ID: 950354571

View in Genome Browser
Species Human (GRCh38)
Location 3:12395731-12395753
Sequence AACCCATCATTTCTGGACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 5, 3: 19, 4: 147}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950354568_950354571 29 Left 950354568 3:12395679-12395701 CCTGCAAGTAATGAAAATAAACA 0: 1
1: 0
2: 1
3: 39
4: 465
Right 950354571 3:12395731-12395753 AACCCATCATTTCTGGACCATGG 0: 1
1: 0
2: 5
3: 19
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950354571 Original CRISPR AACCCATCATTTCTGGACCA TGG Intronic
903624780 1:24722726-24722748 AACCCACCAATTCTGGACACAGG + Intergenic
904326585 1:29730531-29730553 AAGCCATCATTTCTTGACCATGG + Intergenic
904430793 1:30462802-30462824 GAGCCATCATTTCTTGACCATGG - Intergenic
904573107 1:31482725-31482747 AACCCACAATCTCTGGACCTCGG + Intergenic
904596559 1:31649966-31649988 AACCAGTCATTTCTGGGCCTTGG + Intergenic
904902758 1:33870316-33870338 AACCCATCCTTTAGAGACCAAGG - Intronic
907238693 1:53068862-53068884 ACCCCATCCTTGCTGGACCCGGG + Intronic
909221563 1:72969043-72969065 TCCCCAACATTTTTGGACCAGGG + Intergenic
909608563 1:77531015-77531037 AACCCACCATTTCCGGACACAGG - Intronic
912370998 1:109173952-109173974 AACCCTTCCTTTCTGGATCCTGG + Intronic
913216734 1:116627308-116627330 TACGCTTCATTTCTGGACCTAGG + Intronic
916564403 1:165960753-165960775 AGCCCATGATTTCTGCCCCAGGG - Intergenic
917688964 1:177448008-177448030 AATCCATCAATTATGGCCCAGGG - Intergenic
920561008 1:206938590-206938612 AACCCATCCTTTCAGGATCTTGG + Intronic
1065693209 10:28356351-28356373 AAGCCACCATATCTGGCCCATGG - Intergenic
1068746194 10:60533298-60533320 ATCCCATCATGTTTGGATCAAGG + Intronic
1069132552 10:64724769-64724791 AACCCAACATTTAAGGACTAGGG + Intergenic
1070131228 10:73656681-73656703 AACCCAGCACTTTGGGACCAAGG + Intronic
1070996667 10:80789711-80789733 AACCCCTCATTTGTGTACCGTGG + Intergenic
1071145700 10:82568151-82568173 TACCCTTCATTGCTGGATCATGG + Intronic
1073611314 10:104946765-104946787 AACCCATCACATGTGGCCCAAGG + Intronic
1074748294 10:116557801-116557823 TACCCCTTATTTCTGGACCAAGG - Intronic
1076193523 10:128499210-128499232 AACCCAGCATTCCTGGGGCAGGG + Intergenic
1077674622 11:4185338-4185360 AAGCCATAATTTCAAGACCAAGG + Intergenic
1082017072 11:47497805-47497827 ATCCCATTAAATCTGGACCATGG - Intronic
1084370622 11:68740237-68740259 ATCCCAACAGTTCTGGTCCATGG + Intronic
1084749319 11:71193757-71193779 AACCCACCCTGTCTGGACCTGGG - Intronic
1091148798 11:133306168-133306190 CACTCATGATTTCAGGACCAAGG - Intronic
1091389803 12:119092-119114 CACCCAACTTTTCTGGACCACGG - Intronic
1093012527 12:14124113-14124135 AATCCATCATTTCTAAAACATGG + Intergenic
1097213100 12:57387472-57387494 AACCCACCAATTCTGGACAAAGG + Intronic
1100884945 12:99059240-99059262 AACACCTCATTTCTTCACCAAGG - Intronic
1100972715 12:100088279-100088301 ACCCCAACACTTCTGGGCCAGGG + Intronic
1102540336 12:113614390-113614412 GACCCATCATTTCTTGCCCAAGG + Intergenic
1103103043 12:118197455-118197477 ATCCCATTAGTTCTAGACCAGGG + Intronic
1104352298 12:128055581-128055603 AACCCATCAGTTCTGCAGCAGGG + Intergenic
1105324670 13:19359560-19359582 AAGCCACCATGTCTGGCCCAAGG - Intergenic
