ID: 950364379

View in Genome Browser
Species Human (GRCh38)
Location 3:12472674-12472696
Sequence GTCCCACGGTGTCATGGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950364379_950364383 16 Left 950364379 3:12472674-12472696 CCCTCACCATGACACCGTGGGAC No data
Right 950364383 3:12472713-12472735 TCTTGCAGAGAAAAAAACCAAGG No data
950364379_950364384 26 Left 950364379 3:12472674-12472696 CCCTCACCATGACACCGTGGGAC No data
Right 950364384 3:12472723-12472745 AAAAAAACCAAGGCTAGAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950364379 Original CRISPR GTCCCACGGTGTCATGGTGA GGG (reversed) Intergenic
No off target data available for this crispr