ID: 950366226

View in Genome Browser
Species Human (GRCh38)
Location 3:12486172-12486194
Sequence CAGTGAGTGCCTCTGGCATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 4, 3: 15, 4: 230}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950366222_950366226 15 Left 950366222 3:12486134-12486156 CCAAGGGATGACTATAGTACCCA 0: 1
1: 0
2: 0
3: 19
4: 156
Right 950366226 3:12486172-12486194 CAGTGAGTGCCTCTGGCATCTGG 0: 1
1: 0
2: 4
3: 15
4: 230
950366221_950366226 28 Left 950366221 3:12486121-12486143 CCTTCTGTGGATACCAAGGGATG 0: 1
1: 0
2: 3
3: 27
4: 142
Right 950366226 3:12486172-12486194 CAGTGAGTGCCTCTGGCATCTGG 0: 1
1: 0
2: 4
3: 15
4: 230
950366224_950366226 -5 Left 950366224 3:12486154-12486176 CCACATGTGCAGCACATGCAGTG 0: 1
1: 0
2: 2
3: 11
4: 138
Right 950366226 3:12486172-12486194 CAGTGAGTGCCTCTGGCATCTGG 0: 1
1: 0
2: 4
3: 15
4: 230
950366223_950366226 -4 Left 950366223 3:12486153-12486175 CCCACATGTGCAGCACATGCAGT 0: 1
1: 1
2: 1
3: 12
4: 167
Right 950366226 3:12486172-12486194 CAGTGAGTGCCTCTGGCATCTGG 0: 1
1: 0
2: 4
3: 15
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950366226 Original CRISPR CAGTGAGTGCCTCTGGCATC TGG Intronic
900127194 1:1073859-1073881 CCGTGAGTGCCCCAGGCACCGGG + Intronic
900394020 1:2445717-2445739 CAGTGAGGGCCTCGGGAACCGGG - Intronic
900536319 1:3179457-3179479 CAGTGAGTGGCTCTGGAAGGAGG - Intronic
901000216 1:6145324-6145346 CACTCAGTGCTTCTGGCTTCAGG - Intronic
901778674 1:11578039-11578061 CAGTTAGTGGCTATGGGATCTGG + Intergenic
902176375 1:14653943-14653965 AAGGGAATGCCACTGGCATCTGG - Intronic
902191497 1:14766349-14766371 CAGTGAGTGCTTGGGGCATGTGG - Intronic
904077085 1:27851561-27851583 CACTGATTGCCACTGCCATCTGG + Exonic
904631212 1:31843693-31843715 CAGTGAATGACTCTTGCAGCTGG + Intergenic
905274455 1:36807894-36807916 CAGTGAGAGCTGCAGGCATCTGG - Intronic
905819801 1:40980268-40980290 CAGTGCGGGCCTCGGGCCTCCGG + Intronic
906725405 1:48040702-48040724 CACTGAGTGGCACTGGCAGCAGG + Intergenic
907897950 1:58710384-58710406 AACTGAGTCCATCTGGCATCAGG - Intergenic
913044445 1:115062051-115062073 GAGTCAGTGCCTCTGGCCCCTGG - Intronic
913396882 1:118381382-118381404 CAGGGAGTGCCTGTGGAATGTGG + Intergenic
916979217 1:170115567-170115589 CTGTGAGTGACTCAGGAATCTGG - Intergenic
917683480 1:177392012-177392034 CTCTGAGTGCCTGTGGCATTTGG - Intergenic
917704962 1:177623143-177623165 CAATGAGTGCCTGTGGGATGAGG + Intergenic
919690934 1:200527811-200527833 CTCTGAGTGTCTCTGTCATCTGG - Intergenic
919764827 1:201120296-201120318 CAGTGAGATCCTCTGGCAATAGG - Intronic
920184292 1:204150976-204150998 CAGTGAGTGGCTCTGCCCACAGG + Intronic
923708246 1:236363378-236363400 CAGTGAGTTCTTCTGAGATCTGG + Intronic
