ID: 950369977

View in Genome Browser
Species Human (GRCh38)
Location 3:12520929-12520951
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 8272
Summary {0: 2, 1: 22, 2: 374, 3: 1806, 4: 6068}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950369977 Original CRISPR GAGGGTGAAGAGAGGGAGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr