ID: 950367336

View in Genome Browser
Species Human (GRCh38)
Location 3:12496894-12496916
Sequence CCTACAGTGTAGCTGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 183}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950367336_950367341 -9 Left 950367336 3:12496894-12496916 CCTTCCTCCAGCTACACTGTAGG 0: 1
1: 0
2: 1
3: 15
4: 183
Right 950367341 3:12496908-12496930 CACTGTAGGGTCAGAGAAAGAGG 0: 1
1: 0
2: 0
3: 20
4: 240
950367336_950367342 3 Left 950367336 3:12496894-12496916 CCTTCCTCCAGCTACACTGTAGG 0: 1
1: 0
2: 1
3: 15
4: 183
Right 950367342 3:12496920-12496942 AGAGAAAGAGGCTTTCACAGAGG 0: 1
1: 0
2: 2
3: 48
4: 440

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950367336 Original CRISPR CCTACAGTGTAGCTGGAGGA AGG (reversed) Intronic
900737825 1:4310228-4310250 CCTACAGCTGAACTGGAGGAGGG - Intergenic
902091216 1:13904718-13904740 ACTACAGTGTAGCTAGGGGTAGG + Intergenic
902613675 1:17612003-17612025 CTTACAGACTATCTGGAGGATGG - Intronic
904990373 1:34587936-34587958 CCTACAGTACTGCTGGATGAGGG - Intergenic
907068397 1:51510633-51510655 ACTACAGTGGAGCCGGAAGAGGG + Intronic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
908671831 1:66556534-66556556 CTTGCAATGGAGCTGGAGGAGGG + Intronic
908981418 1:69963577-69963599 GCTACAGTGTAGATAGAAGATGG + Intronic
911049673 1:93660110-93660132 CATAGAGTGTAGTGGGAGGAAGG - Intronic
912274854 1:108245338-108245360 TACACAGTGTAGGTGGAGGATGG - Intergenic
912274917 1:108246162-108246184 TACACAGTGTAGGTGGAGGATGG + Intergenic
912286349 1:108373629-108373651 TACACAGTGTAGGTGGAGGATGG - Intergenic
912286411 1:108374454-108374476 TACACAGTGTAGGTGGAGGATGG + Intergenic
912293302 1:108448194-108448216 TACACAGTGTAGGTGGAGGATGG - Intronic
912293365 1:108449019-108449041 TACACAGTGTAGGTGGAGGATGG + Intronic
912968181 1:114255604-114255626 CCTTCAGTGAAGCTGGAGGCAGG + Intergenic
913386062 1:118259508-118259530 GTTACAGTGTATCTGGAAGAAGG - Intergenic
913640043 1:120804033-120804055 CTTACAGTGTCACTGGAAGATGG + Intergenic
914278436 1:146146305-146146327 CTTACAGTGTCACTGGAAGATGG - Intronic
914382384 1:147128813-147128835 TACACAGTGTAGTTGGAGGATGG - Intergenic
914539483 1:148597253-148597275 CTTACAGTGTCACTGGAAGATGG - Intronic
914627198 1:149474375-149474397 CTTACAGTGTCACTGGAAGATGG + Intergenic
915731070 1:158054912-158054934 CCTACACTGTGGGTGGAGGTGGG + Intronic
916559804 1:165924916-165924938 CCTTCAGAACAGCTGGAGGACGG + Intergenic
917484939 1:175447303-175447325 CCTTCAGAGAAGCAGGAGGAAGG - Intronic
919182357 1:194103182-194103204 CCTACACTGGAGATGGATGATGG - Intergenic
919470875 1:197977756-197977778 CATACCATGTAGCTGTAGGATGG - Intergenic
919736808 1:200957762-200957784 CTTACAGTGTAGTGGGAGGAGGG + Intergenic
919855903 1:201705869-201705891 CCTACAGTGTGGCTGGGGGCAGG - Intronic
919860539 1:201736982-201737004 ACTACAGTGGAGGTGGAGGGTGG - Intronic
922762128 1:228139849-228139871 CCTGCAGTGTAGATGGAGGACGG + Intergenic
922872433 1:228914020-228914042 TCCCCAGGGTAGCTGGAGGATGG - Intergenic
923465387 1:234243754-234243776 CCTGCACTGTAGCAGGAGCAGGG - Intronic
924020699 1:239778598-239778620 CCTATAATGTTGCTGGAGAAGGG - Intronic
1063570825 10:7213278-7213300 CCTACTGTGTATTAGGAGGAAGG + Intronic
1064143280 10:12807786-12807808 CCTGCAGTGGAGCTGGACGGAGG - Intronic
1064299590 10:14111850-14111872 CCTGCAGGGCAGGTGGAGGAGGG + Intronic
1066056194 10:31682424-31682446 GCTACTGTGTAGCTGGAGATAGG - Intergenic
1067776970 10:49170927-49170949 TCTGCAAAGTAGCTGGAGGATGG + Intronic
1068786995 10:60987564-60987586 CCTACATGGGAGATGGAGGATGG - Intronic
1069455648 10:68551851-68551873 CCTCCAGAGTAGCTGGTGGGTGG + Intergenic
1072926891 10:99623621-99623643 CCTACTGTGTACCTGGAAGGAGG - Intergenic
1075659951 10:124186509-124186531 CCAACAGTTAAGCTGGAAGAAGG - Intergenic
1078487336 11:11735793-11735815 CCTACAGGGTGTCTGGGGGAGGG + Intergenic
1080011316 11:27462372-27462394 GGTACAGTTTATCTGGAGGAGGG - Intronic
1083119439 11:60496857-60496879 CCAACTGTGAAGTTGGAGGAAGG - Intronic
1083887712 11:65580970-65580992 CCTGCACTGTAGTTGGGGGAGGG + Intronic
1084328577 11:68416264-68416286 GCCACAGAGGAGCTGGAGGACGG - Intronic
1086797163 11:91120414-91120436 GCTACAGTGGAGCTGGAGATAGG + Intergenic
1086861712 11:91932242-91932264 CATCCAGTGCAGCTGGAGGAGGG - Intergenic
1088360851 11:108988257-108988279 CTTGCAGTGTATATGGAGGAAGG + Intergenic
1089178583 11:116565553-116565575 CATGCAGTGTAGGTGGAAGAGGG - Intergenic
1089878854 11:121753940-121753962 CCTACAGTGTATCTTGAGTTGGG + Intergenic
1098532698 12:71558588-71558610 CCTGCAGTATAGCTTAAGGATGG + Intronic
1101938741 12:109083020-109083042 CCTACACTGGAGCTGCAGGATGG + Exonic
1103041686 12:117701045-117701067 CCTATTGTGCAGATGGAGGATGG - Intronic
1104930074 12:132334060-132334082 CCTACCGCGTACCTGGAAGACGG + Intergenic
1104984141 12:132587185-132587207 ACTGCAGTGTGGCTGGAGGACGG + Intergenic
1105478402 13:20749306-20749328 TCTACATTGTAGTAGGAGGATGG - Intronic
1114299510 14:21361887-21361909 CCTCCACAGTAGCTGGATGACGG + Intronic
1116503673 14:45651654-45651676 TCTACAGTATAGCTTGAGTAGGG - Intergenic
1116548189 14:46197974-46197996 CCTACAGTGTTACTGGATGTTGG + Intergenic
1118452554 14:65917376-65917398 CCTACAGTGCTGCTGGCAGAAGG - Intergenic
1121311841 14:92939538-92939560 CCAAGAGTGGAGATGGAGGATGG - Exonic
1122425824 14:101604761-101604783 CCCAGAGTGTAGCTGGAGCTGGG + Intergenic
1125600640 15:40913777-40913799 CCCACTGTGTAGATAGAGGAAGG + Intergenic
1128390426 15:67179183-67179205 CCTCCAGTCTGTCTGGAGGATGG + Intronic
1129647441 15:77449508-77449530 CATACAATTTAACTGGAGGAAGG - Intronic
1131589363 15:93731534-93731556 CCTACAGTGTTGCTTGGGTAGGG + Intergenic
1132138573 15:99368760-99368782 CCAACAGTGTGGCTGGACAATGG - Intronic
1134875702 16:17696745-17696767 CCTCCATTCTTGCTGGAGGAAGG - Intergenic
1136907859 16:34118887-34118909 TCTACAGTGAGGCTGGGGGAGGG + Intergenic
1141913348 16:87075997-87076019 CCGCCAGTGGGGCTGGAGGAAGG - Intergenic