923874161 1:238029434-238029456 CAGTGAGTGCCCATGGCTTGGGG - Intergenic
1062834842 10:628869-628891 CTGGGGGTGCCCCTGGCATCTGG - Intronic
1063156014 10:3379793-3379815 CTGTCACTGCCTCGGGCATCAGG - Intergenic
1064388384 10:14920188-14920210 CAGTGACATCCTCTGGCATTCGG + Intronic
1066428553 10:35331475-35331497 CAGCCAGGGTCTCTGGCATCTGG - Intronic
1066541823 10:36455894-36455916 CAGTGAGCACCTCTGATATCAGG + Intergenic
1067467887 10:46514760-46514782 CAGTGAGTGGTTCTGTCAGCTGG - Intergenic
1070560885 10:77565777-77565799 CAGTTACTGCCTCTAACATCTGG + Intronic
1074549714 10:114431186-114431208 CAGTGAGTGCTGCTGGCAACAGG + Intronic
1074894219 10:117760985-117761007 CAGTGAGTGGCTCAGGAAACAGG + Intergenic
1075373371 10:121956653-121956675 CACTGCTTCCCTCTGGCATCAGG - Intergenic
1076335030 10:129701192-129701214 CTCTGAGTTCCTCTGGAATCTGG - Intronic
1078076728 11:8168949-8168971 CAGAGAGTCGCTCTGGCTTCTGG - Exonic
1081487038 11:43538753-43538775 CTGGGGGTGCCTCTGGCATGGGG - Intergenic
1081757532 11:45555226-45555248 CAGTGAGAGCCTCTGGTCTGGGG - Intergenic
1082796402 11:57381137-57381159 CTCTCAGTGCCTCTGGCTTCAGG + Exonic
1083156308 11:60825398-60825420 CAGTCTCTGCCTCTGTCATCAGG + Intergenic
1083173493 11:60936092-60936114 CACCGTGTGCCTCTGGCCTCTGG + Exonic
1083400291 11:62418754-62418776 CAGTGAGTGACACAGGCAGCTGG + Intronic
1083992767 11:66257299-66257321 AAGTGAGTGCCGCTGTTATCTGG - Exonic
1084387272 11:68851855-68851877 CAGAGTGTGGCTCTGGCATGGGG + Intergenic
1084708142 11:70827903-70827925 CGGTGAGGGCCTCTGGCTTTAGG + Intronic
1084762438 11:71282663-71282685 GAGAGAGTGACTCTGGCAGCAGG + Intergenic
1085274453 11:75289430-75289452 CTGTGTCTGCCTCTGCCATCTGG + Intronic
1088723060 11:112611488-112611510 CAGGGAGTGATTCTGGTATCTGG + Intergenic
1089083397 11:115796518-115796540 GAGTGAGTGCTACTGGCCTCTGG + Intergenic
1089386798 11:118073763-118073785 CAGCGAGTTCCCCTGGCCTCTGG + Intergenic
1089627013 11:119757721-119757743 CAGTCAGGGCCCCTGGGATCTGG + Intergenic
1089739693 11:120573871-120573893 CAGTGTGGGCCTCTGGGATGTGG - Intronic
1089741673 11:120588780-120588802 CAGGGCGTGCTACTGGCATCTGG - Intronic
1089975647 11:122729351-122729373 CAGTGTGTGGCTCAGGCACCAGG - Intronic
1090870491 11:130741813-130741835 CAGTGATTGCCTCTGGGAAGTGG + Intergenic
1091662566 12:2395536-2395558 CACTGAGTCCCTCTGTCTTCAGG - Intronic
1091665024 12:2412502-2412524 CAGTGTGAGCCTCTGGCCGCGGG - Intronic
1093888191 12:24487804-24487826 GAGTAAGTGCCTCTACCATCAGG + Intergenic
1094607279 12:31959560-31959582 CCGCGAGTGCCTCTGGCTCCCGG - Intronic
1094646415 12:32328860-32328882 CAGTGAGTGGCTGTGGAAACAGG + Intronic
