ID: 950355371

View in Genome Browser
Species Human (GRCh38)
Location 3:12403831-12403853
Sequence TACTGTATTTTGAAATACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 582
Summary {0: 1, 1: 0, 2: 8, 3: 44, 4: 529}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950355371_950355374 21 Left 950355371 3:12403831-12403853 CCATTGTATTTCAAAATACAGTA 0: 1
1: 0
2: 8
3: 44
4: 529
Right 950355374 3:12403875-12403897 AGAAATTGTACTAAGTGCTGAGG 0: 1
1: 1
2: 10
3: 71
4: 505

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950355371 Original CRISPR TACTGTATTTTGAAATACAA TGG (reversed) Intronic
901288529 1:8103311-8103333 GAGATTATTTTGAAATACAAAGG + Intergenic
901394616 1:8971984-8972006 TACTGTATTGGAAAATATAAAGG - Intronic
903598158 1:24512657-24512679 TTCTGTTCTTTGAAATAAAAGGG + Intronic
906821307 1:48933322-48933344 TAATTTCTTTTAAAATACAATGG + Intronic
908711551 1:67021273-67021295 TAATGCATGTTGAAATATAATGG + Intronic
908922532 1:69212704-69212726 TAATGTATGTAGAAATGCAAAGG + Intergenic
908938641 1:69406070-69406092 TATGGTAATTTGAAATACCATGG + Intergenic
909354639 1:74694392-74694414 TACTTTATTATTAAAGACAAAGG - Intergenic
909559406 1:76992849-76992871 TACTGTTTTGGGAAATACACAGG - Intronic
909911880 1:81269602-81269624 AAATGTATTTTGTAATCCAAAGG - Intergenic
911587544 1:99708289-99708311 AAATATATTTTGAACTACAAAGG - Intergenic
911865486 1:103015113-103015135 TACTGCATTTTGAGTTAAAATGG - Intronic
912272833 1:108228250-108228272 TGCTTTTTTTTGAAATAAAAGGG - Intronic
912295387 1:108466072-108466094 TGCTTTTTTTTGAAATAAAAGGG + Intronic
913036816 1:114975416-114975438 TACATTATTTTAAAATATAAAGG - Intronic
913084295 1:115421720-115421742 AAATTTATTTTGAAATTCAAAGG - Intergenic
913312008 1:117508916-117508938 TACTCTATTTTGAAAAAAATAGG + Intronic
913535357 1:119767048-119767070 TAATTAATTTTGAAACACAAGGG - Intronic
914200760 1:145483150-145483172 TAACCTATTTTGAAATAAAATGG - Intergenic
914398011 1:147289360-147289382 TGCGGTATTTTGAGGTACAAGGG + Intronic
914479875 1:148056278-148056300 TAACCTATTTTGAAATAAAATGG - Intergenic
917405653 1:174704534-174704556 TACTGTACTTTGATAAAGAAGGG + Intronic
917439208 1:175051921-175051943 TACTGTATTTTGAGATTTTAAGG + Intergenic
917546072 1:175969306-175969328 TGCTGTTTTTTCAAATACCAAGG - Intronic
917697730 1:177544544-177544566 TACTGTATTTTCACATATAGAGG - Intergenic
918464729 1:184809489-184809511 TCCTTTTTTTTGAAATGCAATGG + Intronic
918641810 1:186850233-186850255 TATTGTATTGTGATATGCAAAGG + Intronic
918731035 1:187996518-187996540 TACTCTGCTATGAAATACAAAGG + Intergenic
919075165 1:192804530-192804552 TAATGTATATTGAAATACCTTGG - Intergenic
919930456 1:202217821-202217843 TGCTGTATTTTTAAATAAAAGGG - Intronic
922023399 1:221727551-221727573 TACTCTATGTTGAATTAGAAAGG - Intronic
922070724 1:222190521-222190543 GACTCTATTTTCAAATACAGTGG - Intergenic
922207792 1:223463804-223463826 GACTTTATTTTGTAAGACAATGG - Intergenic
922273315 1:224054363-224054385 TAAAGTATTTTGACATAGAAGGG + Intergenic
923441641 1:234026451-234026473 TACAGTCTTTTTAAAGACAAAGG + Intronic
924290202 1:242528091-242528113 TTCTTTATTTTGAAAAACACTGG + Intergenic
1063051764 10:2457374-2457396 TACCATCTTTTGAAATAAAAAGG + Intergenic
1063361365 10:5462189-5462211 TGCAGTATTTTGAAAAGCAAAGG - Intergenic
1064426805 10:15236708-15236730 TACTGAATTCTGAAATATAGTGG + Intronic
1064939834 10:20721616-20721638 TACTGTAATTTCAAAAACATAGG + Intergenic
1065040806 10:21693681-21693703 TGCTGTATTTTGAAATATAATGG - Intronic
1066607848 10:37200710-37200732 TGCTTTATTTTGATAAACAAGGG - Intronic
1067369167 10:45666506-45666528 TAGTATCTTTTGAAACACAAAGG + Intronic
1068015262 10:51507896-51507918 TTCTGTTTTAGGAAATACAAAGG + Intronic
1068291803 10:55012573-55012595 TTCTGTATTTCTAAATTCAATGG + Intronic
1068407433 10:56608602-56608624 TTCTTTATTTTGAAATAAAATGG + Intergenic
1068672928 10:59742290-59742312 TTTTGTATTTTAAAATTCAATGG - Intergenic
1069244262 10:66182616-66182638 TGCCGTATTTTGAAGTACATGGG - Intronic
1069322844 10:67194473-67194495 TACTGTAGTTGGAATTACATAGG - Intronic
1069470060 10:68679979-68680001 TCCTGTTTTTTAAACTACAACGG + Intronic
1070283632 10:75068164-75068186 TACTGTATTTTAAAATGCTAAGG - Intergenic
1074026999 10:109646804-109646826 TACTTCATTTTGAAGGACAAGGG + Intergenic
1074169026 10:110914889-110914911 TACTGAATTTTGAAATAGGAAGG - Intronic
1074543677 10:114386225-114386247 GAATATATTTTGAAATAAAAAGG + Intronic
1074614181 10:115049873-115049895 TAAAGTATTTTTAAATAAAATGG + Intergenic
1074694136 10:116032420-116032442 TACTGTATATTGAAGTATAGTGG - Intergenic
1074949994 10:118324103-118324125 TAATCTATTTTGGAATAGAAAGG - Intronic
1075010796 10:118868500-118868522 TACTTTATTTTCAAGTTCAATGG - Intergenic
1075251437 10:120878996-120879018 TTCTTTATTTTGAAATTCACTGG - Intronic
1076115518 10:127894600-127894622 TATTGTATTTTGTATTACATAGG + Intergenic
1078226636 11:9397773-9397795 TACTGAATATGGATATACAAAGG + Intronic
1079216547 11:18518137-18518159 AATGGTATTTTGAACTACAAAGG - Intronic
1079889912 11:26038921-26038943 TACTGTGTTATGAAATGTAAAGG + Intergenic
1080269803 11:30439160-30439182 TTCTGAATTTGGAAGTACAAGGG - Intronic
1081053298 11:38373982-38374004 TACTGTATTTTAAATTATGATGG + Intergenic