1108324625 13:49318175-49318197 GAGCCATCATTCCTGGCCCAGGG - Intronic
1108542744 13:51459441-51459463 ACACCATTATTTTTGGACCATGG + Intergenic
1111812232 13:93105325-93105347 AACCCTTCATTTCTGAAAAAAGG - Intergenic
1117912211 14:60647356-60647378 AACCCATCCTTTCTGGGCAGGGG + Intronic
1122248176 14:100418895-100418917 AGCCCATCATTTCAAGGCCAGGG - Intronic
1122401554 14:101470334-101470356 GACCAATTATTTCTGTACCATGG - Intergenic
1123495368 15:20817906-20817928 AACGCATCATTTCTGTGCCATGG - Intergenic
1123551856 15:21386999-21387021 AACGCATCATTTCTGTGCCATGG - Intergenic
1123919224 15:25058783-25058805 AACCCAACAATTCAAGACCAAGG - Intergenic
1125205852 15:37153031-37153053 AACCCATGAGTTCTGAAGCAAGG + Intergenic
1128496235 15:68200151-68200173 AACACAACTTTTCTGGACAATGG + Intronic
1129261860 15:74373198-74373220 CACCCATCGTGGCTGGACCATGG + Intergenic
1130295346 15:82643746-82643768 AGCCCCTCATTTCTGGGGCAGGG + Intronic
1202960202 15_KI270727v1_random:114241-114263 AACGCATCATTTCTGTGCCATGG - Intergenic
1134315651 16:13116610-13116632 ATCCCATCATTTCTGGAGCATGG + Intronic
1134818016 16:17222233-17222255 AAGCCAGCACTTCTTGACCAGGG + Intronic
1138926866 16:61603090-61603112 AATCCCTCATTTCTTGATCATGG - Intergenic
1139676604 16:68528216-68528238 AACCCACCAATTCTGGACACAGG + Intergenic
1143787744 17:9268817-9268839 AAGCCATCAATTCTAGAACATGG + Intronic
1144145002 17:12388838-12388860 TACCCATCACTTCTTGACTACGG - Intergenic
1149361637 17:55901592-55901614 AAGCCATCATTTTTCCACCAAGG - Intergenic
1149555755 17:57572282-57572304 AACCCAAAATTTCTGGAACAGGG - Intronic
1152451370 17:80383102-80383124 GACCCTTCCTTTCTGGACCGAGG - Intronic
1153226579 18:2905054-2905076 AACCCAGCCTTTCTCAACCAGGG + Intronic
1154452768 18:14490392-14490414 AACACATTATTTCTGTGCCATGG - Intergenic
1155086918 18:22467724-22467746 AACCCATCGATTCTGGAACATGG - Intergenic
1164750578 19:30651547-30651569 AAACTATCATTTGTGAACCACGG - Intronic
1167518456 19:49937775-49937797 AACCAATCATTTCTGGCCTCTGG + Intronic
931527576 2:63173675-63173697 AAGCCATCATTTCTGGGCTTTGG - Intronic
931913403 2:66926659-66926681 ATCACATCTTTTCTGGACTAAGG + Intergenic
933074460 2:77905789-77905811 AACCCCGCATTTCTGGCCCCTGG + Intergenic
933436940 2:82260576-82260598 CTCCCATCCTTTCTGGTCCAAGG - Intergenic
935896679 2:107746622-107746644 AACCCACCAATTCTGGACACAGG - Intergenic
937273241 2:120668655-120668677 AATCCATCATTTCTAGACCAGGG - Intergenic
937594066 2:123651920-123651942 AGCCCATCAAGTCTGCACCAAGG - Intergenic
941677632 2:168361197-168361219 AGCCCATCATTTCTGCCCTAGGG + Intergenic
945622426 2:212157191-212157213 TCCCCAGCATTTCTGGGCCATGG + Intronic
947744184 2:232499231-232499253 ATCCCCTCACTTCTGGGCCACGG + Intergenic
948535866 2:238646329-238646351 ATCCCATCACTTTTGGACCATGG - Intergenic
1169850122 20:10039242-10039264 ATCCCATCATCTCAAGACCATGG + Intronic
1170622630 20:18008275-18008297 AACCCACCAGTTATGGATCAAGG - Intronic
1170745114 20:19092096-19092118 AACCCATCATCAGTGGTCCATGG - Intergenic
1172263291 20:33587847-33587869 AACTCATGATTTCTGTCCCAAGG + Intronic
1174757961 20:53178287-53178309 AACTCATCATTTCTGTAGAAAGG + Intronic
1176443270 21:6797896-6797918 AACACATTATTTCTGTGCCATGG + Intergenic