1143469335 17:7162012-7162034 CCCCCAGTGTAGCAGGAGGGGGG - Intergenic
1143486416 17:7257550-7257572 CCTCTGGTGTAGCTGGAGGTGGG + Intronic
1144144212 17:12381693-12381715 TGTAGAGTGGAGCTGGAGGAAGG + Intergenic
1144951380 17:18996280-18996302 CCAACCGTGCTGCTGGAGGAGGG - Intronic
1150641193 17:66950922-66950944 AGGACAGTGTCGCTGGAGGAGGG + Intergenic
1150898934 17:69248622-69248644 GCTACAGTGGAGTTGGAGAATGG - Intronic
1152491725 17:80639515-80639537 CCAGCAGTGCAGCTGGGGGAGGG - Intronic
1157502531 18:48201569-48201591 CCTGGAGTGTAGGTGGAGGGAGG - Intronic
1158031287 18:52968146-52968168 CTCAGAGGGTAGCTGGAGGATGG - Intronic
1158672929 18:59492966-59492988 CCCACAGTGTGGTGGGAGGAAGG - Intronic
1160294923 18:77629300-77629322 CACACAATGCAGCTGGAGGAAGG + Intergenic
1160337902 18:78059278-78059300 CCCACAGGGTGGCTGGAAGACGG - Intergenic
1161094728 19:2383680-2383702 CCTCCAGAGTAGCTGGAATATGG - Intergenic
1162096231 19:8311584-8311606 GCTACAGCAGAGCTGGAGGAGGG + Exonic
1162974934 19:14203201-14203223 CCCACAGAGGGGCTGGAGGAGGG + Intronic
1163557858 19:18002456-18002478 CCTACTGTGTGGCTGCGGGAGGG + Intronic
1163753171 19:19090767-19090789 CCTCCCCTGTACCTGGAGGAGGG - Intronic
1165346971 19:35254573-35254595 GCTGCAGTGCAGCTGGAGGTGGG - Intronic
1166195731 19:41204507-41204529 TCTGCAGTGAAGGTGGAGGAGGG - Intronic
1166287475 19:41840444-41840466 CCTACAGGGAAACTGGAGGAAGG + Intronic
927922216 2:26981794-26981816 ACTGGAGTGTAGGTGGAGGAGGG - Intronic
932474308 2:71991991-71992013 TCAACAGGGTTGCTGGAGGAAGG - Intergenic
933301518 2:80546085-80546107 CTTACAAGGCAGCTGGAGGAGGG + Intronic
933435112 2:82239506-82239528 CTTAAAGAGTAGCTGGAGAAAGG + Intergenic
936266846 2:111017445-111017467 CCTACTGTGCTGCTGGAGGCAGG - Intronic
945382212 2:209154374-209154396 CCTACAGTGTAGGAGAAGAATGG + Intergenic
948630967 2:239302579-239302601 CCCACTGTGTCGCTGGAAGAGGG - Intronic
1169001245 20:2169407-2169429 CCTCCACTGTGGCTGGAAGAGGG + Intronic
1170595022 20:17798744-17798766 CCTCCAGGGCAGCTGGAGGCAGG - Intergenic
1172962168 20:38806727-38806749 TCTCCAGTGAAGCTGGAGGCCGG - Intronic
1173182689 20:40816526-40816548 CCTTCAGTCTGGCAGGAGGAGGG + Intergenic
1176160040 20:63643096-63643118 CAGACAGGGAAGCTGGAGGAAGG - Intronic
1179192515 21:39135590-39135612 CCAAGACTGAAGCTGGAGGAAGG - Intergenic
1180999369 22:19980948-19980970 CCCAGAGTGTGGCTGGAGCAAGG + Intronic
1181491941 22:23265696-23265718 CCATCAGTGTATCTGGATGAAGG - Intronic
1182090786 22:27593235-27593257 CCTACAGTGTGGATGTAGGAGGG + Intergenic
1182287400 22:29256539-29256561 CCTACAGTTTTGCTGGATGAAGG - Intronic
1184191787 22:42899774-42899796 CCAGCAGTGCAGCGGGAGGAAGG + Intronic
1184690524 22:46115294-46115316 CATACTGTGTAGTTGGAGCAGGG + Intergenic
950367336 3:12496894-12496916 CCTACAGTGTAGCTGGAGGAAGG - Intronic
950484727 3:13266431-13266453 CCTGCAGTGCAGCTGGGTGACGG + Intergenic
950544065 3:13628661-13628683 CCAACAGAGCAGCTGGAGGCAGG - Intronic
952243760 3:31562618-31562640 CCTTCAGAGTAGCTGTAGGCTGG + Intronic
952873128 3:37919860-37919882 CCCACAGGATAGCTGGAGAAGGG + Intronic
954428213 3:50454764-50454786 TCCACAGGGTGGCTGGAGGAGGG + Intronic
959275963 3:104277959-104277981 CTTAGAGTTGAGCTGGAGGAAGG - Intergenic
961476877 3:127152572-127152594 CCCCCAGTGGATCTGGAGGAGGG - Intergenic
961709981 3:128820652-128820674 CCTGCAGTGTGAATGGAGGAAGG - Intergenic
966481315 3:180412132-180412154 ACTACAGTGTAACTGAAGTAGGG - Intergenic
966680571 3:182637859-182637881 GATCCAGGGTAGCTGGAGGAGGG - Intergenic
966958498 3:184909184-184909206 ACTACAGTAGAGCTGGAGAAAGG + Intronic
975485614 4:74932117-74932139 CCTAAAGTGTAGCAAGAGCAGGG + Intergenic
976472713 4:85448049-85448071 CAGACAGTGCAGCTGGAGGGTGG + Intergenic
978928642 4:114283195-114283217 CTGACTTTGTAGCTGGAGGAAGG - Intergenic
982452599 4:155570784-155570806 CCTTCACTGTGGCTGGAGGTGGG + Intergenic
988381271 5:30499558-30499580 GCTGCAGTCTAGCTGGGGGAGGG - Intergenic
991212618 5:64123482-64123504 CCTGCAGTATAACTGGATGAAGG - Intergenic
993306399 5:86280386-86280408 TACACAGTGTAGGTGGAGGATGG - Intergenic
993306459 5:86281213-86281235 TATACAGTGTTGGTGGAGGATGG + Intergenic
993898610 5:93569954-93569976 CCAACAGATTGGCTGGAGGATGG + Intergenic
995263736 5:110135563-110135585 GGGACAGTGTAGCTGGGGGAAGG - Intergenic
995402713 5:111759814-111759836 CCTACAGGATAGATGGAAGAGGG - Intronic
995417434 5:111926251-111926273 CCAACAGTGCAGTTGGAGGAGGG + Intronic
996053837 5:118963414-118963436 AGTTCAGTGTAGCTGGAGAAAGG + Intronic
996484156 5:124011837-124011859 CCAACATTGTAGAGGGAGGATGG - Intergenic
998481573 5:142467491-142467513 TCTAGAGTGAAGCTGGAGTAAGG + Intergenic
999153456 5:149441939-149441961 GCTCCTGTGCAGCTGGAGGAAGG + Intergenic
1000259407 5:159572245-159572267 GCTAAAGTGAAGCTGGAGAATGG + Intergenic
1001455485 5:171856972-171856994 TATACAGGGTAGCTGGAGGGAGG - Intergenic
1002701523 5:181128316-181128338 TCTAGAGTGTCCCTGGAGGATGG + Intergenic
1006072349 6:31506847-31506869 CCTCCAGGCTAGCAGGAGGATGG - Intronic
1006131827 6:31874203-31874225 CCTAGAATGTAGCTGAAGCAGGG + Intronic
1007226582 6:40319804-40319826 CCTACAGTGTGATTGAAGGATGG - Intergenic
1007322333 6:41036793-41036815 CCTACAGTGAAGCTGGAATGAGG + Intronic
1007605073 6:43112122-43112144 CATACAGTGTAGATGCAGGGTGG - Intronic
1009045902 6:58237444-58237466 CCTCCAGTGTACCTAGAGGAGGG - Intergenic
1009221718 6:60991757-60991779 CCTCCAGTGTACCTAGAAGAGGG - Intergenic
1009494735 6:64332672-64332694 CCTCCAGTGTGGATGGAGCAGGG - Intronic
1012842922 6:104352641-104352663 CATACTGTCTAGCTGGAGGATGG + Intergenic
1016062578 6:139645918-139645940 GCAAAAGTGCAGCTGGAGGATGG + Intergenic
1019493777 7:1326872-1326894 CCTACAGTCTGGGTGGAGGCTGG - Intergenic
1020021541 7:4872345-4872367 CCTAAAATGTAACGGGAGGAAGG + Intronic
1023640430 7:42251449-42251471 CCTGCTGTGCAGCTGGAGTAGGG + Intergenic
1025014323 7:55426776-55426798 ACTACACTGTGGCTGGAGCACGG + Intronic
1027360927 7:77408909-77408931 CCTGCACTGGAGCTGGAGGTGGG + Intronic
1028577738 7:92370790-92370812 CCAGCAGTGTAGTTGGAGGTGGG + Intronic
1031367226 7:120917560-120917582 CATCCAGTTTAGCTGGATGAAGG + Intergenic
1031794412 7:126153278-126153300 CCTACAGCATAGCTGGGGCATGG + Intergenic
1032318915 7:130867084-130867106 CCTAGAGAGTACCTGGAGCAGGG + Intergenic
1033831917 7:145265137-145265159 CACTCAGTGTAGTTGGAGGATGG + Intergenic
1035466114 7:159079028-159079050 CCTTCAGTGTCCATGGAGGAAGG + Intronic
1038892754 8:31745201-31745223 CCTGCTGAGTAGCTGGTGGAAGG + Intronic
1039906449 8:41790039-41790061 CTTACAGTGGACCTGGAGGCGGG - Intronic
1041766280 8:61421445-61421467 GCTACCCTGTAGGTGGAGGATGG - Intronic
1042284428 8:67092557-67092579 CCTCCTGAGTAGCTGGAGGCAGG + Intronic
1042328650 8:67555243-67555265 CCAACCGTGTAACTGGAGGTTGG + Intronic
1042554417 8:70022102-70022124 CCTCCAGTGTGCCTGGAGGGTGG + Intergenic
1042705711 8:71664138-71664160 TTTTCAGTGTGGCTGGAGGAGGG - Intergenic
1043150434 8:76707822-76707844 CTTGCAGTGTAGCTGGAAGTTGG - Exonic
1043307141 8:78809100-78809122 CCTAAAAAGTAGCTGGAGAAAGG + Intergenic
1044083039 8:87908367-87908389 GCTTCAGTGTAGCTTCAGGATGG - Intergenic
1044415892 8:91939169-91939191 CCTACATCCTAGCTGGAGGCTGG + Intergenic
1044590517 8:93909795-93909817 TCTACAGTGTAGCAAGAGGAGGG - Intronic
1044859680 8:96510657-96510679 CCTACAATGGAGTTGGAGGAGGG + Intronic
1045776657 8:105811682-105811704 TTTACATTGTAGCAGGAGGACGG - Intergenic
1047128538 8:121990631-121990653 GCTACAGTGTTGTTGGAAGATGG + Intergenic
1047277561 8:123417050-123417072 TCTACAGTTTTGCGGGAGGAGGG + Intronic
1049011638 8:139891417-139891439 CCTACAGTCTTGCTGGGTGAGGG + Intronic
1053467109 9:38316632-38316654 CCTGCAATGTGGCTGCAGGAAGG + Intergenic
1055475059 9:76654816-76654838 CCTACAGTGTGGTAGGAAGAAGG - Intronic
1055833441 9:80410261-80410283 CCCACAGTGTTGCTGGAGCTGGG + Intergenic
1055850112 9:80616819-80616841 CCTACAGTTGAGGTTGAGGATGG + Intergenic
1057310771 9:93941719-93941741 CCTACTCTGGGGCTGGAGGAGGG - Intergenic
1058673920 9:107384364-107384386 GCTAAAGTGTGGCTGGAGGGTGG + Intergenic
1061048470 9:128180302-128180324 CATTCAGTGGAGCTGGAGCAAGG - Intronic
1062176797 9:135167833-135167855 GCCACAGTGTGGCTGCAGGAAGG + Intergenic
1062367530 9:136218382-136218404 CCTGGAGAGTAGATGGAGGAGGG - Intronic
1186562330 X:10625952-10625974 TCTAAATTGTAGCAGGAGGATGG + Intronic
1186688065 X:11946344-11946366 CCTACAATGTGTCTAGAGGACGG - Intergenic
1188417091 X:29948741-29948763 CCTAAAATGAAACTGGAGGAGGG - Intronic
1190597886 X:52065248-52065270 CCTTCAGTGAAGCAGGAAGACGG - Intronic
1190610938 X:52188825-52188847 CCTTCAGTGAAGCAGGAAGACGG + Intronic
1191809836 X:65175015-65175037 CCTTCAGTGTAGGTGCATGAGGG + Intergenic
1193241196 X:79171610-79171632 CCTATATTGTACCTGGAAGACGG + Exonic
1194680133 X:96842169-96842191 CCTTTAGTGTAGCTTGGGGAAGG - Intronic
1196069537 X:111505059-111505081 CCTACAGTGGAGCCTGAGGTTGG - Intergenic
1196265882 X:113646091-113646113 CCTACTGTGGAGGTGGAGGAGGG + Intergenic