1081173824 11:39901530-39901552 AACTGTGTTGGGAAATACAAAGG - Intergenic
1082192956 11:49269295-49269317 TACCTTATTTAGGAATACAATGG + Intergenic
1085941310 11:81208971-81208993 AACTGAATTTGGAAATTCAATGG + Intergenic
1086076590 11:82860636-82860658 AACTGTATTTTGAAAAATAATGG - Intronic
1086248523 11:84785671-84785693 TACTAGATTTGGAAATACTAGGG - Intronic
1086260941 11:84939729-84939751 TACTGTCATTTGCAATACCATGG - Intronic
1086673173 11:89571779-89571801 TACCTTATTTAGGAATACAATGG - Intergenic
1086701903 11:89907743-89907765 TACTGTTTTTTTATATTCAAAGG - Intergenic
1087022500 11:93617375-93617397 TACTGTTCAGTGAAATACAATGG + Intergenic
1087140872 11:94764775-94764797 TCCAGTAATTTGAAATACCAAGG - Intronic
1087168259 11:95025450-95025472 CAAAGTATTTTGAAAAACAAAGG + Exonic
1087490767 11:98824017-98824039 TATTGTATTTTAAAATATAGAGG - Intergenic
1087933484 11:104004608-104004630 TGCAGTATTTTGAACTACAGGGG + Intronic
1088617807 11:111649111-111649133 TACAGTATGCTGAAATATAAGGG - Intronic
1088680092 11:112232863-112232885 AACTGAATTCTGAATTACAATGG + Intronic
1090119386 11:124008978-124009000 TAATGTATTATGTAATATAATGG - Intergenic
1090186789 11:124744522-124744544 TTCTGGACTCTGAAATACAAAGG + Intronic
1090866684 11:130707075-130707097 CACTGCATGTTGAAATACATGGG + Intronic
1091419811 12:326901-326923 CACTGTATTTCAAAATCCAATGG - Intronic
1092702218 12:11244576-11244598 TTCTGTTTTTTGAAGTACACTGG - Intergenic
1093651669 12:21653141-21653163 AACTGTGGTTTGAACTACAAAGG + Intronic
1095381430 12:41598307-41598329 TACTTAATTTTCAAATATAAAGG + Intergenic
1095441287 12:42240752-42240774 CAATGTATTTTTAAATAAAAAGG + Intronic
1095979139 12:47960967-47960989 TACCTTATTTAGAAATAAAATGG + Intergenic
1096665856 12:53164264-53164286 TAGTGTCCTTTGAAGTACAAAGG - Intronic
1097361628 12:58664925-58664947 TAGTTTATTTTAAATTACAATGG - Intronic
1097514023 12:60580386-60580408 TACTGTGTTTTATAATAGAATGG + Intergenic
1098727661 12:73988841-73988863 TTTTGTATTTTAATATACAAGGG - Intergenic
1099167084 12:79320055-79320077 TATTGCATTATGAAACACAAGGG - Intronic
1099367222 12:81782839-81782861 TATTGGATTTTAAAAAACAATGG + Intergenic
1099519856 12:83646856-83646878 TACTGTAAATTGGAAAACAAGGG + Intergenic
1099718670 12:86332553-86332575 TCATATATTTTGAAAGACAATGG - Intronic
1100101892 12:91118576-91118598 TATTGTGTTTTGACATCCAAGGG + Intergenic
1100332214 12:93594117-93594139 AATTGTTTTTTGAAATAAAAAGG + Intergenic
1101652453 12:106689882-106689904 TACAATATTTTAAAATAAAATGG - Intronic
1101979618 12:109394478-109394500 TATGTTATTTTCAAATACAAGGG - Intronic
1102058363 12:109913763-109913785 TGCTGTATTTTGGAATCCACAGG + Intronic
1103694308 12:122801895-122801917 GCCAGTATTTGGAAATACAAAGG + Intronic
1104837250 12:131799692-131799714 AAATGTATTATGAAATAAAATGG + Intronic
1106153938 13:27134574-27134596 TACTTCATTTTGAACAACAAAGG + Intronic
1107642073 13:42453633-42453655 TACAGTATTTTTAATTCCAAAGG + Intergenic
1108777359 13:53783341-53783363 TTATTTATTCTGAAATACAATGG - Intergenic
1109035094 13:57248025-57248047 AATTTTCTTTTGAAATACAAAGG + Intergenic
1109192870 13:59346250-59346272 TACAGTCTTGTGAAATTCAAAGG - Intergenic
1109361224 13:61297975-61297997 TATTATATTTAGAAACACAAAGG - Intergenic
1109466818 13:62745542-62745564 AACTATATTTGGAAATACTAAGG - Intergenic
1109678270 13:65710428-65710450 TACTGCATTATGAAATAAAATGG - Intergenic
1109689492 13:65867066-65867088 AACTGTCTTTTTTAATACAATGG + Intergenic
1110105530 13:71670663-71670685 AACTTTATTTTTAAATCCAATGG + Intronic
1110108697 13:71714799-71714821 AAATGTATTTTAAAATAGAAAGG + Intronic
1110211774 13:72981874-72981896 TTCTACATTTTGAAATACTATGG + Intronic
1111139304 13:84093415-84093437 TTATATATTTTGAAATAGAAGGG + Intergenic
1111320052 13:86615157-86615179 TACTGTCTTTTGAAAAATGAGGG - Intergenic
1111409957 13:87862343-87862365 TACTCTATTTAGATATATAAAGG + Intergenic
1111507362 13:89210510-89210532 TCCTGTGTTATGATATACAAAGG - Intergenic
1111520236 13:89392581-89392603 TTCTGAATTTTCAAATAAAAGGG + Intergenic
1111687982 13:91525353-91525375 TACTGAATATTGAAATCCATTGG + Intronic
1112189409 13:97161473-97161495 TACTGTAGTGTGAAAGTCAAAGG + Intergenic
1112342391 13:98563539-98563561 TACGGCATTTTAAAATACAAGGG - Intronic
1112766917 13:102755329-102755351 TAAATTATTTTGAAATAGAAGGG - Intronic
1112977955 13:105344171-105344193 TACTCTCTTTTGAAACCCAATGG - Intergenic
1114335320 14:21683438-21683460 TACTGTAGTATGAGATAAAAAGG + Intergenic
1114779636 14:25523657-25523679 AACAGTATTTTAAAATAGAAGGG + Intergenic
1114891427 14:26928892-26928914 TTCTGTATATAGAAATAAAAGGG - Intergenic
1114949483 14:27730750-27730772 TACTCTGTTTTGTAATAAAAGGG + Intergenic
1115258545 14:31429054-31429076 TAATGTCCTTTGAATTACAAAGG - Intronic
1115806432 14:37056748-37056770 TAATTTATTTTTACATACAAGGG + Intronic
1115980316 14:39044532-39044554 TACTGTATTTGAAAATAGTAAGG - Intronic
1116547883 14:46193396-46193418 TGCTGCTTTTTTAAATACAAAGG + Intergenic
1116640864 14:47461028-47461050 TATTGTTTTTTGAAATCCGAGGG + Intronic
1116936473 14:50745648-50745670 AAATGTATTTTGAAATACCTGGG + Intronic
1117065067 14:52005284-52005306 TACTGTATTTTTAAAAATGAAGG - Exonic
1118095625 14:62533978-62534000 TAATGTATTTTGTAACATAATGG + Intergenic
