ID: 950371404

View in Genome Browser
Species Human (GRCh38)
Location 3:12533941-12533963
Sequence AGCAGCCTTGTGAATTCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 146}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950371400_950371404 -4 Left 950371400 3:12533922-12533944 CCTGTGTATTTATCCCTGCAGCA 0: 1
1: 0
2: 1
3: 11
4: 140
Right 950371404 3:12533941-12533963 AGCAGCCTTGTGAATTCAGGAGG 0: 1
1: 0
2: 2
3: 13
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950371404 Original CRISPR AGCAGCCTTGTGAATTCAGG AGG Intronic
900989523 1:6091925-6091947 GGCAGCCTTCTGAAACCAGGGGG + Intronic
902156986 1:14495687-14495709 AGTAGCCTCGGGAAATCAGGAGG + Intergenic
904031419 1:27535860-27535882 AGCAGAGCTGTGAATCCAGGGGG - Intronic
904302572 1:29564231-29564253 AGAGGCTTTCTGAATTCAGGGGG - Intergenic
904314048 1:29648872-29648894 AGCAAAATTGTGAATTCAGCAGG + Intergenic
907110321 1:51921071-51921093 AGCAGCCTTTTGGAATCAGGAGG - Intronic
910090101 1:83451927-83451949 AAAACACTTGTGAATTCAGGGGG - Intergenic
913295814 1:117318997-117319019 AGCAGCCTTGTTAATTTACCTGG - Intergenic
915743347 1:158137045-158137067 AGAACCCTTGTGAATTCATTGGG - Intergenic
917721337 1:177789199-177789221 AGAAGCTTTGTGAATACAGGTGG - Intergenic
920920691 1:210295033-210295055 CCCAGCCTTGTGACTTCAGATGG - Intergenic
921282911 1:213585133-213585155 AACAGCCTTGAAAATTAAGGAGG - Intergenic
921587397 1:216964348-216964370 AGCAGACCTGTGACTTAAGGAGG - Intronic
923330642 1:232920837-232920859 AGCTGCCTTGGGAATGGAGGAGG - Intergenic
924802655 1:247338739-247338761 AGCATCCTTGGAATTTCAGGAGG + Intergenic
1063125426 10:3132791-3132813 AGCAACCTCGTGTATACAGGGGG - Intronic
1067482945 10:46617149-46617171 ACCAGCCTTGTGGAGTCAGAGGG + Intergenic
1067531909 10:47080414-47080436 AGCACTATTGTGCATTCAGGAGG - Intergenic
1071083554 10:81841327-81841349 AGCAGCCGTTTGAACTCAGCGGG + Intergenic
1071513233 10:86280521-86280543 AGAACCCTTGTGAAAGCAGGAGG + Intronic
1071987505 10:91067286-91067308 GGAAGCCTTGTGAATTCCTGAGG + Intergenic
1074285635 10:112095260-112095282 ACCCGCCTTGGGAAGTCAGGGGG - Intergenic
1076433463 10:130423746-130423768 AGGAGTCGTGTGAATGCAGGAGG - Intergenic
1076513913 10:131032605-131032627 GGCGGCCCTGTGAATTCAGTGGG - Intergenic
1078387647 11:10907021-10907043 AGTAGTCTTATGAATTCAGTAGG + Intergenic
1079604445 11:22347027-22347049 AGCAGCGTTGAGAAATCAAGAGG - Intronic
1081252650 11:40854313-40854335 AGCAGCCTTGCCATTCCAGGAGG - Intronic
1082775616 11:57242357-57242379 AGCAGACCTGTGAAGTGAGGGGG - Intergenic
1083756846 11:64796535-64796557 AGCAGCGATGTGAAATCAGCTGG + Exonic
1084111322 11:67015808-67015830 AGAAGCCATGTGAGTGCAGGAGG + Intronic
1085134581 11:74074535-74074557 AGCTGCCTTGCGAGTTCATGTGG - Exonic
1088642084 11:111882407-111882429 GGCAGCCTTGTTAATGCAGATGG + Exonic
1088975883 11:114816144-114816166 TACAGCCTTGGGGATTCAGGAGG - Intergenic
1089306230 11:117528020-117528042 AACGGCCTTGTGAAGTCTGGAGG - Intronic
1089531512 11:119132843-119132865 AGCTGCCATGAGAAATCAGGAGG - Exonic
