ID: 950354902

View in Genome Browser
Species Human (GRCh38)
Location 3:12399006-12399028
Sequence GTGCCTCTCTGTACTGGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 195}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950354902 Original CRISPR GTGCCTCTCTGTACTGGCTC TGG (reversed) Intronic
900703556 1:4062370-4062392 GTGCCTTCCTGGAGTGGCTCAGG + Intergenic
901451945 1:9341205-9341227 GTGCCTCTCTGTTCTGAGGCCGG - Intronic
901769977 1:11525018-11525040 GTGCCCCTCTCTACTGGACCAGG - Intronic
902470691 1:16646140-16646162 GTGCCTCTGTGTAGTGGCCCAGG - Intergenic
902488113 1:16761320-16761342 GTGCCTCTGTGTAGTGGCCCAGG + Intronic
902893904 1:19465582-19465604 GTGACTCTGTGCAATGGCTCAGG + Intronic
902955635 1:19922747-19922769 CTCCCTCTCTGCAGTGGCTCTGG - Exonic
903248106 1:22031704-22031726 CTGCCTCTGTGGTCTGGCTCCGG + Intergenic
903795796 1:25927999-25928021 GTCCCTCTCTGTAGCTGCTCTGG + Intergenic
903927137 1:26838722-26838744 GTGCCTCTGTGTGGTGACTCTGG - Intronic
904674653 1:32191499-32191521 GTGTCTCACTGTAGTGGCCCAGG - Intronic
905945546 1:41898497-41898519 TTACCTCCCTGTCCTGGCTCAGG + Intronic
906294563 1:44641498-44641520 TTGCCTCTGAGTACTGGCTTGGG + Intronic
909131141 1:71738661-71738683 CTGCCTGTGTGTCCTGGCTCTGG + Intronic
910814980 1:91282300-91282322 TTGCTTCTCTGTGCTTGCTCTGG + Intronic
910943843 1:92566836-92566858 GTGCCCCTCTGTCCAGGCTGGGG + Intronic
912459885 1:109823604-109823626 GTGCCTCACTGTCCAGCCTCAGG - Intergenic
914990767 1:152497844-152497866 CTGCATCTCTGTTCTGGCTCTGG + Intergenic
916107813 1:161443515-161443537 GTGCCTCTCTCGACTGACTTAGG + Intergenic
916109397 1:161450888-161450910 GTGCCTCTCTCGACTGACTTAGG + Intergenic
916110984 1:161458319-161458341 GTGCCTCTCTCGACTGACTTAGG + Intergenic
916112570 1:161465679-161465701 GTGCCTCTCTCGACTGACTTAGG + Intergenic
918793125 1:188857568-188857590 GTCCCTCTCTGGGCTGGCTGAGG + Intergenic
919220012 1:194616376-194616398 GTTCCTCTCAGCACTGGATCTGG - Intergenic
923448714 1:234096613-234096635 TTGCCTCTCACCACTGGCTCTGG - Intronic
1067054837 10:43044486-43044508 GTGCCTCACTGCTCTGCCTCCGG - Intergenic
1067728525 10:48791793-48791815 GTGTCTCTCGCTACTGGGTCAGG + Intronic
1067916860 10:50409034-50409056 GTGCCTCTCACTACTGGGTCTGG - Intronic
1071718613 10:88120819-88120841 TTCCCTCTCAGAACTGGCTCTGG + Intergenic
1073327933 10:102653207-102653229 GTCCCTCCCTGTCCTGGCTACGG - Intronic
1073541411 10:104318616-104318638 GAGCCTCCTTGTACTGGCACAGG + Intronic
1075067543 10:119299559-119299581 GTGCCTCACTTTAGTGGTTCTGG + Intronic
1075279785 10:121129617-121129639 GTGACTCTCCCTCCTGGCTCCGG - Intergenic
