ID: 950359409

View in Genome Browser
Species Human (GRCh38)
Location 3:12439940-12439962
Sequence CTTCCAGTATTGTGGAAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950359409_950359412 -9 Left 950359409 3:12439940-12439962 CCATTTTTCCACAATACTGGAAG No data
Right 950359412 3:12439954-12439976 TACTGGAAGCCGGAAAGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950359409 Original CRISPR CTTCCAGTATTGTGGAAAAA TGG (reversed) Intergenic
No off target data available for this crispr