1118174765 14:63427367-63427389 TATTGTATTTTAAACTACACTGG + Intronic
1120243576 14:81979136-81979158 TATGGTATTCTTAAATACAAAGG - Intergenic
1120379048 14:83749725-83749747 TTCTGGATTTTGAATTACACTGG - Intergenic
1120526830 14:85586645-85586667 TACGGTATTTTGATATATATAGG + Intronic
1121046045 14:90788536-90788558 TACAGTGTTTTGAAAGATAAAGG - Intronic
1121806049 14:96824353-96824375 TACTGTATTTTGAAAGCAAAAGG + Intronic
1124868507 15:33517520-33517542 GACTGTATTTTGGAACACATTGG - Intronic
1125039759 15:35171717-35171739 TTCTGGATTTTGAAATACTTGGG + Intergenic
1125776351 15:42218770-42218792 ATGTGTATTTTGATATACAATGG - Intronic
1126877389 15:53058936-53058958 TACTGAGTTATGAAAAACAACGG + Intergenic
1127401472 15:58590688-58590710 TGTTGTATTTAGAAACACAAAGG + Exonic
1128622637 15:69162974-69162996 TACATCATTTTGAAAAACAAAGG + Intronic
1129622226 15:77158509-77158531 TGCTGTATGTTGCACTACAAGGG + Exonic
1131576207 15:93594135-93594157 TAATGAATTTTTAAAAACAATGG - Intergenic
1135128637 16:19833584-19833606 TACTATATTTGGGAATAAAATGG - Intronic
1136078351 16:27832555-27832577 TACTGTACTTAGCAATATAAAGG - Intronic
1136927283 16:34386913-34386935 TTCTGTATTTTGTATTAGAAAGG - Intergenic
1136977291 16:35024894-35024916 TTCTGTATTTTGTATTAGAAAGG + Intergenic
1137455048 16:48611640-48611662 TGCTGTAGTTGGAAATACCAAGG + Intronic
1137593089 16:49705884-49705906 AAATGTATTTTGAGAAACAAGGG + Intronic
1137637362 16:49998517-49998539 TACTGGGTTTTGAAATCCAGTGG - Intergenic
1138932140 16:61672043-61672065 TACTTTCTTTTAAAATAAAAGGG + Intronic
1139343568 16:66287769-66287791 GACTGTATTTTGAATTACTTGGG - Intergenic
1139456488 16:67082815-67082837 TTCTGTATTTTACAATAGAAAGG - Intronic
1139789484 16:69421454-69421476 AAATGTATGTGGAAATACAAAGG + Intergenic
1139944256 16:70628204-70628226 TACTGTCTTGTGAAATGCATTGG + Intronic
1140349271 16:74246472-74246494 TCTTGTATTTTGAAATGTAATGG + Intergenic
1140446028 16:75028744-75028766 TACTGGATTTAGCAGTACAAAGG - Intronic
1146129003 17:30253900-30253922 TTCTGTATTTTGTAACAGAAAGG + Intronic
1149097009 17:52855337-52855359 TAATGTATTTTTAAATCAAATGG - Intergenic
1149275764 17:55033523-55033545 TACTGTATTTTTAATTTCCAAGG - Intronic
1149853311 17:60054697-60054719 TACTGATTTTTAAGATACAATGG - Intronic
1150670071 17:67186950-67186972 AACTTTATTTTCAAAAACAATGG - Intronic
1150916291 17:69440600-69440622 TACTGTTTTTTTAAAAAAAATGG - Intronic
1150916470 17:69442689-69442711 TAATGCATGTTGAAAGACAAAGG - Intronic
1153117043 18:1671002-1671024 TATTTTATTTTTAAATAAAAAGG + Intergenic
1153522713 18:5967518-5967540 AACTGAATTTTGAAAAAAAATGG - Intronic
1153762706 18:8347263-8347285 TACTGGATTTTTAAAAATAAAGG + Intronic
1153767910 18:8392314-8392336 TACTGTGTTTAAAAATAAAAAGG + Intronic
1155399791 18:25425499-25425521 TATTCTATTTTGAAAAATAAAGG - Intergenic
1155999704 18:32371326-32371348 TACTGTGTTTTTAAATACCGAGG + Intronic
1156232558 18:35168488-35168510 TAATATCTTTTGAAATTCAAGGG - Intergenic
1156279041 18:35615118-35615140 AAATTTATTTGGAAATACAAAGG + Intronic
1156311877 18:35930936-35930958 TAAGGTTTTTTGAAAAACAAGGG + Intergenic
1156366678 18:36434538-36434560 AAATGTATATAGAAATACAAAGG - Intronic
1156366762 18:36436279-36436301 AAATGTATATAGAAATACAAAGG - Intronic
1156564672 18:38173997-38174019 TCTAGTATATTGAAATACAATGG - Intergenic
1157046935 18:44112496-44112518 TACTTTATTTAGACATACAAAGG - Intergenic
1158188559 18:54799515-54799537 TTCTGTTTTTTAAAAAACAATGG + Intronic
1159398222 18:67892844-67892866 TAGTTTATTTAGAAATACACAGG + Intergenic
1159533802 18:69689307-69689329 AACTATATTGTGAAATATAATGG - Intronic
1159996545 18:74970525-74970547 TACTGGATTTTGAATTGGAATGG - Intronic
1164490607 19:28709693-28709715 TAGTGTGTTTTGAATTAGAAAGG + Intergenic
1165609452 19:37137857-37137879 TATCGTATTTAGAAATAAAATGG - Intronic
925040681 2:731368-731390 TATTTTATTTAGAAATAAAATGG - Intergenic
925593270 2:5530997-5531019 TTCTGTATTTTGAAATTAAATGG - Intergenic
925661716 2:6209755-6209777 CACTGAAATTTGAAATCCAATGG - Intergenic
926051539 2:9748034-9748056 TACTATATGTTGAAAGACAGTGG - Intergenic
926067636 2:9856854-9856876 TACTCTATTTTGAAAGGAAATGG + Intronic
926398751 2:12472993-12473015 AAATTTATGTTGAAATACAAAGG - Intergenic
927350831 2:22112231-22112253 AACTGCTATTTGAAATACAAAGG - Intergenic
927531320 2:23805438-23805460 TGGTGTATCTTGACATACAAAGG - Intronic
927746346 2:25625171-25625193 TATGGAATTATGAAATACAAAGG + Intronic
928056456 2:28060982-28061004 AAATTTATTTTGAAATACCAAGG + Intronic
928717589 2:34079987-34080009 TATTTTATTTTAAAATGCAATGG + Intergenic
929168848 2:38910859-38910881 TACAGTACTTTGAAATACTGTGG + Intronic
929728513 2:44459489-44459511 TTCTGTATTTTAAAAGAGAAAGG + Intronic
929985858 2:46731515-46731537 TACTGTCTATTGAAATAAACAGG + Intronic
931041626 2:58306964-58306986 TACTGTACTTTTATATATAAAGG + Intergenic
931245020 2:60485227-60485249 TACTGGCTTATGAAATGCAATGG + Intronic
931590908 2:63882298-63882320 TACTTGATTTTGAACCACAAGGG + Intronic
931624713 2:64246741-64246763 TACAGTATTTGCAAATACACAGG + Intergenic
931681433 2:64752196-64752218 TACAGTACTTTCAAGTACAAGGG - Intergenic
932901639 2:75708007-75708029 TGCTGCATCTTGAAATGCAATGG + Intronic
932979355 2:76645422-76645444 TCATGTATTTTGAAATATATGGG - Intergenic