1076857100 10:133122747-133122769 GTGCCTCCCTGGCCTGGCCCTGG + Intronic
1077118169 11:894767-894789 GGGCCTCTGGGTACTGGCTGAGG - Intronic
1077134139 11:990343-990365 GTCCCTCTCTGGCCTGGCTGGGG + Intronic
1077288736 11:1779155-1779177 CTGCCTCTCTCTGTTGGCTCTGG + Intergenic
1080416972 11:32077891-32077913 GAGCCACTCTGTACTGGCACTGG + Intronic
1083637780 11:64129648-64129670 TTGCCTCTCTGTGCTGGACCTGG - Intronic
1084775532 11:71372279-71372301 GTGCCTGTCTTTACTGCTTCTGG - Intergenic
1086821967 11:91445996-91446018 CTGCATCTCTGCACTGGCTTTGG + Intergenic
1090671802 11:128952787-128952809 GTTCCTTTCTGTACTGTCTAGGG + Intergenic
1091602247 12:1925058-1925080 GTGCCTCTCAGCACTTCCTCTGG - Intergenic
1093540049 12:20271595-20271617 GTGCCTACCTGTACTGGTCCTGG - Intergenic
1093911154 12:24748788-24748810 GTGCCTCTCTGTCATATCTCAGG - Intergenic
1095744637 12:45644048-45644070 ATGCCTCTGTCTACTGGCACTGG + Intergenic
1095860888 12:46917125-46917147 GAGGCTCTCTGTAGTGACTCTGG - Intergenic
1095977186 12:47947691-47947713 GTCCCTCACTGTCCTGGCGCAGG - Intergenic
1096260811 12:50089870-50089892 CTTCCTCTCTGTAGTGGCACAGG + Exonic
1097226297 12:57478531-57478553 GTGACTCACTGTGCTGGCACTGG + Exonic
1099679571 12:85807632-85807654 GTGCCTCTCCGTGCTGGGTAGGG - Intronic
1102738557 12:115185596-115185618 GAGCCACTCTGTGTTGGCTCAGG + Intergenic
1104791131 12:131482808-131482830 GTGCCTCGCTGGGCTGGCCCAGG - Intergenic
1112258210 13:97853846-97853868 GGGGCTTTCTGAACTGGCTCCGG + Intergenic
1113610924 13:111644815-111644837 GTGCCTCTCTCTCCTGCCTGGGG + Intronic
1117051535 14:51865256-51865278 GTGCCTGTCTTTACTAGATCTGG + Intronic
1117183701 14:53217915-53217937 GCCCCTCTCTGTGCTGGCTGAGG - Intergenic
1120912363 14:89678876-89678898 ATGCCTCTCTGTACTCCCTTGGG - Intergenic
1121253702 14:92516759-92516781 GTGCCCCTCTATCCTGGCCCTGG + Intronic
1121393508 14:93596945-93596967 GTGCCCACCAGTACTGGCTCTGG - Intronic
1122423179 14:101590092-101590114 GTGCCCCAGTGTCCTGGCTCAGG - Intergenic
1122587184 14:102817054-102817076 GTTCCTCTCTGATCTGCCTCTGG - Intronic
1126230197 15:46314884-46314906 GTGCCCACCTGTACTGGTTCAGG + Intergenic
1127203386 15:56684078-56684100 CTGCTTCTCTGTACTGAATCAGG - Intronic
1127281860 15:57499800-57499822 ATTCCTCTTTGTACTGGGTCAGG - Intronic
1128689375 15:69711663-69711685 GAGCATCTCTGTATTGACTCTGG - Intergenic
1130320260 15:82835637-82835659 GTGCCTCACTGTGCTGGCCCAGG + Exonic
1131057019 15:89381026-89381048 CAGCCTTTCTGTACTTGCTCAGG + Intergenic
1132282438 15:100631973-100631995 GTGCCTCCATGTACAGACTCTGG - Intronic
1132510779 16:340318-340340 GTGCATCACTGGACTGGCCCGGG + Intronic
1133438815 16:5803313-5803335 GGTCCTCTTTGTACTGGCTTTGG + Intergenic
1134191230 16:12122555-12122577 GTGCCTCTGTGTCTTGGCACAGG - Intronic
1134613939 16:15634828-15634850 GTCCCTCTGTGTAATGGCTGTGG - Exonic
1134846544 16:17445581-17445603 GCGACTCTCACTACTGGCTCAGG + Intronic
1136266433 16:29122506-29122528 GAGCATCTCTGTTCTGGCACGGG + Intergenic
1137596036 16:49724585-49724607 TTGCCTTTTTGTGCTGGCTCAGG - Intronic
1140479010 16:75252539-75252561 GTGCCTCCCTGGCCTGGCCCAGG - Intronic
1140840310 16:78832254-78832276 GGGCCTCTCTGTACAGCTTCAGG + Intronic
1141850968 16:86645710-86645732 GTCCCCCTCTGGACTGGCACAGG + Intergenic
1141940642 16:87273796-87273818 GTGCCTCACTGTCCTGGCCCGGG + Intronic
1142055281 16:87990461-87990483 GAGCATCTCTGTTCTGGCACGGG + Intronic
1142381815 16:89737097-89737119 ATGCATTGCTGTACTGGCTCTGG - Intronic
1142911013 17:3091008-3091030 GTGCTACTCTGTGCTGGCTTGGG + Intergenic
1146932978 17:36791240-36791262 GAGCCTCTCTGTGCTGGCACGGG - Intergenic
1148158781 17:45438100-45438122 GTGCCTCTCCGTTCTGGAACAGG + Intronic
1149623170 17:58061051-58061073 GTGGGTCTCTGTCCTGCCTCTGG - Intergenic
1151751494 17:76041010-76041032 GTGCTTCTCTGACCTGGCCCTGG - Intronic
1153237045 18:2998140-2998162 GTACCTCCCTTTCCTGGCTCTGG + Intronic
1156228632 18:35132900-35132922 GGGCCTCTCTCTCCTGGCACTGG - Intronic
1158118800 18:54025950-54025972 GTGCCTCCTTGTTCTGCCTCAGG + Intergenic
1158796805 18:60856220-60856242 GTGCATCACTGTCCTGGCTCAGG + Intergenic
1159005174 18:63004671-63004693 GGGCCTCTCCCTCCTGGCTCTGG - Intergenic
1159534790 18:69702473-69702495 TTGCCTGTGTGTACAGGCTCAGG - Intronic
1159629452 18:70732612-70732634 ATGCCTTTGTGTACTTGCTCGGG + Intergenic
1165449493 19:35873942-35873964 TTGCCTCTCAGGGCTGGCTCTGG + Intronic
1166197892 19:41218971-41218993 GTGTCTCTCTATCCGGGCTCTGG - Intergenic
1166294472 19:41882380-41882402 GTGCCTCTCTGTCATTGCCCCGG - Intergenic
1167104569 19:47422365-47422387 GTGCCTCTGGGTCCTGTCTCCGG + Intergenic
1167426075 19:49430414-49430436 GCTCCTCTCTGTCCTGCCTCAGG - Exonic
1168419454 19:56191681-56191703 TTCCCTCTCTGTGATGGCTCAGG + Intronic
1168421550 19:56207409-56207431 TTCCCTCTCTGTGATGGCTCAGG - Intronic
1168423895 19:56223462-56223484 TTCCCTCTCTGTGATGGCTCAGG + Intronic
1202703086 1_KI270713v1_random:2920-2942 GTGCCTCTGTGTAGTGGCCCAGG - Intergenic
925636841 2:5948917-5948939 GTGTCTCTGTCTACTGGCTGGGG - Intergenic
927218670 2:20686126-20686148 GTGCCTCTCCATCCTGGCTCTGG + Exonic
928399344 2:30966592-30966614 GAGCCACTGTGCACTGGCTCAGG - Intronic