1090998747 11:131890421-131890443 AGCAGCCTGCTGAGTGCAGGGGG + Intronic
1091097638 11:132839233-132839255 AACGGCCTTGGGAAATCAGGTGG + Intronic
1091478495 12:801330-801352 AGCAGCGTTGAAAATTGAGGAGG + Intronic
1092568295 12:9693247-9693269 ATCAACCCTGTGAAATCAGGAGG - Intronic
1094428271 12:30338558-30338580 AGCAGACATGTGAGTCCAGGTGG + Intergenic
1095048133 12:37532977-37532999 AGCAGCCTGGGGAACACAGGCGG - Intergenic
1095685362 12:45027145-45027167 AGCAGCCTTATAAAATCAGCTGG - Intronic
1097721567 12:63027177-63027199 ACCAGTCATGTGACTTCAGGTGG + Intergenic
1101335774 12:103795422-103795444 AGCAGCCTTGTGCATTCATAAGG - Intronic
1102612559 12:114125268-114125290 ACCACCCTTGAGTATTCAGGTGG - Intergenic
1103495678 12:121360422-121360444 AGCAGCCTAGTGATTTCCGGAGG - Intronic
1107030579 13:35848920-35848942 AGCAGCCTTTTGATCTCAGCAGG + Intronic
1113328888 13:109310347-109310369 AGCAGCCTTGTGTTGTGAGGAGG - Intergenic
1118600747 14:67470155-67470177 AGCAGCCCTCTTAGTTCAGGAGG + Intronic
1119540481 14:75435028-75435050 AGCAGCGCTGTGATTCCAGGTGG - Intronic
1125132246 15:36296857-36296879 AGCATCCTGGAGATTTCAGGTGG - Intergenic
1126471921 15:49021623-49021645 AGCAAGCGTGAGAATTCAGGTGG - Intronic
1127594436 15:60464818-60464840 ACCAGCCTGGTGAACACAGGAGG + Intronic
1128870716 15:71153297-71153319 AGCCTCCTTGTGCATACAGGTGG + Intronic
1131544265 15:93302630-93302652 GGCAGCCTTGTGACTATAGGAGG + Intergenic
1132973420 16:2700078-2700100 AGGAGCCTTGGGAGTTCGGGTGG + Intronic
1135128498 16:19831789-19831811 AGCAACCTTGGGCAGTCAGGAGG + Intronic
1135244656 16:20845173-20845195 GGGAGCCTTGTTGATTCAGGTGG - Exonic
1137618481 16:49860058-49860080 AGCAGTCTGGTGAATGCACGAGG + Intergenic
1138353340 16:56358364-56358386 AGCAGTCTTTTGAATCAAGGGGG + Intergenic
1139092951 16:63671399-63671421 AGCATCCTTGTGGTTTCAAGAGG - Intergenic
1139391483 16:66608633-66608655 AGCAGCCCTGTGACCTCAAGTGG + Intronic
1140652952 16:77108410-77108432 ATCAGGCCTGTGACTTCAGGTGG + Intergenic
1140926244 16:79587005-79587027 AGCAGCCTAGAGAATTCAGCAGG - Intronic
1140930835 16:79626364-79626386 AGGTGCCTTGTGAGTTAAGGAGG - Intergenic
1140986979 16:80167438-80167460 AGCCGCCATGTGAATTTAAGTGG - Intergenic
1141620521 16:85234778-85234800 GGCAGCCTTGGGAATGCTGGCGG + Intergenic
1144046097 17:11456117-11456139 AGCATCCTTGTGCATGCAGGAGG + Intronic
1144059518 17:11570164-11570186 GGCAGCCTGGTGAACACAGGAGG + Intergenic
1148246232 17:46032532-46032554 AAGTGCCTAGTGAATTCAGGAGG + Intronic
1150806027 17:68319765-68319787 ACCAGCCTTTAGAATGCAGGAGG + Intronic
1156684244 18:39625455-39625477 AGAAGCCTTGTGATTTCAATTGG + Intergenic
1157709814 18:49842689-49842711 AAGAGCCTTGTGCCTTCAGGTGG + Intronic
1158056040 18:53281809-53281831 GCCAGCCTGGTGAATTCTGGTGG - Intronic
1160151153 18:76395249-76395271 TGCAGCCTTGTGAATTGCGGGGG - Intronic
1160194260 18:76739404-76739426 AGCAGCGTTAAGAATGCAGGAGG - Intergenic
1160480782 18:79237884-79237906 ACCAGCCTAGGGAATACAGGAGG - Intronic