932979455 2:76646990-76647012 TCATGTATTTTGAAATATATGGG - Intergenic
933058120 2:77699400-77699422 TAGTATATTTATAAATACAATGG - Intergenic
933784693 2:85829196-85829218 CACTGAAATATGAAATACAAAGG - Intergenic
935844336 2:107148481-107148503 ATCTGTTATTTGAAATACAAAGG + Intergenic
936409746 2:112247071-112247093 TACTGTTTTCTAAAATATAATGG + Intronic
936432921 2:112480638-112480660 TTCTGGATTTGGAAATTCAAAGG + Intergenic
936769718 2:115897048-115897070 TACTGTACTCTGAAATGCACAGG - Intergenic
937216626 2:120317314-120317336 AACTTTATTTAGAAAAACAAGGG + Intergenic
937878366 2:126844704-126844726 AACTTTATTTTGAAATGCAAAGG + Intergenic
938271225 2:129973806-129973828 TACTGTATTTTTTAAAACATGGG + Intergenic
938541162 2:132285005-132285027 TACAGCATTATGGAATACAATGG + Intergenic
938947697 2:136227929-136227951 TGCTGTATATTGAGATGCAAAGG + Intergenic
939193477 2:138943767-138943789 TACTGCCTTTTTAAGTACAATGG - Intergenic
939837166 2:147144686-147144708 TATTGTATTTCTAATTACAAAGG + Intergenic
941340886 2:164301704-164301726 AAATGTATTTGGAAAAACAAAGG + Intergenic
941944427 2:171078958-171078980 TTCTTTACTATGAAATACAAGGG + Intronic
942033859 2:171991485-171991507 TACTGCATGTTGAAAGATAATGG + Intronic
942226980 2:173825468-173825490 TACTTTATTTATAAATACATAGG - Intergenic
942296263 2:174519942-174519964 TATTCTCTTTTGAAATAAAAAGG + Intergenic
942676457 2:178431456-178431478 TAATTTACTTTGAAATTCAAAGG - Exonic
942684202 2:178513499-178513521 GACTGTCTTTTGAAAGAAAATGG - Exonic
942931018 2:181492240-181492262 TACTTTGTTTAGACATACAAAGG - Intronic
943004035 2:182367484-182367506 TAATGAATTTTAAAATACAGTGG + Intronic
943095571 2:183424820-183424842 TTCTGTGTTTTGAAAAACAAAGG + Intergenic
943095577 2:183424917-183424939 TACTGTAACTGGAAAGACAAAGG - Intergenic
943267276 2:185749131-185749153 TAATTTATATGGAAATACAAAGG - Intronic
943293031 2:186100244-186100266 TACTGCATTATGAGACACAATGG + Intergenic
943541167 2:189216476-189216498 TACTAGATTTTGAAATCCCAAGG - Intergenic
943621803 2:190156847-190156869 AAATGTATTTTTAATTACAATGG - Intronic
943737625 2:191374200-191374222 TACTGCAAGTTGAAGTACAAGGG + Intronic
943888454 2:193253698-193253720 TAGTGTATTGGGAAAAACAAAGG + Intergenic
945460224 2:210099306-210099328 TACTCTATTGTGAAATAAAGGGG + Intronic
945486329 2:210400846-210400868 CACTGCATTTTGAAAACCAATGG + Intergenic
945833946 2:214816613-214816635 TACAGAATTTTGAAACACAATGG - Intergenic
946755526 2:222942066-222942088 TACTGTATTTAAAAATACAAGGG + Exonic
947224083 2:227823379-227823401 CACAGTCTTTAGAAATACAATGG + Intergenic
1169402159 20:5291744-5291766 GACCCTATTTTGGAATACAAAGG + Intergenic
1170446684 20:16435452-16435474 TTCTTTATCTTGAAATTCAATGG + Intronic
1171870072 20:30518010-30518032 TACAGCATTATGGAATACAATGG + Intergenic
1173838798 20:46143135-46143157 CATTGTAGTTTGAAATGCAATGG - Intergenic
1174711297 20:52708116-52708138 TACTTTATTTTAAAATAAAAAGG - Intergenic
1174745594 20:53058597-53058619 TACTGTCTTTTGAATGACACTGG - Intronic
1175510848 20:59525101-59525123 TTCTGTAATTTGAAAAACATAGG + Intergenic
1175638656 20:60607243-60607265 TGATGTATTTTTAAATATAAGGG - Intergenic
1176006599 20:62867739-62867761 TATTGTATTTAGAAATACAATGG - Intergenic
1176315070 21:5235137-5235159 TACAGAATTTTGTAATCCAATGG + Intergenic
1177076475 21:16581836-16581858 TTCTGAAATTTGGAATACAAAGG - Intergenic
1177900455 21:26908368-26908390 TATTGTATTTAGAAATACAGTGG - Intergenic
1178320714 21:31603241-31603263 TATTGTTTTTTCAAACACAAGGG + Intergenic
1179074388 21:38105981-38106003 AAAAGTATTTGGAAATACAAGGG + Intronic
1179076976 21:38131665-38131687 TACTGTATTTAGAATTTAAAGGG + Intronic
1180392861 22:12301094-12301116 TACAGAATTTTGTAATCCAATGG + Intergenic
1180406888 22:12563674-12563696 TACAGAATTTTGTAATCCAATGG - Intergenic
1182541610 22:31045985-31046007 TAATGTTTGTTGAAATACAATGG + Intergenic
1182976694 22:34628920-34628942 TATAATAGTTTGAAATACAAAGG - Intergenic
949174888 3:1048825-1048847 AACTACATTTTGAAATATAAAGG + Intergenic
949216141 3:1569713-1569735 CAGTGTCTTTTGAAATGCAAAGG + Intergenic
949756837 3:7421850-7421872 TACTGTATTTTTAAAAAATAGGG + Intronic
949795679 3:7848002-7848024 TTCTGTCTTTTGGAATACTATGG - Intergenic
949836270 3:8273803-8273825 TAGTGAAATTTGAAACACAAAGG + Intergenic
950347251 3:12307779-12307801 TAATGTATTTTGAAAGACCCCGG + Intronic
950355371 3:12403831-12403853 TACTGTATTTTGAAATACAATGG - Intronic
950985099 3:17355047-17355069 GACTGTAGTTTGCAATCCAAAGG + Intronic
951037158 3:17946021-17946043 AACTGTATTTGCAATTACAATGG + Intronic
951884082 3:27506876-27506898 TAATGTATTATGAAATATAAGGG + Intergenic
952760729 3:36911446-36911468 TTTTGTATTTGTAAATACAATGG - Intronic
953095549 3:39771202-39771224 CACTGAGTTTTAAAATACAATGG - Intergenic
953235872 3:41105910-41105932 TATTGTATTTTTAATTTCAATGG + Intergenic
954768351 3:52942275-52942297 TACAGTATTTTTGAATAAAAGGG + Intronic
956086901 3:65621213-65621235 TAATTTCTTTTAAAATACAAGGG - Intronic
956829966 3:73036925-73036947 TACTGTATATTTTAATACAAAGG - Intronic
957148399 3:76453732-76453754 TTTTGTTTTTTAAAATACAAAGG - Intronic
957160656 3:76605376-76605398 AACTGTATTTTAAAAAAAAAAGG + Intronic
957171673 3:76745032-76745054 TAATGTAATTTGAAAGGCAAGGG - Intronic