1176821438 21:13662939-13662961 AACACATTATTTCTGTGCCATGG + Intergenic
1179024277 21:37667375-37667397 AGCCCATCCTGTCTGGACCAGGG + Intronic
1180818092 22:18805688-18805710 TACGCTTCATTTCTGGACCTAGG + Intergenic
1181204310 22:21240143-21240165 TACGCTTCATTTCTGGACCTAGG + Intergenic
1203222612 22_KI270731v1_random:55272-55294 TACGCTTCATTTCTGGACCTAGG - Intergenic
1203268217 22_KI270734v1_random:31542-31564 TACGCTTCATTTCTGGACCTAGG + Intergenic
949619224 3:5791278-5791300 AAACTATCATTCCTGGACCTGGG + Intergenic
950354571 3:12395731-12395753 AACCCATCATTTCTGGACCATGG + Intronic
950601402 3:14038436-14038458 AACCCACCAATTCTGGACGCAGG + Intronic
952045397 3:29312956-29312978 ACCCCATCATTTCAGGACAGAGG + Intronic
953820024 3:46199994-46200016 AAACAAGCATTTCTGGACCCTGG + Intronic
956465676 3:69518681-69518703 AACCCAACATGTTTGGAACAAGG + Intronic
957255915 3:77837819-77837841 AAATCTTCATTTCTGGACCTGGG + Intergenic
957522223 3:81332872-81332894 AACCCATCCTTTATTGACGATGG - Intergenic
957591835 3:82209242-82209264 TACTCATCATTTCTGAAGCATGG + Intergenic
961159208 3:124707596-124707618 AACCCCACATTTCTGGCCAAAGG + Intronic
962050506 3:131809246-131809268 AACCCATCATTACTGGTTTAAGG + Intronic
962806854 3:138933731-138933753 AACCTATCATTTCTGGGAGATGG + Intergenic
963184742 3:142401725-142401747 AACACATAACTTCTTGACCAAGG + Intronic
964107415 3:153054334-153054356 TACCCAAGATTTCTGGGCCAAGG - Intergenic
964353315 3:155824698-155824720 AAACCATGATTTTTGGATCATGG + Exonic
965906615 3:173715421-173715443 CACCCATCACTTATGGAACAAGG - Intronic
967323575 3:188217435-188217457 AACCCATCACATCTGGACTCAGG - Intronic
967326615 3:188246895-188246917 ATCCCATCATTTCTGGTCTGAGG - Intronic
969272684 4:6113452-6113474 ATCCCAGCAATTCTGGAGCAGGG + Intronic
970189807 4:13503780-13503802 AAGCAATCATTTCTGGAGGAAGG + Intergenic
972836211 4:42873019-42873041 AAACTATCATTTCTGGTCCATGG + Intergenic
975220154 4:71805113-71805135 AACCCATGATTCCTGGAAGAAGG - Intergenic
975220725 4:71809628-71809650 AACCCATGATTCCTGGAAGAAGG - Intergenic
980922435 4:139100439-139100461 AGCCCAGCATTTCTGGACTCAGG - Intronic
981053448 4:140334815-140334837 GAGCCATCATGTCTGGCCCATGG - Intronic
981167535 4:141579703-141579725 TAACCATCATTTCTGGAACAAGG + Intergenic
986670594 5:10139684-10139706 AGCCCACCACTTCTGGCCCAAGG - Intergenic
988207768 5:28162450-28162472 AACATATCATTCCTGGACCTAGG + Intergenic
988266438 5:28957317-28957339 AACCTATCATCTCTTGACCTAGG - Intergenic
988605104 5:32672569-32672591 AACCCACCAATTCTGGACACAGG - Intergenic
991206633 5:64057642-64057664 ATCCCATCATGCCTGAACCATGG + Intergenic
994118119 5:96083833-96083855 AACCCATCATCTCAAAACCATGG + Intergenic
996410342 5:123151860-123151882 AACCCCTCATTTTTTAACCAGGG + Intronic
996625340 5:125563973-125563995 AACATATTATTTATGGACCATGG + Intergenic
999973083 5:156884293-156884315 AGCCCATCATTTTGGGTCCAAGG + Intergenic
1000417174 5:160995376-160995398 AACCCTTGATTCCTGGACCTGGG - Intergenic
1001178368 5:169494545-169494567 AATCCATCCTTTCAGGAACAAGG - Intergenic
1001282920 5:170400717-170400739 AACACAGCATTTCTTGTCCAAGG + Intronic
1003344856 6:5257534-5257556 AACCCATCAGTACTGGTCCGTGG + Intronic