1166114116 19:40642281-40642303 AGTAGCCTTGGGAGTACAGGTGG - Intergenic
1166246424 19:41530348-41530370 AGCAGCCTTGTGGATACGGGTGG - Intergenic
926063328 2:9818554-9818576 AGCAACCTAGTGAATTAAGAAGG + Intergenic
926202941 2:10814276-10814298 AGCAGCCCTCTGAAGTCACGGGG + Intronic
928240809 2:29584098-29584120 AGCAGCCTGGGTATTTCAGGGGG - Intronic
929697007 2:44126276-44126298 AACAGCCTTGTGAAATCAATAGG + Intergenic
930327121 2:49933925-49933947 AGAGGCCTTGTGAATTCAGGTGG + Intronic
932912123 2:75817449-75817471 AGCAGTCTTATGAATTCATAAGG - Intergenic
933971403 2:87472864-87472886 AGCAGCCGAGAGATTTCAGGAGG + Intergenic
936322327 2:111477335-111477357 AGCAGCCGAGAGATTTCAGGAGG - Intergenic
937084905 2:119165084-119165106 AGCAGCCATCTGTATTTAGGTGG + Intergenic
937887590 2:126910552-126910574 AGCAGCTTTGTGCATTTTGGAGG - Intergenic
940722008 2:157292606-157292628 AGCAGCCTTATGAAGTCAAAGGG - Intronic
940991674 2:160103503-160103525 AGCAGCCTGGTTAATTCTGAGGG + Intronic
941577921 2:167258236-167258258 AGCAGGGTTGTCATTTCAGGTGG - Exonic
944321447 2:198348481-198348503 AGAAGCCTTGTGAATTATGATGG + Intronic
948245985 2:236486290-236486312 TGCAGCCTTGTGAGATCTGGAGG + Intronic
1170929587 20:20756746-20756768 AGCATTCTTGATAATTCAGGAGG - Intergenic
1171542675 20:25976447-25976469 AGCAGCCTGGGGAACACAGGCGG - Intergenic
1171798383 20:29584074-29584096 AGCAGCCTGGGGAACACAGGTGG + Intergenic
1171977326 20:31604020-31604042 TGCAGCTGAGTGAATTCAGGCGG - Intergenic
1174704251 20:52639649-52639671 AGCAGCCATTTGTATTCATGGGG + Intergenic
1175212372 20:57368766-57368788 ATCAACCTTCTGAATTCAGGAGG + Exonic
1177771008 21:25515826-25515848 AGAAGTCTGGTGAATTCAGCTGG + Intergenic
1179069447 21:38058101-38058123 AGAACCCTGGTGAATACAGGTGG + Intronic
1182021280 22:27083644-27083666 AGCAGCCTGGTGGATAGAGGGGG + Intergenic
1183580649 22:38724319-38724341 GGCAGCCTGGTGACTTCAGCAGG - Exonic
950371404 3:12533941-12533963 AGCAGCCTTGTGAATTCAGGAGG + Intronic
951587453 3:24229978-24230000 ACCAGCCTTGTGAAATAAGTGGG - Intronic
952042489 3:29277667-29277689 AGTAGCCATGGCAATTCAGGAGG - Intergenic
952357846 3:32601206-32601228 AGCAGCTTTGGGAATTTGGGAGG - Intergenic
959162047 3:102735758-102735780 AACAGCCTTGTTTATTCAGTGGG + Intergenic
961169175 3:124784205-124784227 ATCAGCATTGAGAAATCAGGTGG - Intronic
964422882 3:156522732-156522754 AGCAGCCTATTGAAATCATGTGG + Intronic
964664588 3:159158387-159158409 AGAAGTTTTGTGAGTTCAGGTGG + Intronic
965364248 3:167778575-167778597 TTCAGACTTTTGAATTCAGGTGG - Intronic
966719698 3:183049920-183049942 ACCAGCCTTGGCAATACAGGGGG + Intronic
967789693 3:193533912-193533934 AGGAGCCTTGTTAATGCTGGTGG - Intronic
967811729 3:193766362-193766384 AGCAGCCTTCTGAGTTCTGGAGG - Intergenic
974401447 4:61413088-61413110 AGCTGCCTTGTTACTGCAGGTGG + Intronic
982567297 4:157001521-157001543 AGCAGACTTATGAATTAAGTTGG - Intergenic
985429422 4:189864688-189864710 AGGAACCTTGAGAATTCAGAAGG - Intergenic
985998156 5:3608976-3608998 AGCATCCATGTAGATTCAGGAGG + Intergenic