957256871 3:77848238-77848260 TACTGTATTTTTAAAATTAAAGG - Intergenic
957648876 3:82972479-82972501 TAATGGATTTTGAAAGACAATGG - Intergenic
957793404 3:84968597-84968619 TACTGTATTATGTATCACAATGG - Intronic
957827226 3:85463538-85463560 TCCTATATTTTTAAATAAAAGGG + Intronic
957877206 3:86162996-86163018 TACTATACTATCAAATACAATGG - Intergenic
958837392 3:99161424-99161446 CAATGTATATGGAAATACAAAGG + Intergenic
958857048 3:99398132-99398154 GATTGTGTTTTGAAATGCAAGGG - Intergenic
959054956 3:101558392-101558414 TACTAGATTTAGCAATACAAGGG - Intergenic
959442445 3:106394673-106394695 TTTTGTATTTTAAAATAAAAAGG + Intergenic
959995146 3:112672415-112672437 TACTGAGTTATGAAATAAAATGG - Intergenic
961112884 3:124299885-124299907 TGCAGGAGTTTGAAATACAATGG - Intronic
961968723 3:130935878-130935900 TTTTGTATATTGAAATACAATGG + Intronic
962681585 3:137806122-137806144 TTCTGTATTGTGATCTACAATGG - Intergenic
963572629 3:147016541-147016563 TTCTGTATTTTGGACTTCAATGG + Intergenic
964775407 3:160270497-160270519 CACTGTATTGTGAAATCCAAGGG + Intronic
965525187 3:169709052-169709074 TACAGTATTTTCAATTTCAATGG - Intergenic
965560435 3:170057203-170057225 GAATGTAAGTTGAAATACAAAGG + Intronic
965954036 3:174346466-174346488 TACTGTATTTTTAATTATATTGG + Intergenic
965967281 3:174508459-174508481 TACTTTATGTGGAAATACAAAGG - Intronic
966113257 3:176429444-176429466 TAGGGTATTTTAAAATAAAATGG - Intergenic
966813950 3:183873626-183873648 TACTGGACTGAGAAATACAAAGG + Intronic
967314720 3:188140990-188141012 TACTGTATTTTAAAATGTGATGG - Intergenic
967443374 3:189535356-189535378 TAATGTATCTTTAAACACAATGG - Intergenic
967653204 3:192012422-192012444 TACTCTATTTTGAAATGCTGAGG + Intergenic
967712528 3:192725828-192725850 TACTCCATTTTAAAATAAAAAGG - Intronic
968252091 3:197227947-197227969 AAATGTATTTTTAAATATAAAGG - Intronic
969292564 4:6249595-6249617 CACTGTATCTTGAATTACAAGGG - Intergenic
970668217 4:18362894-18362916 CACTGTGTTTTGAAATTCAATGG + Intergenic
970756285 4:19430128-19430150 CACCGTATTTTAAAATGCAAAGG + Intergenic
971036278 4:22696367-22696389 AACTGTATTTTGAAATACAGTGG - Intergenic
971071636 4:23100486-23100508 AACTATATATGGAAATACAAAGG - Intergenic
971702814 4:30001603-30001625 TTCTGTTTTCTGAGATACAATGG + Intergenic
971751335 4:30653016-30653038 TATGCTAATTTGAAATACAATGG + Intergenic
972848087 4:43014165-43014187 TACTGCATTTTTAAAGACACTGG + Intronic
972877451 4:43380954-43380976 TAATTTATTTTAAAATACAATGG + Intergenic
973719557 4:53709378-53709400 CAGTGTATTTTGAGATAAAATGG + Intronic
973751768 4:54027148-54027170 TACTGTATTTTTCAATTCTAGGG - Intronic
973927495 4:55754112-55754134 CACTGAATTTGGAAATACAGTGG + Intergenic
974572932 4:63678220-63678242 GACTGCATTTTCAAAAACAATGG + Intergenic
974580085 4:63786805-63786827 TACTGTTTTATGAAAACCAATGG + Intergenic
974791166 4:66691850-66691872 TTCTGAATATAGAAATACAAAGG + Intergenic
975416469 4:74110808-74110830 TAGTGTATTTTGGAATTCAAGGG + Intergenic
976360995 4:84177921-84177943 TACTCTGTTTCCAAATACAATGG - Intergenic
976877304 4:89869331-89869353 TGCTGTATTTCCACATACAAAGG + Intergenic
976952821 4:90854165-90854187 TAGTGAATTTTCAAATACGATGG + Intronic
977112740 4:92979718-92979740 TTCTGCATTTTCAACTACAAGGG + Intronic
977171758 4:93770929-93770951 TATTGAATTTTGAAATAAGAAGG + Intronic
977495726 4:97772907-97772929 TGCTGTATTTTTAGATCCAAGGG + Intronic
977637302 4:99314228-99314250 TGCTTTATTTTTAAATTCAAGGG + Intronic
977935375 4:102796773-102796795 GACCCTATTTTGGAATACAAAGG + Intronic
977953162 4:102997169-102997191 AAATGTATGTGGAAATACAAAGG - Intronic
978117937 4:105044227-105044249 ACATGTATTTTGAAAAACAACGG - Intergenic
978196066 4:105973418-105973440 GCCTGTATTTTAAAAGACAAAGG + Intronic
978335081 4:107658228-107658250 TACTGTATTCTAAAAAAAAAAGG + Intronic
978970864 4:114804336-114804358 TACTGTAATTTGGATTACACTGG - Intergenic
979115904 4:116822079-116822101 TACTGGATTTTGTACTACAGTGG + Intergenic
979477103 4:121171184-121171206 GAGTCTATTTTGAAATGCAAAGG - Intronic
979569102 4:122195178-122195200 TACTGACTTTTGAAATAGCATGG + Intronic
979616711 4:122750882-122750904 TCCTGTATGTTGAATAACAATGG - Intergenic
979926534 4:126573211-126573233 TACTGTATTTTAAAACAGTAAGG - Intergenic
980219447 4:129896858-129896880 AACTGTTTTTTAAAATAGAAAGG + Intergenic
980304371 4:131038505-131038527 TACTTTATTTTCAAATATCAGGG + Intergenic
980463096 4:133143702-133143724 TTCTGTATTTTAAAAATCAAGGG + Intergenic
980474019 4:133287324-133287346 TACTGTATATTAAAATACAAAGG - Intergenic
980502193 4:133670779-133670801 TATTATATTTTAAAATACAAGGG + Intergenic
980704028 4:136469191-136469213 TACTGTATTTTTCAAAACAGTGG - Intergenic
980758521 4:137197552-137197574 AATGGTATTTTGAAACACAATGG + Intergenic
980772079 4:137387678-137387700 TACAGTAATTTCTAATACAAAGG - Intergenic
981221387 4:142240753-142240775 TACTGTATTTTATGATACATAGG - Intronic
981413448 4:144459548-144459570 TTGTTAATTTTGAAATACAAGGG + Intergenic
981477335 4:145200080-145200102 TATTTTATTTAGAAATAAAATGG + Intergenic
981643990 4:146977345-146977367 TATAGTATTTTCAAATACATAGG + Intergenic
983331750 4:166338768-166338790 AACAGTATTGTGAAATAAAAAGG - Intergenic
983347459 4:166545207-166545229 TACTGAAATTTAAAATATAAAGG + Intergenic