930096510 2:47570482-47570504 GCGCCCCTCTGTCCGGGCTCTGG - Exonic
935815558 2:106843354-106843376 GGGCCTTCCTGTACCGGCTCTGG - Exonic
937146881 2:119655034-119655056 GTCCCTGTCTGTCCAGGCTCTGG - Intronic
938925548 2:136037990-136038012 GCCCCTCTCTCTCCTGGCTCTGG + Intergenic
947435324 2:230068057-230068079 ATGCCTCTCTGCACAGGCTGTGG - Intronic
948681774 2:239640033-239640055 CTGCCTCTCACCACTGGCTCAGG + Intergenic
948865630 2:240773380-240773402 GTGCCAGGCTGTGCTGGCTCAGG - Intronic
1170893673 20:20396081-20396103 CTGCCTTTCTGTCCTGGGTCTGG - Intronic
1172163606 20:32885424-32885446 GTGGCTCTCTGTTCTGCCGCAGG + Intronic
1173229298 20:41181642-41181664 CTCCCTCTCTCTCCTGGCTCTGG - Exonic
1174681642 20:52414474-52414496 GTGCCTCAGTGTACTAGCTCTGG - Intergenic
1175998260 20:62820923-62820945 GTGCCTCTCAGCCCTGCCTCAGG + Intronic
1176148224 20:63574733-63574755 TTGGCTCTCTGGACTGGCTCTGG + Intergenic
1180078802 21:45476981-45477003 GTGGCTCTGGGTACAGGCTCTGG + Intronic
1180115925 21:45704981-45705003 GTGCCTCTTTTTTCTGGCTTCGG + Intronic
1180702309 22:17788264-17788286 GCGCCTCTCTGCAAAGGCTCGGG + Exonic
1181580159 22:23823724-23823746 CTGCCTCTCTGTGTTGGCCCAGG - Intronic
1182556996 22:31134520-31134542 CTGCCTCTCTGTCCTGGCCAGGG + Exonic
1183332849 22:37230532-37230554 GTGCTTCTTTGTAGTGGCTCAGG - Intronic
1184100913 22:42341412-42341434 GTCCCTCCCTGTCCTGTCTCGGG - Intronic
1185278327 22:49959400-49959422 GTGGCTCTCGGGACTGGCCCAGG - Intergenic
950354902 3:12399006-12399028 GTGCCTCTCTGTACTGGCTCTGG - Intronic
950475844 3:13214376-13214398 GTGCCTGCCTGTGCTGGCTGTGG - Intergenic
951551931 3:23882956-23882978 GCCCCTCTCTGTGCTGGCTGAGG - Intronic
954298740 3:49688114-49688136 GTGCCTCTGTTTAGTGGCCCAGG + Intronic
954712433 3:52511832-52511854 GTGTCTCTCTGTACCCCCTCAGG + Intronic
954751782 3:52818039-52818061 GTGCCTCTCTCACCTTGCTCAGG + Exonic
954919056 3:54174105-54174127 CTGCCTTTATGTACTGTCTCTGG - Intronic
955108983 3:55929092-55929114 GAGCCTCTCTCTACTGGCTGAGG - Intronic
956919640 3:73913451-73913473 TTCCCTCTCTGTTTTGGCTCTGG - Intergenic
961584524 3:127911089-127911111 GTGGCTCTCTCTACTGTATCAGG + Intergenic
962177301 3:133167813-133167835 GCCCCTCTCTGTGCTGGCTGAGG - Intronic
963883554 3:150554846-150554868 ATGCATTTCTGTACTGGCTCAGG - Intronic
968273613 3:197423536-197423558 CTGCCTCTCTTTCCTGGTTCTGG - Intergenic
968273638 3:197423644-197423666 CTGCCTCTCTTTCCTGGTTCTGG - Intergenic
968961510 4:3747246-3747268 GCGCCCCTCCGTGCTGGCTCTGG - Intergenic
969330224 4:6470598-6470620 GTGCCTCGGTGGCCTGGCTCGGG - Intronic