1003463832 6:6358102-6358124 AACACATCAGTTCTGGACAGAGG - Intergenic
1003468111 6:6400866-6400888 AACCCAAGGTTTCTGGAGCAAGG + Intergenic
1004142957 6:13037552-13037574 AACCCATCATTTCTGCCTCAAGG - Intronic
1004799098 6:19125903-19125925 AAAACATCATTTCTAAACCAAGG - Intergenic
1005087158 6:22018897-22018919 AAGCCATGAGTTCTTGACCAGGG - Intergenic
1005130304 6:22499101-22499123 AATCCATCATTTGTGGAGTAGGG - Intergenic
1006455559 6:34129985-34130007 AACCCATCATTAGGGGAGCAGGG + Intronic
1010770383 6:79821868-79821890 AACCAATCAGTTCTTGCCCATGG + Intergenic
1012212405 6:96537515-96537537 AAGCCATCAGCTCTGGAACATGG + Exonic
1013186184 6:107760626-107760648 AACACATCATCTCTGGAGAAAGG + Intronic
1013386370 6:109635677-109635699 AACCCTTAGTTGCTGGACCATGG - Intronic
1017238638 6:152143287-152143309 AACTAATAATTTTTGGACCAAGG - Intronic
1018612466 6:165659931-165659953 GCCCCATCATTTCAGGACCGCGG + Intronic
1018934672 6:168265912-168265934 AAACCATCACTTCTGATCCATGG - Intergenic
1019891355 7:3949624-3949646 AATCCAACATTTCTAGAACAGGG - Intronic
1021001099 7:15331345-15331367 CAGCCATAATTTCTGGAACAGGG + Intronic
1021006026 7:15396175-15396197 AACCCACCATTTCTGGACGAGGG - Intronic
1024501418 7:50112325-50112347 AAACCATGGTTTCTGGACCTTGG + Intronic
1027875939 7:83768119-83768141 AACCCATCATTCCTGGAACAAGG - Intergenic
1028383024 7:90220009-90220031 AAGCCATCATGTCTGGCCCTTGG + Intronic
1032437301 7:131910614-131910636 AACCCACCAATTCTGGACACAGG + Intergenic
1032487157 7:132296617-132296639 AAGCCAGCATTTCTGAACCTGGG - Intronic
1032639864 7:133754088-133754110 GACCCATCATTTCTCAACCAGGG - Intronic
1033085719 7:138339809-138339831 TGCCCATGATTTCTGGAACAAGG + Intergenic
1035092865 7:156329131-156329153 AACTCATCACTTCTGGTGCAAGG + Intergenic
1036218481 8:6900851-6900873 AACAAATCATCTCTGCACCATGG + Intergenic
1037634461 8:20688786-20688808 GAACCATCAGTTCTGGGCCAGGG - Intergenic
1037684518 8:21127375-21127397 AGCCCATCATTTCAGTAGCAGGG + Intergenic
1038278551 8:26142096-26142118 AACCCATCATCTCTGGATTCTGG - Intergenic
1039671494 8:39605221-39605243 AACCCACCATTTCTCTTCCAAGG - Intronic
1040870129 8:52092129-52092151 GACCCACCATCTGTGGACCAAGG + Intergenic
1042940954 8:74107410-74107432 AACTCATCACTTCTTGACCTTGG + Intergenic
1057423707 9:94931656-94931678 GGCCCATCATTTCAAGACCATGG - Intronic
1058459445 9:105169480-105169502 AACACATCATTTCTGCCTCAGGG + Intergenic
1061872002 9:133525949-133525971 CACCCATCATTCCTTGGCCAGGG - Intronic
1185446750 X:261909-261931 AAACCATCATTTCTAATCCAGGG + Intergenic
1187351194 X:18519022-18519044 AATCCATCATTACTACACCAAGG - Intronic
1187526673 X:20060875-20060897 AACCCCTCATGTCTGTGCCAGGG - Intronic
1189634515 X:42991600-42991622 AACTCAAGATTTCTGGAACAAGG - Intergenic
1192718216 X:73665420-73665442 AACCCATGATTCCTGGAAGAAGG - Intronic
1195709929 X:107765528-107765550 AATCCATCATTTATTGACCAAGG - Intronic
1197252219 X:124228135-124228157 AAACCATCCTTTCAGGACCATGG + Intronic
1197724778 X:129768976-129768998 AACCCATCATTCCTAAACCCTGG + Exonic
1200973960 Y:9187783-9187805 AACCCACCAATTCTGGACACAGG + Intergenic
1202136919 Y:21675842-21675864 AACCCACCAATTCTGGACACAGG - Intergenic