984498329 4:180526970-180526992 TACTAAATGTTGAAATGCAATGG + Intergenic
984824031 4:183907703-183907725 TTCTTTTTTTGGAAATACAACGG + Intronic
984894187 4:184521980-184522002 TACTTTATTTTACCATACAATGG - Intergenic
986129623 5:4915424-4915446 TACTACATTTTCAAATAAAAAGG + Intergenic
986486603 5:8244204-8244226 TACTGTTTTATGAAAAAGAAAGG - Intergenic
986840986 5:11697479-11697501 TACTGACTTATAAAATACAAAGG - Intronic
986908656 5:12526410-12526432 TTGAGTATTTTGAACTACAAAGG - Intergenic
986963445 5:13242906-13242928 TAGTGTGTTTTGAAAAATAAGGG - Intergenic
987184646 5:15403685-15403707 AAATGTATATGGAAATACAAAGG - Intergenic
987419696 5:17704694-17704716 TAATGTATTTTTAAAAACCATGG - Intergenic
988248645 5:28724496-28724518 TATTTTATTCTGAAACACAAAGG - Intergenic
988323189 5:29727327-29727349 CACTGTATTTTCAAAGAAAATGG + Intergenic
989011107 5:36874783-36874805 TAATGTATTTTGAAAGACAGAGG + Intergenic
989321190 5:40135828-40135850 AAATGTCTTTTGAAATACAAAGG + Intergenic
989730941 5:44647892-44647914 TACTGCAATTTGAAATACCTGGG + Intergenic
989769480 5:45126768-45126790 TACTGGATATTAAAATAAAAGGG + Intergenic
990180943 5:53159910-53159932 TACTGTCTTTTGATTCACAAAGG - Intergenic
990205015 5:53419538-53419560 TACTGTCTGATGAAATCCAAGGG + Intergenic
990328493 5:54701760-54701782 TTTTGTATTTTTAAAAACAAAGG - Intergenic
990486340 5:56262662-56262684 TACTGTTCTTTTAAAAACAAGGG + Intergenic
990971267 5:61508916-61508938 TACAGAATTGTGAGATACAACGG + Intronic
991229875 5:64320625-64320647 TGCTTTATTTTTATATACAAGGG - Intronic
991339132 5:65586374-65586396 CACTGTAGTAAGAAATACAATGG + Intronic
991641988 5:68763957-68763979 TAGTGTATATTAAAATAAAAGGG - Intergenic
992400428 5:76405902-76405924 TACTTTATTTTTAAATGCTAGGG - Intronic
992916781 5:81463177-81463199 TAAAGTATTTTCAAACACAATGG - Intronic
992983345 5:82200845-82200867 TAATGTATTTTTAAATAAATTGG - Intronic
993535414 5:89078750-89078772 TACTGCATCCTGAAATACCATGG + Intergenic
993772971 5:91954128-91954150 TTCTGTATTTTAAATTATAAAGG + Intergenic
993962471 5:94316780-94316802 TATTGTTTTTTTAATTACAAAGG + Intronic
994704420 5:103183487-103183509 TACTCTGATGTGAAATACAAGGG - Intronic
994764031 5:103893664-103893686 CACAGTATTTTGCAATGCAATGG + Intergenic
994884759 5:105545948-105545970 GGCTGTATTTTGAAATAAGAGGG + Intergenic
994955803 5:106530431-106530453 TTCACCATTTTGAAATACAATGG - Intergenic
995430459 5:112069276-112069298 TGCTGCATTCTGAAATACAATGG - Intergenic
995962272 5:117856707-117856729 TGCTGTATTTTTAAGTTCAATGG + Intergenic
996076886 5:119206121-119206143 TACTTTCTATTTAAATACAAAGG - Intronic
996430673 5:123372926-123372948 TACTGAATTTTTAATTACTAAGG - Intronic
996744764 5:126837607-126837629 TACTGTCTTTTAAAATAGGAAGG + Intergenic
997153359 5:131524266-131524288 TACTGTATTTTAAACTTCATGGG - Intronic
997380879 5:133436904-133436926 AACTGTATTTTGAATTAGAGTGG + Intronic
998195374 5:140064966-140064988 AACTATAATTTGAAATACAGAGG + Intergenic
1000166216 5:158651178-158651200 GACTGTATTTGGAGATACATTGG - Intergenic
1000684479 5:164230163-164230185 AACTGTGTTTTGGAATTCAAAGG - Intergenic
1000779410 5:165462455-165462477 TACTGTATTTTTAAAGGCTATGG - Intergenic
1000801495 5:165732451-165732473 TAGTGTATTTTGAAATTAAGTGG + Intergenic
1001539404 5:172526829-172526851 TACTGTATTGAGAAAAATAAGGG - Intergenic
1002628647 5:180552192-180552214 TATTGTATTTGGAAATAAACAGG + Intronic
1004345646 6:14846797-14846819 TACTCCATATTGAAATACAATGG - Intergenic
1004588016 6:17021415-17021437 ACCTGTAGTTTGAAAAACAATGG - Intergenic
1005030310 6:21502510-21502532 TTCTGTTTTTGGAAACACAAGGG + Intergenic
1005064007 6:21800786-21800808 TACTCTATTTTCAAATTGAAAGG + Intergenic
1005166758 6:22931868-22931890 TACTGTATGTAGAAATCCTAAGG - Intergenic
1008268087 6:49456753-49456775 TACTATATGTTGAAACAAAATGG + Intronic
1008596301 6:53045212-53045234 TACTGTATTATGGAATAGATTGG + Intronic
1008737693 6:54565882-54565904 TACTGTATTGTGATATAGTAAGG + Intergenic
1008852185 6:56035736-56035758 TTCTGTATCTTGAAATGCAGAGG + Intergenic
1009347857 6:62638589-62638611 TACTGCATTTTGCAGTCCAATGG + Intergenic
1009443428 6:63710660-63710682 CACTGAATTTAGAAATAAAAAGG - Intronic
1009653154 6:66502831-66502853 TACTGGTTTATGAAACACAAAGG + Intergenic
1009834213 6:68977248-68977270 TACCTAATTTTGAAATATAATGG - Intronic
1009989428 6:70823513-70823535 AACTGTATTTTGAAATATGATGG - Intronic
1010190950 6:73195816-73195838 TAATGTATATTTAAACACAATGG + Exonic
1012443562 6:99285615-99285637 TACAGTAAGTTGAATTACAAAGG - Intronic
1012531043 6:100236722-100236744 TACTGCATTTTTACTTACAAAGG + Intergenic
1012531266 6:100239982-100240004 TAATTTATGTTGAAATCCAAAGG + Intergenic
1012664061 6:101943655-101943677 TACTGGATTTTGGAATTCCATGG + Intronic
1012718421 6:102707185-102707207 TGTTGTATTTTGAGAAACAAAGG + Intergenic
1012846797 6:104399860-104399882 TTCTGAGTTTTGAAATATAAAGG + Intergenic
1013358348 6:109367893-109367915 TACTTTTTTTTAAAGTACAAAGG + Exonic
1014299285 6:119660680-119660702 TATTATATTTTGGAAAACAATGG + Intergenic
1014367842 6:120566299-120566321 TATTGGAATTTGAAACACAAAGG - Intergenic
1014463053 6:121721402-121721424 TACTTTATTCTGAACTACAGAGG + Intergenic
1014517543 6:122398769-122398791 TTCTGTATATTAAAATACACTGG - Intergenic