1095570189 12:43675560-43675582 CAGTGTCTGGCTCTGGCAACAGG - Intergenic
1095599686 12:44000931-44000953 TAGTGAGGACCTCTGGGATCTGG - Intronic
1100185437 12:92134007-92134029 CAGGAAGTGCCTGAGGCATCAGG + Intronic
1101736448 12:107466702-107466724 CATGCAGGGCCTCTGGCATCTGG + Intronic
1102030213 12:109736006-109736028 CAGTCACTGCCACTGGCAACAGG - Intronic
1102391397 12:112551787-112551809 CAGTGACTGCTCCTGGCCTCTGG + Intergenic
1103737819 12:123071474-123071496 CAGGGAGTGGCTCTGGGTTCAGG + Intronic
1104048521 12:125181159-125181181 CAGTGAGTGCCCCTGGCCTTGGG + Intergenic
1108074138 13:46661227-46661249 TAGTGAGTGCCTCTGTGTTCAGG - Intronic
1108263104 13:48678068-48678090 CAGTGAGAGCCTCTGAAATGTGG + Intronic
1108263228 13:48678992-48679014 CAGTGAGAGCCTCTGAAATGTGG - Intronic
1108317698 13:49253877-49253899 CAGTGAGGGCCTTTAGCATAAGG - Intronic
1109552250 13:63918566-63918588 CCGTAAGTGTCTCTAGCATCTGG + Intergenic
1113288005 13:108874878-108874900 CACTTGGAGCCTCTGGCATCTGG + Intronic
1113871408 13:113562087-113562109 CTGTGAGGGCCTCTGGCAAAGGG + Intergenic
1114050058 14:18914787-18914809 CCGTGGGTGCCTCTGCCACCCGG - Intergenic
1114112500 14:19487144-19487166 CCGTGGGTGCCTCTGCCACCCGG + Intergenic
1116145404 14:41061529-41061551 GAGTGAGTTCTTGTGGCATCTGG + Intergenic
1117106698 14:52404705-52404727 GAGTGAGTGGCAATGGCATCAGG - Intergenic
1117469741 14:56030986-56031008 TAGTGAGGGACTCTGGAATCAGG + Intergenic
1119534799 14:75394300-75394322 CAGTGAGTGCCACTGCACTCCGG - Intergenic
1119884391 14:78128224-78128246 AAGGGCGTGGCTCTGGCATCAGG - Intergenic
1121489615 14:94348539-94348561 TAGTGAGTGCCTCTGTGCTCAGG + Intergenic
1122118964 14:99541738-99541760 CAGGAAGTGCCTCAGGGATCAGG + Intronic
1122138451 14:99647852-99647874 CAGTAAGTGCCTGTGTCCTCTGG + Intronic
1122422380 14:101585570-101585592 CAGTGTGTGGCTCTGGTTTCAGG - Intergenic
1123049583 14:105534583-105534605 CAGGGAGGGCCTCTGTCCTCGGG + Intergenic
1124260621 15:28186967-28186989 CAGTGAGTGTCTCATGCCTCAGG - Intronic
1124881475 15:33646542-33646564 CAATGAGTGCCTCTGAGAACTGG - Intronic
1126423822 15:48504049-48504071 CAGGGAATGCCTCTGATATCGGG + Intronic
1127933417 15:63612849-63612871 GAGTGAGTGGGGCTGGCATCAGG - Intronic
1128309179 15:66619977-66619999 GAGTGAATGCCTCTGGGTTCTGG - Intronic
1129686073 15:77686767-77686789 CAGAGTGTTCCTCTGGCAGCAGG - Intronic
1129856612 15:78829687-78829709 TAGTGGGTGCCTCTGTCATGAGG + Intronic
1130107820 15:80942336-80942358 AAGTAAGTGCCTCTGGCCCCTGG + Exonic
1132384863 15:101393159-101393181 CAGTGAGTGCCTCAGCCCTCTGG - Intronic
1132752975 16:1467340-1467362 CAGGGAGAGCCACTGGCATGTGG - Intronic
1132883210 16:2171383-2171405 CTGTGGGGGCCTCTGGCAGCAGG - Intronic
