ID: 950367652

View in Genome Browser
Species Human (GRCh38)
Location 3:12499367-12499389
Sequence GACCTAGTCCCTGTTCTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 4, 3: 17, 4: 157}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950367651_950367652 -7 Left 950367651 3:12499351-12499373 CCAAGAGCGAGGAAAAGACCTAG 0: 1
1: 0
2: 0
3: 10
4: 133
Right 950367652 3:12499367-12499389 GACCTAGTCCCTGTTCTTGAAGG 0: 1
1: 0
2: 4
3: 17
4: 157
950367650_950367652 -6 Left 950367650 3:12499350-12499372 CCCAAGAGCGAGGAAAAGACCTA 0: 1
1: 0
2: 0
3: 6
4: 90
Right 950367652 3:12499367-12499389 GACCTAGTCCCTGTTCTTGAAGG 0: 1
1: 0
2: 4
3: 17
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950367652 Original CRISPR GACCTAGTCCCTGTTCTTGA AGG Intronic
900242889 1:1625331-1625353 GACCTTGTCCCCGTGCTGGAAGG - Exonic
901742531 1:11351723-11351745 GACCTAGTCTTTTTTCTTGATGG + Intergenic
902719929 1:18297134-18297156 GACCTAGTCCCTGTCCTCATGGG - Intronic
902736410 1:18404203-18404225 CACCTAGGCACTGTTCTAGATGG + Intergenic
907796853 1:57726351-57726373 TTCCTAGTCCCTATTCCTGATGG - Intronic
909077621 1:71070830-71070852 GACCTAGACCTTGAACTTGAGGG + Exonic
909693757 1:78440746-78440768 GAACTTTTCCCTGTTCTTCAAGG + Intronic
910674882 1:89806680-89806702 GACACAGTCCCTGAACTTGAGGG + Intronic
912884649 1:113457596-113457618 GTGCTAGTTCCTGTTCTTGGTGG + Intronic
914327365 1:146632683-146632705 GACCTAGTGTCTTTTCTTCAGGG - Intergenic
917124561 1:171675288-171675310 GCCCAAATCCCAGTTCTTGATGG - Intergenic
918220205 1:182429871-182429893 GACCCAGTCCCTGCCCTGGAGGG + Intergenic
919481472 1:198095506-198095528 GACATAGTCCTTGCTCTTGAAGG + Intergenic
919751526 1:201040914-201040936 GCCCTGGTCGCTGTTCTTGAAGG + Intronic
920312625 1:205057539-205057561 GACACAGTCCCTCTTCTTCAAGG - Intronic
1064226145 10:13487062-13487084 GAAATAGTCCCTGCCCTTGAAGG - Intronic
1067807700 10:49404577-49404599 GACCTACTCCCTGTTGCTGGAGG - Intergenic
1068501654 10:57846424-57846446 GAGATATTCCCTGTTGTTGATGG - Intergenic
1070360686 10:75685612-75685634 GACATAGCCCCTGATTTTGAGGG + Intronic
1070820295 10:79350381-79350403 CACCCAATCCCTGATCTTGAAGG - Intronic
1073372962 10:103007189-103007211 GACCTACTCCCTGTTCGTACAGG - Intronic
1073569962 10:104572490-104572512 GCCCTAGTCCCTGGTTCTGAGGG - Intergenic
1075623118 10:123942261-123942283 TACCCAGTCCCTGTTCAAGATGG - Intergenic
1077608024 11:3625430-3625452 GACATAGTCCCTGCCCTTGAGGG + Intergenic
1078047139 11:7925514-7925536 GAAATAGTCTCTGCTCTTGAAGG - Intergenic
1080005004 11:27397394-27397416 GACCTAGTCCCTGCTCATGAGGG - Intronic
1080008864 11:27437542-27437564 GATCTAGTCCCTGTTCTTGCAGG - Intronic