1014579797 6:123123076-123123098 TGCTGTAAATTGAAATAAAATGG + Intergenic
1014619098 6:123643517-123643539 TCATGTATTTAGAAGTACAAGGG - Intergenic
1015128711 6:129785478-129785500 TAATTTATCTTGAAAAACAAGGG + Intergenic
1015580428 6:134718435-134718457 TCCTTTATTTGGATATACAATGG + Intergenic
1016227272 6:141753668-141753690 TGCTTTATGTTGAAAAACAAAGG - Intergenic
1016243000 6:141953566-141953588 TACTGGATTTTGAACTTCCATGG + Intergenic
1016336721 6:143013559-143013581 TACTGGCTTTTAAAATATAATGG - Intergenic
1017222267 6:151979911-151979933 TACTTTATTTTGTTATACAGTGG + Intronic
1017712328 6:157181887-157181909 TCATGTATTTAGAAAGACAAAGG - Intronic
1018744660 6:166752638-166752660 TTCTTTCTTTTAAAATACAAGGG - Intronic
1020553891 7:9644591-9644613 TACTGTAGTTTGAAATAACATGG - Intergenic
1020838618 7:13185789-13185811 TTATGTATTTTAAAATAAAATGG - Intergenic
1021088011 7:16446864-16446886 TACAGAATTAAGAAATACAATGG + Intergenic
1021626458 7:22598235-22598257 GACTCTATTCTAAAATACAAGGG + Intronic
1021715325 7:23456550-23456572 TACTTAATTTTTATATACAAGGG + Intronic
1021929191 7:25562588-25562610 TACTGTAATTGGCATTACAAAGG + Intergenic
1023528834 7:41132559-41132581 TGATGTATTTTGAAATCCTAGGG + Intergenic
1023707458 7:42956314-42956336 TTCTGGACTTTGAAAAACAAAGG + Intergenic
1024277410 7:47689298-47689320 TACTGTATTTCACAATAAAAAGG - Intergenic
1024880204 7:54076537-54076559 TACTGTATTATAAAAAAAAATGG - Intergenic
1026052273 7:66957253-66957275 TCCTGCATTCTGAAATACATTGG + Exonic
1027527050 7:79282753-79282775 TAATGTATTTTTAAAACCAAGGG + Intronic
1027650991 7:80868572-80868594 CATTGTATTTTGGAATATAAGGG - Intronic
1027876597 7:83778134-83778156 AACTTTATCTTGAAATACCATGG - Intergenic
1028098178 7:86787845-86787867 GACTGTATTTAGAAATAAAGAGG - Intronic
1028311015 7:89335914-89335936 TACTGTATTTTTTCAGACAAAGG - Exonic
1028379420 7:90182283-90182305 AACTGGATTTTTAAATGCAAGGG - Intronic
1028481172 7:91306989-91307011 TAATGTATTTTCAGATACAGAGG - Intergenic
1028916863 7:96268832-96268854 TCCTGTGTTTTGAAATGCAGAGG - Intronic
1029233231 7:99089349-99089371 AACTGTATTTTAAAATACAGTGG + Intronic
1030217916 7:107065588-107065610 AGTTGTATTTTCAAATACAATGG - Intronic
1030840302 7:114343793-114343815 TACTGTATTTTTAAGTAAAATGG - Intronic
1030870648 7:114751507-114751529 TGCTGCATATTGAAATACGATGG - Intergenic
1031205268 7:118749090-118749112 TACTTAATTTTAAAATACAATGG - Intergenic
1031276506 7:119730914-119730936 CAATGTGTTTTGTAATACAAGGG + Intergenic
1031321027 7:120328088-120328110 CATTGTATCATGAAATACAAGGG - Intronic
1032211218 7:129915827-129915849 TTATGGATTTTGAGATACAAAGG - Intronic
1033023280 7:137749136-137749158 TACTGTTTATTGAAATAAAATGG - Intronic
1033594456 7:142846532-142846554 TGCTGTTTTTTTAAATATAATGG + Intergenic
1034722780 7:153310094-153310116 TACTGTATTTTTTAACACGAGGG - Intergenic
1034854899 7:154534869-154534891 AAATTTATATTGAAATACAAAGG + Intronic
1035296730 7:157871613-157871635 TATTTTTTTTTGTAATACAAAGG + Intronic
1036297084 8:7546180-7546202 TACTGTGTTTTGAAACACAATGG + Intergenic
1036325485 8:7774839-7774861 TACTGTGTTTTGAAACACAATGG - Intergenic
1036970805 8:13353018-13353040 TATGGTATTTTAAAATAAAAAGG - Intronic
1037043110 8:14262499-14262521 TCCTGTGCTTTGAAATACTATGG - Intronic
1037526812 8:19732940-19732962 AAATTTATTTTGCAATACAAAGG + Intronic
1039048017 8:33467735-33467757 AACTGTATTTTGAATTAAGATGG + Intronic
1039832944 8:41231418-41231440 AACTGCATTTTTAAATAAAATGG + Intergenic
1039861456 8:41462407-41462429 TAATTTATATGGAAATACAAAGG + Intergenic
1040632581 8:49232997-49233019 AACTGTATTTTTAATTTCAACGG - Intergenic
1040759403 8:50820824-50820846 TACTGTCTTTTGGAATACAGGGG - Intergenic
1040914609 8:52556176-52556198 TAAGGTATTTTGAAATATACTGG - Intronic
1041918203 8:63157180-63157202 TATTTTATTTAGGAATACAATGG - Intergenic
1042223705 8:66498451-66498473 TACTGCTTTTGGAAATAAAAAGG - Intronic
1042261912 8:66868550-66868572 TATTCTACTTTAAAATACAATGG + Intergenic
1043060795 8:75500044-75500066 TAATGTCTTTTGAAGCACAATGG - Intronic
1043221975 8:77677590-77677612 TAATATATTTTGAAATCCAGTGG - Intergenic
1044163584 8:88951624-88951646 GACTGTGTTATGAAATACAGAGG + Intergenic
1044252745 8:90023302-90023324 TGTAGTATTTAGAAATACAATGG + Intronic
1044334299 8:90960739-90960761 TACTGGTTTTTGCAGTACAATGG + Exonic
1044374194 8:91450031-91450053 TACTGTAGTTTGAATTCCAAGGG + Intergenic
1044549685 8:93497890-93497912 TACTGTCTTATGTAATACAAAGG - Intergenic
1044577599 8:93787972-93787994 TACTCTATTTATACATACAAGGG - Intronic
1045119263 8:99017468-99017490 AAATGTATATGGAAATACAAAGG - Intronic
1045223299 8:100219896-100219918 TACTTTATTATTAAATACATAGG + Intronic
1046026669 8:108732417-108732439 AAATGTATTTGGAAATGCAAAGG + Intronic
1046293377 8:112191648-112191670 TACTCCATCTTAAAATACAATGG + Intergenic
1046577195 8:116045352-116045374 TATTATATTTTTAAATTCAAGGG + Intergenic
1046777981 8:118184146-118184168 TATTTCATTTTGAAAAACAAAGG - Intergenic
1046988593 8:120421595-120421617 TACTATGTTTTGAAAAAGAATGG - Intronic
1047079547 8:121444226-121444248 TCCTTTATTTTCAAATCCAAAGG - Intergenic
1047640388 8:126813656-126813678 TACTGCATTTTGTCATACACAGG + Intergenic
1048975289 8:139668359-139668381 CACTGTATTTTTAGACACAATGG + Intronic
1049822397 8:144643814-144643836 TGGTGTATTTTGAAGCACAAAGG + Intergenic
1050559925 9:6824695-6824717 TAATGTATGTTGATATATAATGG - Intronic
1050968552 9:11839723-11839745 TACTCTAATTTTAAATAAAAGGG + Intergenic
1051140071 9:13969347-13969369 TATGGTATTTTGAAATGCACAGG - Intergenic
1051731991 9:20153548-20153570 TACAGTATTTTGAAAATGAAGGG + Intergenic
1051847823 9:21472476-21472498 TATGGTATTCTGTAATACAAAGG + Intergenic
1052011856 9:23420266-23420288 TACTGTGCTTGGAAGTACAAGGG - Intergenic
1052068297 9:24050354-24050376 TACTGTATTTTAATATAGCATGG + Intergenic
1052119800 9:24698676-24698698 TACTGTATTTGGTAATCCATGGG - Intergenic
1052321748 9:27174821-27174843 TAATTTTTTTTAAAATACAAGGG - Intronic
1053176416 9:35928213-35928235 TTCTGTATTTTGAAATGTATTGG - Intergenic
1053260748 9:36661445-36661467 AAATGTATGTGGAAATACAAAGG + Intronic
1053638378 9:40039612-40039634 TACTGTAATTTAAAATTTAATGG + Intergenic
1053721223 9:40948462-40948484 TACAGAATTTTGTAATCCAATGG - Intergenic
1054344770 9:63903697-63903719 TACAGAATTTTGTAATCCAATGG + Intergenic
1054830410 9:69618786-69618808 TAATGTATCTTTAAAAACAAAGG - Intronic
1055167388 9:73213323-73213345 TACTTTACTTAGAAATAAAATGG - Intergenic
1055189621 9:73501583-73501605 TAATGTATTTTGATCAACAAAGG + Intergenic
1055691279 9:78833888-78833910 TACTATATTTGGAAATTCTAGGG + Intergenic
1056501237 9:87211541-87211563 TAATGAATTTTGTAATAAAATGG - Intergenic
1058066589 9:100555054-100555076 TGCAGTGTTTTCAAATACAAAGG - Intronic
1058623400 9:106907279-106907301 CACTGGATTTGGAAATACATTGG + Intronic
1058689763 9:107509889-107509911 TATTAGATTTAGAAATACAAGGG - Intergenic
1058855108 9:109054017-109054039 TGTTGTATTTAGAAATACAGTGG - Intronic
1058855166 9:109054541-109054563 CAATGTATTCTGAAATACACTGG + Intronic
1059067988 9:111105118-111105140 CGCTGTATCTTGAGATACAATGG - Intergenic
1059863936 9:118492446-118492468 TATTTTCTTTTGAAATAAAATGG + Intergenic
1059865839 9:118513016-118513038 GACAGTATGTTGAAATAGAAGGG - Intergenic
1061460226 9:130731735-130731757 AAATGTATATGGAAATACAAAGG - Intronic
1185806976 X:3066971-3066993 TATTGTATTCTGAAACTCAATGG + Intronic
1185979865 X:4766583-4766605 TACTGTATAATGATATAAAATGG - Intergenic
1185997382 X:4966722-4966744 TACTGTCTTTAGAAATACGATGG - Intergenic
1186848237 X:13552882-13552904 TACTGTGCTCTGAAATGCAATGG - Intergenic
1186910040 X:14153338-14153360 TAATCTATTTTAAAATGCAACGG - Intergenic
1187479418 X:19641401-19641423 TAATGAAACTTGAAATACAATGG - Intronic
1187657112 X:21488822-21488844 TACCGTATTTAGAAATAAAATGG - Intronic
1187727745 X:22221275-22221297 CACTGGATTATGAAATAAAATGG - Intronic
1187890031 X:23925707-23925729 TACCGCATTCTGACATACAAAGG + Intronic
1188115814 X:26240885-26240907 TTCTGTATTTTGGAATGCCAAGG - Intergenic
1188621655 X:32233230-32233252 CAGTGTATTTTGAAATGGAAAGG - Intronic
1189503622 X:41588301-41588323 TAGTTTATTTTTAAATACAGAGG + Intronic
1190097328 X:47492110-47492132 TACTGTATGATGACATACCAGGG + Intergenic
1191026307 X:55917533-55917555 GACTTTATTTTGAATTAAAACGG - Intergenic
1191688404 X:63915749-63915771 TACTGTAATATGAGATCCAAGGG + Intergenic
1192049414 X:67710259-67710281 TACTGAATGTTGTAATTCAAAGG - Intronic
1192192715 X:69002174-69002196 TACATAATTTAGAAATACAAAGG + Intergenic
1192721903 X:73707925-73707947 AACTGGATTTTGTAACACAAAGG + Intergenic
1193934094 X:87594323-87594345 TACTATATATTGACATTCAATGG + Intronic
1194002924 X:88454276-88454298 TACTATATTTTCAAATACATTGG + Intergenic
1194981640 X:100447283-100447305 TACGGTATATTGTAATATAATGG + Intergenic
1194988817 X:100522133-100522155 TACTATCTTTTGTAATATAAAGG - Intergenic
1195056797 X:101153731-101153753 TAATGTCTTTTGATTTACAAAGG + Intronic
1195292514 X:103442613-103442635 TTATGTATTTTAAAATACAGTGG - Intergenic
1195819373 X:108926914-108926936 TACTGTATTTAAAATTTCAATGG + Intergenic
1196005064 X:110828048-110828070 AAATTTATTTGGAAATACAAAGG + Intergenic
1196151005 X:112374479-112374501 AAATGTATTTAGAAATTCAAAGG - Intergenic
1196961719 X:121010556-121010578 TACCTTTTTTTGGAATACAAAGG + Intergenic
1197612652 X:128656445-128656467 TGCTATATTTAGAATTACAAAGG + Intergenic
1197654255 X:129099224-129099246 TACTGTATTTTGAGAGAGAGTGG - Intergenic
1198962209 X:142194846-142194868 TACTGTGTTTTCAAAGACATAGG + Intergenic
1198967400 X:142242507-142242529 TACAATATTTTAAAATAAAATGG + Intergenic
1198974178 X:142317088-142317110 TACTAAATTGAGAAATACAATGG - Intergenic
1198976991 X:142347274-142347296 TGTTCTAATTTGAAATACAAGGG - Intergenic
1199309050 X:146301267-146301289 TTCTGCATTTTAAAATACATAGG + Intergenic
1200361268 X:155609560-155609582 TACTGTATGTTGAAGGGCAAAGG - Intronic
1200385601 X:155887492-155887514 CACTGTATTTTGCAATATAGAGG + Intronic
1200822754 Y:7604805-7604827 TAGTGTATTTTGGAATACAATGG + Intergenic
1201015500 Y:9597488-9597510 AAATGTATGTGGAAATACAAAGG + Intergenic
1201272731 Y:12271106-12271128 TATTGTATTCTGAAACTCAATGG - Intergenic
1201313767 Y:12622462-12622484 TAAGGAATTTTAAAATACAATGG + Intergenic
1201320048 Y:12688433-12688455 TATTTTATTTAGAAATAAAATGG + Intergenic
1202056425 Y:20836413-20836435 TACTGTATTTTGAGATGATAGGG + Intergenic
1202237301 Y:22726284-22726306 TAGTGTGTTTTGGAATACAATGG - Intergenic