1133146568 16:3791392-3791414 CAGTGAGAGCCTCTGCCCTAGGG - Intronic
1136314978 16:29449211-29449233 CTGGGAGTGCCACTGGCCTCTGG - Intronic
1136429555 16:30188550-30188572 CTGGGAGTGCCACTGGCCTCTGG - Exonic
1139603527 16:68001469-68001491 CATTGAGTTCCTCTTGCAGCTGG + Intronic
1141619658 16:85230211-85230233 CATTGAGTGCCTGTGCCGTCTGG + Intergenic
1141908879 16:87045082-87045104 CAGTCAGTGCCTCCGGGCTCAGG + Intergenic
1142566499 17:843647-843669 AAGTGACTGCCTCTGGGATGGGG - Intronic
1146051796 17:29560057-29560079 CAGTGGGTGCATCTGGCACAAGG + Intergenic
1147914127 17:43876687-43876709 CTGTCTGTGCCTCTGGCACCAGG - Intronic
1148844572 17:50521746-50521768 CTGTGAGTGGCTCTGGCAAGAGG + Intronic
1150209470 17:63434301-63434323 CGGAGAGTGGCTCTGGCAGCAGG - Exonic
1150277136 17:63906113-63906135 CAATGAGTACCTCTGGGATTAGG - Intergenic
1151229213 17:72670905-72670927 CAGTGAGCGCCTCTGGAGCCCGG - Intronic
1152259113 17:79257201-79257223 CTGTGAGTCCCTCTGCCAGCAGG + Intronic
1153130829 18:1853986-1854008 CACTGAGTGCCGCTAGCATCAGG + Intergenic
1153155358 18:2143451-2143473 AAGTGAGTGACTGTGGGATCTGG - Intergenic
1155145246 18:23078047-23078069 CCATGAGTCCCTCTGGCTTCTGG + Intergenic
1156739710 18:40309465-40309487 CTGAGAGTTCCTCTGGCATGTGG - Intergenic
1158847231 18:61457482-61457504 TAGGGAGTGCCTCTGCCACCAGG - Intronic
1159731307 18:72032335-72032357 CAGTGAGTTCCTCTGGCTCTGGG + Intergenic
1160384043 18:78483675-78483697 CAGGGGGTGCTACTGGCATCTGG + Intergenic
1161066985 19:2243496-2243518 CAGGGAGCGCCTCCGGCAGCTGG + Exonic
1161167515 19:2796333-2796355 CAGGGAGTGCTTGGGGCATCAGG + Intronic
1163300075 19:16439557-16439579 CAGTGTGTGCCTGTGGCCTCAGG + Intronic
1163594752 19:18214492-18214514 GACTGAGGGCCTCTGGCAGCTGG + Intronic
1163681782 19:18686881-18686903 TAGGGAGTGCTTCTAGCATCTGG + Intronic
1164791862 19:30992994-30993016 CAGTGATTACCTCTGGGAGCAGG + Intergenic
1165881516 19:39047339-39047361 CAGTGATGGGCTCTGGCATTAGG + Intergenic
1167136596 19:47619961-47619983 CAGTGACTGCTTCTGGGAGCAGG - Intronic
1167715978 19:51143130-51143152 GAGTGGGTGCTTCTGGCATCTGG - Intronic
1167768766 19:51500957-51500979 GGGTGGGTGCTTCTGGCATCTGG + Intronic
1168687943 19:58359468-58359490 CAGTGTGTCCCTCAGGCACCTGG - Intronic
925929654 2:8696801-8696823 CAGTGAGCGGCTCTGGCATCTGG + Intergenic
925952308 2:8926758-8926780 CAGCCAGTCCCTCTGGCCTCTGG - Intronic
926055010 2:9769341-9769363 CTGTGAGAGTCTCTGGCACCTGG - Intergenic
929022195 2:37564666-37564688 CAGTGTGAGCCTCGGGGATCTGG - Intergenic
929994236 2:46815308-46815330 CATTGAGTCCCTCAGCCATCTGG - Intergenic
930499760 2:52199169-52199191 AAGTCATTGCCTCTGGTATCAGG + Intergenic
930934552 2:56932038-56932060 AAGTGAGTGCCCCTGAGATCTGG - Intergenic
931809200 2:65838040-65838062 CAGTGAGTGCTTCTAGATTCAGG - Intergenic
933167085 2:79088105-79088127 CAGTAAGAGATTCTGGCATCAGG + Intergenic
933302684 2:80560421-80560443 CAGTTAGTGCCTCTGGGACTTGG + Intronic
937237096 2:120437565-120437587 CAGTCACTGCCTCAGGCCTCCGG - Intergenic
938261816 2:129902189-129902211 TGGTCAGTGCCTCTTGCATCTGG - Intergenic
938653265 2:133405861-133405883 TATTGAGTGCCTACGGCATCTGG - Intronic
938770149 2:134494830-134494852 CAGTGAGTGCCTGGGGGACCCGG - Intronic
939711931 2:145532764-145532786 AAGTAAGTTCCTTTGGCATCAGG - Intergenic
941803036 2:169682339-169682361 CAGTGAGGGCCCATGGCAACCGG + Intronic
1168840554 20:907359-907381 CAGGGCCTGCCTCTGCCATCTGG + Intronic
1169027737 20:2384684-2384706 AAGTGTGTGCCTCTGAAATCAGG + Intronic
1169700439 20:8440449-8440471 CAGTGATTCCCTGTGGCACCTGG + Intronic
1170604486 20:17865432-17865454 AAGAGATTGCCACTGGCATCTGG - Intergenic
1171881626 20:30621685-30621707 CAGTGAGTGAGGTTGGCATCTGG - Intergenic
1173039917 20:39452565-39452587 GTGTGTGTGCCTCTGGGATCTGG - Intergenic
1173887441 20:46472761-46472783 CAGTGAGTGGCTCTGTCTTAAGG + Intergenic
1173995676 20:47336909-47336931 CAGTGATTGTGGCTGGCATCTGG - Intronic
1174887382 20:54350605-54350627 CAGTGAGAGCCTCCTGCTTCAGG + Intergenic
1175813371 20:61870648-61870670 CAGTGAGTGCTTCGGGAAGCTGG + Intronic
1176053361 20:63132324-63132346 CAGTGAGTGCCTCTGCCCTCAGG - Intergenic
1176168539 20:63686815-63686837 CAGTGCGTGCCTGAGGCAGCCGG + Intronic
1178581164 21:33839694-33839716 CAGTGAGGGCGTGGGGCATCTGG - Intronic
1180137409 21:45870732-45870754 CACTCAGTGCCTCTGGCCTCTGG + Intronic
1180138572 21:45876983-45877005 CTGTGAGTGCGGCTGGCAGCAGG - Intronic
1180468538 22:15637162-15637184 CCGTGGGTGCCTCTGCCACCCGG - Intergenic
1180699334 22:17773245-17773267 CAGAGGGATCCTCTGGCATCAGG - Intronic
1181266672 22:21634701-21634723 CAGGGAGTCCCTCTGGGAGCAGG - Exonic
1182319926 22:29472009-29472031 CAGAGAGTGGCTCTTGCACCTGG - Intergenic
1183131058 22:35836508-35836530 CAGTGAGTCCATGTGGCAGCAGG - Intronic
1184217208 22:43075776-43075798 CAGGGGATGCCTCTGGCATCGGG + Intronic
1185193089 22:49451273-49451295 CAGTGTCTGCCTCTGGCCACCGG + Intronic
949783322 3:7713972-7713994 CAGAGAGAGCCACTTGCATCAGG + Intronic
949957370 3:9279996-9280018 GAGCCAGTGCCTCTGGCATTTGG + Intronic
950366226 3:12486172-12486194 CAGTGAGTGCCTCTGGCATCTGG + Intronic
953388220 3:42519139-42519161 GAGTGGGTGCCTATGGCCTCAGG + Intronic
955451846 3:59076812-59076834 AAGTGAGAGCCTCTGGGAACAGG - Intergenic
956569983 3:70683303-70683325 CAGTAAGTGTCTCTGGCATAAGG + Intergenic
956607013 3:71083202-71083224 CAGTGAGTTCCCCTGAGATCTGG + Intronic