1081446044 11:43132424-43132446 GACCAAGTCCCTGTTCTCCTTGG - Intergenic
1082075733 11:47974754-47974776 CTCCTATTCCCTGTTCTTGGGGG + Intergenic
1083288597 11:61677081-61677103 GACCTAAGCCTTCTTCTTGAGGG - Intergenic
1085603033 11:77872462-77872484 GACAAGGTCCCTGTCCTTGAGGG + Intronic
1086784755 11:90954326-90954348 GACCCAGTACCTGTTCAAGATGG - Intergenic
1092169164 12:6362579-6362601 GTCCTAGTCCCAGCTCTTGCTGG - Intronic
1093139358 12:15489726-15489748 TACCCAGTCCCTATTCATGATGG + Intronic
1093554119 12:20450292-20450314 GACCTAGTCCCTGTCATCCAGGG + Intronic
1096326612 12:50668236-50668258 GACATAGTCCCTATTCTTATGGG - Intronic
1097141492 12:56905994-56906016 TTCCTAGTCCTGGTTCTTGAAGG + Intergenic
1100407430 12:94283783-94283805 GGCCCAGACCCTGCTCTTGATGG - Intronic
1100880042 12:99006346-99006368 GACACAGTCCCTGCTTTTGAGGG + Intronic
1101722913 12:107366054-107366076 GCCATAGTCACTGTTCTAGAAGG + Intronic
1102182660 12:110923991-110924013 GGCCTTGTCCCTGGTCTTGGGGG - Intergenic
1102565324 12:113793742-113793764 GACACAGTCCCTGGTCTTGGAGG - Intergenic
1102816218 12:115868533-115868555 GACCCAGTCCCTGGTCCTGGAGG + Intergenic
1103480653 12:121247998-121248020 GACCAAGTCCCTGTCCAGGAGGG - Intronic
1103855820 12:123970646-123970668 CACCTAGTCACTGCCCTTGAAGG + Intronic
1106085125 13:26534997-26535019 AACCCAGTCCCTGCCCTTGAAGG + Intergenic
1107468901 13:40673788-40673810 ATGCTAGTCCCTTTTCTTGATGG - Intergenic
1107831530 13:44377907-44377929 GACATAGTCCCTGCCCTTGTGGG + Intronic
1113961690 13:114129929-114129951 GCCTGAGTCCCTGGTCTTGAAGG - Intronic
1114893628 14:26958219-26958241 GCCATAGTCCCAGTGCTTGAAGG + Intergenic
1116423158 14:44757184-44757206 GAAATAGTCCCTGTCCTTCAGGG + Intergenic
1117230671 14:53714778-53714800 GACCTACTCCCTTTTTTTGATGG - Intergenic
1117779304 14:59216022-59216044 GACCCAGTCACTCTTCTTGTGGG + Intronic
1126926200 15:53589515-53589537 GACCTGATCCCTGTCCTTGAAGG + Intronic
1128912209 15:71525897-71525919 GACCCATTCCCTGTCCTTGAGGG - Intronic
1130388907 15:83437518-83437540 GGCCTTGTCCCTGATCTTGTGGG - Intergenic
1130397531 15:83516254-83516276 GTCCTAGTTCTTGTCCTTGATGG - Intronic
1132072269 15:98788714-98788736 GTCCTAATCCCTGTTCTGGCCGG + Intronic
1132113637 15:99120249-99120271 GACCTAGTCCCTGTCCTCAGTGG + Intronic
1132914894 16:2338720-2338742 GACACAGTCCCTGCTCTTGGAGG - Intronic
1132939645 16:2500444-2500466 GACCGAGTCCATGTTCATGGCGG + Exonic
1133401080 16:5487536-5487558 GTCTTGGTCTCTGTTCTTGAAGG + Intergenic
1135557564 16:23449783-23449805 CAAATAGTCCCTGTTCCTGAGGG + Intronic
1137241573 16:46659182-46659204 GCCCCAGTTCCTCTTCTTGAGGG - Exonic
1137960260 16:52875819-52875841 GACCTCGTCTGTGGTCTTGAGGG + Intergenic
1139347884 16:66316219-66316241 GACCTAGAAACTGTTTTTGAGGG + Intergenic
1140006194 16:71078257-71078279 GACCTAGTGTCTTTTCTTCAGGG + Intronic
1140558383 16:75947733-75947755 GACTTAGTCCCTGTTCCTCCAGG - Intergenic
1140691563 16:77489508-77489530 AACCTAGTCCCTAATATTGATGG + Intergenic
1141277936 16:82604974-82604996 TACCTAGTCCCTATTCAAGATGG - Intergenic
1143728588 17:8866874-8866896 GGCCTGGTCTCTGTCCTTGAAGG - Intronic
1144467917 17:15511367-15511389 GACAGAGTCCCTGATCTTAAAGG + Intronic
1150350042 17:64437287-64437309 TACCTAGCCCCTGTTCAAGATGG - Intergenic
1151134907 17:71937186-71937208 TACCCAGTCCCTGTTCAAGATGG + Intergenic
1160431009 18:78812528-78812550 GATCCAGTCCCTGTTCTCAAGGG - Intergenic
1166833697 19:45653873-45653895 GACCTAGTCCTTGCCCTTGAGGG + Intergenic
1202678452 1_KI270711v1_random:28730-28752 CCCCTACTCCCTGCTCTTGATGG + Intergenic
925759086 2:7166839-7166861 GACCTAGTCCCTGGAATTCATGG + Intergenic
929450603 2:42034535-42034557 AACCCAGTCCCTATTCTAGATGG + Intergenic
930159146 2:48135805-48135827 GGCTTAGTCCCTCTTTTTGATGG - Intergenic
930660018 2:54044051-54044073 GATCTCGTCTCTGTCCTTGATGG - Intronic
932512574 2:72309180-72309202 CACCTAGTCACTTTTCTAGAAGG + Intronic
936781943 2:116043910-116043932 GAAATAGTCCCTGTTTTTTAGGG + Intergenic
939147760 2:138436813-138436835 GACTTGGTCCCTGATCTTGCAGG - Intergenic
941304788 2:163850287-163850309 TACCTAGCCCCTGTTCAAGATGG + Intergenic
941916518 2:170817187-170817209 GCCCTAGTCCCTGCTCTCCACGG + Intronic
945019947 2:205560256-205560278 GACACAGTCCCTGTCCTTAAAGG - Intronic
945148784 2:206765924-206765946 GCCCAGGTCCCTATTCTTGATGG + Intronic
946363219 2:219232028-219232050 GACCTATTACCTGTTCTTGGTGG - Exonic
946518833 2:220443889-220443911 GCCATCATCCCTGTTCTTGAAGG + Intergenic
947909775 2:233793438-233793460 GACCCCGTCTCTGTCCTTGAAGG + Intronic
948389567 2:237602193-237602215 GACGCAGGTCCTGTTCTTGAAGG - Intergenic
1170419795 20:16181285-16181307 TTCCTCTTCCCTGTTCTTGAAGG + Intergenic
1171086744 20:22244781-22244803 GTCATAGTCCATGTGCTTGAAGG - Intergenic
1173391395 20:42637683-42637705 AACCAAGTCCCTGTTCTTAGAGG - Intronic
1173578381 20:44128411-44128433 GACATGGCCCCTGCTCTTGAAGG + Intronic
1176693588 21:9947731-9947753 GTCCTAGGCCCTGCTCTTGAAGG - Intergenic
1177948251 21:27500537-27500559 GACCTAGTGACTGTCCTGGATGG + Intergenic
1178250560 21:30999794-30999816 GTCCTGTTCCCAGTTCTTGACGG + Intergenic
1179618650 21:42598248-42598270 GCCCCAGTCCATGTTCTTGGTGG - Intergenic
1181621920 22:24096937-24096959 CACCCAGGCCCTGTGCTTGAGGG + Intronic
1183562393 22:38585693-38585715 GACACAGTCCCTGTTCTCAAGGG - Intronic
1183581389 22:38728597-38728619 GACCTTGCCCCTGGTCTTGGAGG + Intronic
