ID: 950359409 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:12439940-12439962 |
| Sequence | CTTCCAGTATTGTGGAAAAA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 950359409_950359412 | -9 | Left | 950359409 | 3:12439940-12439962 | CCATTTTTCCACAATACTGGAAG | No data | ||
| Right | 950359412 | 3:12439954-12439976 | TACTGGAAGCCGGAAAGTGTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 950359409 | Original CRISPR | CTTCCAGTATTGTGGAAAAA TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||