956872720 3:73433975-73433997 CTCTGAGTGACTCTGGCAGCTGG + Intronic
958729863 3:97950042-97950064 CAGTAAGTTCTGCTGGCATCTGG - Intronic
959289975 3:104461246-104461268 CAGTGAGGTGCTCTGCCATCTGG + Intergenic
962875769 3:139535175-139535197 CAGTGAGAGCCTCTGCCCTTTGG + Intronic
963663864 3:148157626-148157648 CAGTGACTGCCTTTGGTATATGG + Intergenic
964713983 3:159702249-159702271 CATTTAGTGCCTCTGGAAACTGG - Intronic
966118717 3:176497378-176497400 CAGTCAGAGTGTCTGGCATCTGG + Intergenic
967044218 3:185721771-185721793 TAGTGAGTTCCTTTGACATCAGG + Intronic
967931804 3:194695430-194695452 CCGTGAGGGCATCTGGCAGCAGG + Intergenic
969511908 4:7622952-7622974 CAGGGAGTGGCTCTGGGGTCTGG - Intronic
969591880 4:8126730-8126752 GAGGGTGTGCCTCTGGCATCTGG - Intronic
973041280 4:45472682-45472704 GAGTGAGTGAGTATGGCATCTGG - Intergenic
976956121 4:90902701-90902723 CAGTGAGCCCTTCTGGCAGCAGG + Intronic
981571877 4:146160305-146160327 AAGTGTTTGCCTCTGGCAGCAGG - Intergenic
982409788 4:155061674-155061696 CAGTTAGTGCCTCTGTCATTAGG - Intergenic
987131171 5:14861501-14861523 CAGTGAGGACCTCTGGCTCCAGG - Intronic
988992389 5:36684173-36684195 GAGTGAGTGCACATGGCATCTGG - Intronic
990563663 5:57008050-57008072 CGTTTTGTGCCTCTGGCATCTGG - Intergenic
992217929 5:74543866-74543888 CACTGACTGCCTCTGGGGTCAGG - Intergenic
992709537 5:79436500-79436522 AAGTGTGTGCCTTTGGCATGTGG - Intronic
996490170 5:124085579-124085601 TAGTGAGTGCCCCTGGAATTGGG + Intergenic
996728438 5:126693402-126693424 CAGTGATTGTCTCTGGAAGCTGG - Intergenic
996902654 5:128560639-128560661 CAGTGATTGCCTATGGGATGGGG - Intronic
998210385 5:140192733-140192755 CAGGGAGTGCCATTTGCATCTGG + Intronic
998868574 5:146530107-146530129 GAGTGAGTGCCCCTGGGCTCTGG - Intergenic
999948981 5:156628159-156628181 CAGTGAGTTCCTGTGAGATCTGG - Intronic
1002446744 5:179294717-179294739 CAGGAAGTTTCTCTGGCATCAGG - Intronic
1004743355 6:18485389-18485411 CATTGAGTGCTTCTGGCTGCTGG + Intergenic
1006602278 6:35233910-35233932 GAGGGAGTACCACTGGCATCTGG - Intronic
1008017719 6:46540832-46540854 CAGAGAGTGTCTCTGGGCTCTGG + Intergenic
1010356208 6:74936976-74936998 CAGTGTGATCCTTTGGCATCTGG - Intergenic
1014031982 6:116716520-116716542 CAGTGACTGCCTCTGGGCACAGG - Intronic
1016580826 6:145627892-145627914 TAGAGAGAGCCTCTGGCCTCTGG - Intronic
1016612654 6:146009938-146009960 CAGTGTGGGACTCTGGCCTCTGG - Intergenic
1016878611 6:148888233-148888255 CAGTGAGTTCCTGTGAGATCTGG - Intronic
1017409318 6:154151638-154151660 CAGCAAGAGCCTCTGGCATGAGG + Intronic
1022718602 7:32922051-32922073 CAGTGAGTGGACCTGGCATCAGG + Intergenic
1022837493 7:34131624-34131646 AAGTGAAGGCCTCTAGCATCTGG - Intronic