1183609744 22:38891661-38891683 GACACAGTCCCTGTTCATGGGGG + Intergenic
1183739519 22:39662236-39662258 CACCGAGTCCCTGTTGTCGAGGG - Exonic
1183910941 22:41078619-41078641 GACTCAGTCCATGTCCTTGAGGG - Intergenic
1185414265 22:50701150-50701172 GACATAGTCCCTGTGCGTGCAGG + Intergenic
949195701 3:1304153-1304175 TACCTACTCCCTGATCTGGATGG + Intronic
950367652 3:12499367-12499389 GACCTAGTCCCTGTTCTTGAAGG + Intronic
957893078 3:86384701-86384723 TACCTAGTCCCTATTCAAGATGG + Intergenic
959680970 3:109096246-109096268 GACCCAGCCCCTGTTCAAGATGG - Intronic
961068731 3:123900045-123900067 GACCTAGTCCTTGTCCTCAAAGG - Intronic
963294711 3:143533192-143533214 GACCAAGTCCCTGCTCTCGTGGG + Intronic
964069502 3:152614562-152614584 GACCTAGTCACAGTTGTTGTTGG + Intergenic
964409216 3:156380815-156380837 GATCTGGTCCCTGATTTTGAGGG + Intronic
965585597 3:170315119-170315141 GACATGGCCCCTGTCCTTGAGGG - Intergenic
965613915 3:170573696-170573718 GAACAAGACCCTGTTTTTGAAGG + Intronic
970158725 4:13167877-13167899 GATGTAGTCTCTATTCTTGAGGG - Intergenic
970201729 4:13616165-13616187 GACCTGGTCCCTGTTCTGGATGG + Intronic
972285191 4:37641614-37641636 AACATATTCCCTTTTCTTGAGGG - Intronic
980028670 4:127798405-127798427 GACATAGTCACTGTTTTTAATGG + Intronic
980366208 4:131807969-131807991 GTCCTAGGCCCTGCTCTTGAAGG - Intergenic
985656084 5:1131945-1131967 GACCCAGCCCCTGTTCAAGATGG - Intergenic
986550929 5:8954396-8954418 TACCTAGTGCCTGTTCTTATTGG - Intergenic
990704281 5:58510468-58510490 GGGCAAGTCTCTGTTCTTGAGGG + Intergenic
990976696 5:61567058-61567080 GACCCAGTCCCTGCCCTTGGGGG - Intergenic
991557287 5:67909867-67909889 GACCAAGTTCCTGTGCTGGATGG - Intergenic
993692702 5:91022506-91022528 TACCTACTCCCTGTGCTTTAAGG + Intronic
995310185 5:110701840-110701862 AACCTATTCCCTGTACTTGCTGG + Intronic
995713099 5:115054500-115054522 GACATGTTCCCTGTCCTTGAAGG - Intergenic
998597146 5:143543877-143543899 AACCTATTTCCTGTCCTTGAAGG - Intergenic
1001320071 5:170673546-170673568 GACCTAGTATCTGTTCTAGCTGG + Intronic
1007109720 6:39306023-39306045 GACCCAGTCCCTGCTCTTGAGGG - Intronic
1008790098 6:55220631-55220653 TACCTAGTTCCTGATCTTGGAGG - Intronic
1013593683 6:111642568-111642590 GACATATTCCCTGTACTTGAAGG - Intergenic
1015320386 6:131866382-131866404 GTCATGGTCCCTGTTTTTGAGGG + Intronic
1016553376 6:145308065-145308087 GGCCTAGTCCTTATTCTTGAGGG - Intergenic
1016907333 6:149164606-149164628 GACTTAGTTCCTGTCCTTGGGGG - Intergenic
1018310124 6:162499997-162500019 GACCAAGTCCTTGTTCTAGATGG - Intronic
1019484709 7:1284234-1284256 GACCTAGTCTCTGCACCTGAAGG + Intergenic
1022423614 7:30246752-30246774 GAAATGGTCCCTGTTCTCGAGGG + Intergenic
