ID: 950359412

View in Genome Browser
Species Human (GRCh38)
Location 3:12439954-12439976
Sequence TACTGGAAGCCGGAAAGTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950359405_950359412 -2 Left 950359405 3:12439933-12439955 CCCCTGGCCATTTTTCCACAATA No data
Right 950359412 3:12439954-12439976 TACTGGAAGCCGGAAAGTGTAGG No data
950359407_950359412 -4 Left 950359407 3:12439935-12439957 CCTGGCCATTTTTCCACAATACT No data
Right 950359412 3:12439954-12439976 TACTGGAAGCCGGAAAGTGTAGG No data
950359402_950359412 23 Left 950359402 3:12439908-12439930 CCCGCAAGAGTTGGAAAATTGTG No data
Right 950359412 3:12439954-12439976 TACTGGAAGCCGGAAAGTGTAGG No data
950359403_950359412 22 Left 950359403 3:12439909-12439931 CCGCAAGAGTTGGAAAATTGTGA No data
Right 950359412 3:12439954-12439976 TACTGGAAGCCGGAAAGTGTAGG No data
950359406_950359412 -3 Left 950359406 3:12439934-12439956 CCCTGGCCATTTTTCCACAATAC No data
Right 950359412 3:12439954-12439976 TACTGGAAGCCGGAAAGTGTAGG No data
950359409_950359412 -9 Left 950359409 3:12439940-12439962 CCATTTTTCCACAATACTGGAAG No data
Right 950359412 3:12439954-12439976 TACTGGAAGCCGGAAAGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950359412 Original CRISPR TACTGGAAGCCGGAAAGTGT AGG Intergenic
No off target data available for this crispr