986029746 5:3882985-3883007 TGCAGCCTTGTGGATGCACGGGG + Intergenic
986242472 5:5973305-5973327 AGCAGCATAGTGGATGCAGGAGG + Intergenic
986454277 5:7899838-7899860 ATTAGACTTGTGAATTAAGGAGG + Intronic
987288368 5:16483582-16483604 AAAAGCCCTGTGAATTCAGAAGG + Intronic
987836093 5:23164075-23164097 AACAACCTTGAGATTTCAGGAGG - Intergenic
990316194 5:54585426-54585448 AGCAGCCTTTTGAATTGGGTGGG + Intergenic
994073439 5:95626102-95626124 AGTAGCTGTGTGACTTCAGGCGG + Intergenic
994220382 5:97188322-97188344 ATGAGCTTTGTGGATTCAGGTGG - Intergenic
995116534 5:108486888-108486910 AGCAGCCTTGAGTATTCAGTGGG - Intergenic
997532156 5:134588248-134588270 GGCAGCCTTTTGAGTTCAGATGG + Intergenic
1007348849 6:41253307-41253329 AGCTTCCTTGTCAATTCAGTAGG + Intergenic
1010466386 6:76171624-76171646 TGCAGCCTTGTGAATGGAGCTGG + Intergenic
1013471339 6:110468975-110468997 AGCAGGCTTGTCCATTCAGAAGG + Intronic
1014263212 6:119244688-119244710 AGCAGCATTTTGAATTGGGGAGG - Intronic
1018061778 6:160095298-160095320 AGCAGAGGTGTGAATGCAGGAGG - Intronic
1018180128 6:161216113-161216135 AGAAGCCTTGTCAAGGCAGGAGG - Intronic
1018467036 6:164057559-164057581 AGGTGCCTGGTAAATTCAGGGGG - Intergenic
1022412638 7:30150928-30150950 AGCTGTCTTGTGGATTCATGGGG + Intronic
1024191973 7:47021430-47021452 AGGAGACTTGTGAATCAAGGAGG + Intergenic
1024693180 7:51825270-51825292 AGTAGCAGTGTGAATTGAGGAGG - Intergenic
1025294049 7:57761546-57761568 AGCAGCCTGGGGAACACAGGCGG - Intergenic
1027937125 7:84621225-84621247 AGCAACCTTGTGAAATCACATGG + Intergenic
1037497876 8:19458064-19458086 AGCAGCCTTGAGTCTTGAGGAGG - Intronic
1045632058 8:104135920-104135942 AGCAGCCTTGTGGATACTGTTGG + Intronic
1047163539 8:122409605-122409627 AGAGGCCTGGTGAAATCAGGTGG + Intergenic
1047585831 8:126271391-126271413 AGTAGCCTTTTGAAGTCAGTTGG - Intergenic
1049958577 9:715921-715943 AGAAGCTTTGAGAATCCAGGTGG + Intronic
1052011782 9:23419311-23419333 AGCAGGCTGGTGAGTTCACGAGG + Intergenic
1053348522 9:37395733-37395755 ATCTCTCTTGTGAATTCAGGTGG + Intergenic
1054162368 9:61682747-61682769 AGCAGCCTGGGGAACACAGGTGG + Intergenic
1058743209 9:107965145-107965167 AGCAGCCTTGCGAAGTGAGTAGG - Intergenic
1059075985 9:111194535-111194557 AGGAGCCTTGTGAATACATTGGG + Intergenic
1189215993 X:39324451-39324473 AGCAGCTTTATGGATGCAGGTGG + Intergenic
1190655907 X:52612008-52612030 AGCAGCCTTGAGTCTTTAGGAGG + Intergenic
1191056519 X:56246858-56246880 AGCAGGTTTGTGAACTCATGGGG + Intronic
1191737166 X:64399006-64399028 AGCAGGCTTGAGGATTCAGGTGG - Intergenic
1195681949 X:107553789-107553811 AGCAACCCTTTGAATTCAGTTGG + Intronic
1196242132 X:113353897-113353919 AGCAGCCTTATGCATTCCAGAGG + Intergenic
1197119643 X:122875258-122875280 AGCTTCCTTGTGAATTCAGGTGG - Intergenic
1199412526 X:147541167-147541189 AGCTGCTGTGTGAATTCAGGAGG + Intergenic
1200034614 X:153319425-153319447 AGCAGCCTCAGGAAGTCAGGTGG + Intergenic
1202148710 Y:21825624-21825646 AGCATCTTTGGGAATACAGGAGG - Intergenic