1022764769 7:33399435-33399457 GTCCTAGTCCCAGTTCTTTCTGG + Intronic
1024484918 7:49907045-49907067 GACCCAGTACTTGTTCTTTATGG - Intronic
1025015719 7:55437569-55437591 GGCCTAGTCCTGGTTCTTAATGG + Intronic
1027442644 7:78236497-78236519 GATACAGTCCTTGTTCTTGAGGG + Intronic
1027486890 7:78772641-78772663 GAACTATTCACTGTTCTTGCTGG + Intronic
1027540863 7:79463365-79463387 GGCCTAGTTCATGTTCTTTAAGG + Intergenic
1033243279 7:139698753-139698775 AACATATTCCCTGTACTTGATGG - Intronic
1035820712 8:2588845-2588867 GCCCCTGTCTCTGTTCTTGAGGG + Intergenic
1036202860 8:6783949-6783971 GACACAGCCCCTGCTCTTGAGGG + Intergenic
1036397815 8:8383913-8383935 GACCTACTGCCTATTCCTGAAGG - Intronic
1037345828 8:17900320-17900342 GACCTAGCCTTTGTTTTTGAGGG - Intronic
1042814834 8:72866991-72867013 GACATAGTCCCTGTCCTCAAGGG - Intronic
1046695887 8:117338799-117338821 GACCTTGTCCCTCAGCTTGAAGG + Intergenic
1048439743 8:134451070-134451092 GACATAGGCCCTGTCCTGGAGGG - Intergenic
1049025357 8:139984563-139984585 GACCTGGTCCCTGTCCTTCCAGG - Intronic
1049514301 8:143045305-143045327 GACCTTGTCCCTGGTCCTGCTGG - Intronic
1053160627 9:35811146-35811168 GGCCTGCTCCCTTTTCTTGAAGG - Intronic
1053560515 9:39189055-39189077 TACCAATTCCATGTTCTTGATGG - Intronic
1053630552 9:39933816-39933838 GTCCTAGACCCTGCTCTTGAAGG - Intergenic
1053775218 9:41529693-41529715 GTCCTAGACCCTGCTCTTGAAGG + Intergenic
1053824615 9:42009296-42009318 TACCAATTCCATGTTCTTGATGG - Intronic
1054136604 9:61429900-61429922 TACCAATTCCATGTTCTTGATGG + Intergenic
1054213335 9:62316885-62316907 GTCCTAGACCCTGCTCTTGAAGG + Intergenic
1054605956 9:67178067-67178089 TACCAATTCCATGTTCTTGATGG + Intergenic
1061424378 9:130489942-130489964 GACCTACTCCATGAACTTGAGGG + Intronic
1061645705 9:131999341-131999363 GACCTAGTCTCTGACATTGATGG - Intronic
1061865296 9:133489016-133489038 GCCCTCGTCCCTGGTCCTGATGG - Intergenic
1062005924 9:134238415-134238437 GCCACAGTCCCTGTTCTGGAAGG + Intergenic
1062417226 9:136457761-136457783 GTCCTAGTCCCTGTTCCCCAAGG + Intronic
1186311628 X:8326150-8326172 AACTGAGACCCTGTTCTTGAGGG + Intergenic
1187243293 X:17532381-17532403 GATATAGTCCCTGCCCTTGAAGG + Intronic
1192639622 X:72849430-72849452 GACTCAGACCCTGTTTTTGAAGG + Intergenic
1192642089 X:72871375-72871397 GACTCAGACCCTGTTTTTGAAGG - Intergenic
1192794658 X:74416952-74416974 GACCTGGTGCCTGTTTCTGAGGG - Intergenic
1197043245 X:121965436-121965458 CACCTATTCTCTGTTCATGAAGG - Intergenic
1197637690 X:128933682-128933704 GACCCAGTCCCTGCATTTGAGGG - Intergenic
1199485188 X:148338995-148339017 GCCCAAGGCCCTGTTCTTCAGGG - Intergenic
1201271051 Y:12254007-12254029 AAGCTGGTCCGTGTTCTTGACGG - Intergenic