971043400 4:22779001-22779023 GCCCCTCTCTGGACTGGCTGAGG - Intergenic
974579060 4:63770720-63770742 ATGTATCTCTGTACTGGCTTGGG + Intergenic
974913211 4:68148449-68148471 GTCTTTCTCTCTACTGGCTCTGG - Intergenic
980836098 4:138194478-138194500 GTGCCACTATCTAATGGCTCAGG + Intronic
982470619 4:155785991-155786013 GTGCCTATCTTTAGTGACTCAGG + Intronic
984188870 4:176580670-176580692 CTCCCTCACTCTACTGGCTCAGG - Intergenic
988755659 5:34245235-34245257 GCCCCTCTCTGTGCTGGCTGAGG - Intergenic
991743910 5:69711006-69711028 GCCCCTCTCTGTGCTGGCTGAGG - Intergenic
991753799 5:69844236-69844258 GCCCCTCTCTGTGCTGGCTGAGG + Intergenic
991795482 5:70290738-70290760 GCCCCTCTCTGTGCTGGCTGAGG - Intergenic
991803416 5:70400963-70400985 GCCCCTCTCTGTGCTGGCTGAGG + Intergenic
991823280 5:70586274-70586296 GCCCCTCTCTGTGCTGGCTGAGG - Intergenic
991833115 5:70719349-70719371 GCCCCTCTCTGTGCTGGCTGAGG + Intergenic
991887849 5:71290257-71290279 GCCCCTCTCTGTGCTGGCTGAGG - Intergenic
998006679 5:138661778-138661800 GTGCCTCCCTGCGCTGGCTGAGG - Intronic
998158431 5:139799415-139799437 GTGCCTCTCACTACTTTCTCTGG - Intronic
998330987 5:141327025-141327047 GTGCCACGCTGCACAGGCTCAGG - Intergenic
998699579 5:144682885-144682907 GTGCCTCTATGTCCTGGTTTAGG + Intergenic
999671225 5:153960540-153960562 GTGCCTGATTGTCCTGGCTCTGG + Intergenic
1000849081 5:166317890-166317912 GTGTCTCTCTGCTCTGTCTCTGG - Intergenic
1001323834 5:170704872-170704894 CTGCCTCTCTATATTGTCTCAGG - Intronic
1003111990 6:3258747-3258769 GTACCTCTCTGGACGGGCTGGGG - Intronic
1005554298 6:26957010-26957032 GCCCCTCTCTGTGCTGGCTGAGG - Intergenic
1006030405 6:31173246-31173268 GGGACTCTCTGGACTGGCTTGGG - Intronic
1006626674 6:35402676-35402698 GTGACTCTCTGGGCTGACTCTGG + Intronic
1007816620 6:44529584-44529606 GCCCCTCTCTGCCCTGGCTCCGG + Intergenic
1008974361 6:57407627-57407649 GTGCCACTGTGTACCGCCTCAGG - Intronic
1009163250 6:60309146-60309168 GTGCCACTGTGTACCGCCTCAGG - Intergenic
1009700095 6:67165823-67165845 GTGATACTCTGTACTGCCTCAGG - Intergenic
1010753562 6:79641442-79641464 CTACCTCTCTGTCCTGGCTATGG + Intronic
1012865875 6:104617192-104617214 GTGATGCCCTGTACTGGCTCAGG + Intergenic
1014732767 6:125053045-125053067 GGGCCTCTGTGTGGTGGCTCAGG + Intronic
1015279155 6:131414407-131414429 GTGTCTCTTTATACTGGTTCAGG - Intergenic
1016690428 6:146931363-146931385 GTTCCTCTTAGTCCTGGCTCTGG - Intergenic
1017129921 6:151099409-151099431 CAGCCTCACTGTAGTGGCTCTGG - Intronic
1017217820 6:151930919-151930941 GTGCTTCCCTGCCCTGGCTCTGG + Intronic
1017524453 6:155230290-155230312 CTGCCTCTCTGTCCTGCCTTGGG + Intronic
1017632355 6:156408871-156408893 GTGCCTCACTGTCCTGTCTCTGG - Intergenic
1018909936 6:168096088-168096110 CTGCCTCTCAGTGCTGGCCCCGG - Intergenic
1019524942 7:1476624-1476646 CTGCCTCTCTGGACTTCCTCTGG - Exonic
1021359460 7:19692654-19692676 GCCCCTCTCTGGACTGGCTGAGG - Intergenic
1021965815 7:25916751-25916773 GTGCATCACTGTACTCGTTCGGG - Intergenic
1029254641 7:99261359-99261381 GTGCATCTCTACACTGGCCCTGG + Intergenic
1029257944 7:99281909-99281931 GTGCCTCTCCCTGCTGCCTCGGG + Intergenic
1030577782 7:111311632-111311654 GTGGCTCTGTGAACTGGCTCCGG + Intronic
1033129737 7:138735554-138735576 GTGCCCCTCTGGCCTGGCTCAGG - Intronic
1033250426 7:139753785-139753807 CTGCCTATGTGTACTGGGTCAGG - Intronic
1033410305 7:141111422-141111444 GTGCCTGTATTTGCTGGCTCAGG - Intronic
1040060577 8:43100081-43100103 GGGCCTCTCTGACCTGGCCCGGG + Intronic
1040964635 8:53071558-53071580 GTCCCTCTCTGGGCTGGCTGAGG - Intergenic
1041068490 8:54104204-54104226 GAGCCACTCTGTGCTGGCGCAGG + Intergenic
1046770174 8:118110572-118110594 GTGCCTCTTTGTCCTGAGTCTGG - Exonic
1047626130 8:126657957-126657979 CTGCCTCTCTGAATTGGCTACGG + Intergenic
1049212451 8:141392906-141392928 GTGCCTTTCTGTCTTGGCTGAGG - Intronic
1053429494 9:38032736-38032758 GTGCCACGCTGCACTGGCTTTGG - Intronic
1056023958 9:82472404-82472426 GAGCCTCTCTGAACTTACTCTGG + Intergenic
1056430885 9:86526755-86526777 GTGTCTCTCTGTTCTGCTTCAGG + Intergenic
1056676882 9:88683403-88683425 CTGGCTCTCTGCACTGTCTCTGG + Intergenic
1057140705 9:92725273-92725295 GTGCCTCTGTGTTCTGGGTTTGG - Intronic
1057902703 9:98961910-98961932 GGGGCTCTTTGTGCTGGCTCCGG - Intronic
1058713167 9:107698586-107698608 GTGTTTGTCTGAACTGGCTCTGG - Intergenic
1061873759 9:133534090-133534112 GAGCCTCTCTGCCCTGGCCCTGG + Intronic
1188069878 X:25705607-25705629 CTGCTGCTCTGTACTGCCTCAGG + Intergenic
1188667036 X:32836959-32836981 GTGTCTTTCTTTTCTGGCTCTGG + Intronic
1189113927 X:38324454-38324476 GTTTCTCTCTGTGCTGTCTCCGG - Intronic
1190940265 X:55033341-55033363 GTGCCTCTCTGTACTATTCCTGG + Intergenic
1196046409 X:111260574-111260596 GGGCCTCTCTGAATTGGCTCAGG - Intronic
1199622965 X:149715484-149715506 GTCCCTTTCTGTACTGGGGCAGG - Intronic
1200088668 X:153624332-153624354 GTCCCTGTCAGAACTGGCTCAGG + Intergenic
1200304038 X:155007083-155007105 ATGACTTTCTGTACTGGCTGAGG + Intronic
1200317348 X:155147823-155147845 ATGACTTTCTGTACTGGCTGAGG - Intronic
1201499638 Y:14627721-14627743 GCCCCTCTCTGGACTGGCCCAGG - Intronic
1201729981 Y:17192674-17192696 GCCCCTCTCTGGACTGGCTGAGG - Intergenic