1025901779 7:65750862-65750884 CAGTAAGTGCTTCTGGGTTCTGG - Intergenic
1027155399 7:75763924-75763946 CAGTGGCTGTCTCTGGCCTCTGG - Intergenic
1028903665 7:96129165-96129187 CACTGGGTGCCTCTGGCACCAGG - Intronic
1030704515 7:112677641-112677663 CAGTAAGTGCCACTTTCATCAGG + Intergenic
1031968646 7:128047278-128047300 CAGTGAGTGCCTGTGGACTCAGG + Intronic
1032505977 7:132435057-132435079 CAGTCTGCGCTTCTGGCATCTGG + Intronic
1034431359 7:151042883-151042905 CAGTGAGGACAGCTGGCATCTGG - Intronic
1035206751 7:157298603-157298625 CTGTGGGCGCCTCTGGCCTCTGG - Intergenic
1036717443 8:11139429-11139451 CAGTGAGTGCCTCAGGCTGTTGG - Intronic
1038415659 8:27393427-27393449 CAGTTAGTGGCTCTTGAATCAGG + Intronic
1038647842 8:29375912-29375934 CAGTGATTGCCTGTGGCAGGGGG - Intergenic
1039143836 8:34423028-34423050 CACTGTGAGCCACTGGCATCTGG + Intergenic
1042226771 8:66520476-66520498 CAGTGAGTGTTTCTGGCAGTTGG - Intergenic
1043872289 8:85447025-85447047 CAGTGTGTGTCTCTTGCATAAGG + Intronic
1044887069 8:96790707-96790729 CAGTAAGAGTCTGTGGCATCTGG - Intronic
1044944868 8:97380485-97380507 CAGTCACTTACTCTGGCATCTGG + Intergenic
1047303622 8:123635795-123635817 CAGTGAGTGCTGCAGGCAGCTGG - Intergenic
1049451127 8:142662129-142662151 CAGTGAGTGGCTGTGTCCTCAGG - Intronic
1051145737 9:14025521-14025543 GAGGGAGTGCCTCTTCCATCAGG - Intergenic
1051197359 9:14577167-14577189 CAGTGACTGCGTGTGTCATCTGG + Intergenic
1055057725 9:72039138-72039160 CCCTGAGTGCTTCTGCCATCTGG - Intergenic
1057182181 9:93036178-93036200 CACTGTGTGCCACTAGCATCAGG - Exonic
1057505581 9:95630830-95630852 CATTGGGTGGCTCTGTCATCTGG + Intergenic
1060395386 9:123312922-123312944 CAGAGAATGCCTCTGGCAGGTGG - Intergenic
1060500339 9:124148896-124148918 CAGTGATTGCCTCTGGATTGTGG + Intergenic
1061010092 9:127949697-127949719 CAGGGAGAGCCTATGGTATCTGG - Intronic
1061573870 9:131494285-131494307 GAGTGAGCGCCTCTGGCCGCAGG + Intronic
1062001368 9:134217362-134217384 CAGGGAGTGCCCCTGGCCTGAGG - Intergenic
1062463567 9:136671734-136671756 GAGTGGGTGCCTGGGGCATCAGG - Intronic
1185832500 X:3315550-3315572 CAGTGGGTGCTTCTGGTATCTGG - Intronic
1186439995 X:9577554-9577576 CAGTGGGTGCTTCTGGCATCTGG + Intronic
1187310290 X:18135282-18135304 CAGTGACTGCCTCTGGGATCTGG + Intergenic
1188052068 X:25499900-25499922 CAGTGAGTGCCTATTTAATCTGG + Intergenic
1191841239 X:65514802-65514824 GAGTGAGTGCCCATGGCAACAGG - Exonic
1194925087 X:99815285-99815307 CAGAGAGTGTCTCTGGATTCTGG + Intergenic
1199605187 X:149572287-149572309 CAGTGTGTGACTCTGGCTTTTGG - Intergenic
1199639993 X:149850538-149850560 CAGTGTGTGACTCTGGCTTTTGG + Intergenic
1201243552 Y:11981403-11981425 CGGTGGGTGCTTCTGGTATCTGG + Intergenic