ID: 950375508

View in Genome Browser
Species Human (GRCh38)
Location 3:12568945-12568967
Sequence TAGTACTTGCAGATGGTGGA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 4, 3: 8, 4: 140}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950375508_950375516 14 Left 950375508 3:12568945-12568967 CCGTCCACCATCTGCAAGTACTA 0: 1
1: 0
2: 4
3: 8
4: 140
Right 950375516 3:12568982-12569004 GTGCCTATGGAACTCGGTGCAGG 0: 1
1: 0
2: 0
3: 4
4: 69
950375508_950375514 1 Left 950375508 3:12568945-12568967 CCGTCCACCATCTGCAAGTACTA 0: 1
1: 0
2: 4
3: 8
4: 140
Right 950375514 3:12568969-12568991 CAGAAGGGCTACTGTGCCTATGG 0: 1
1: 0
2: 1
3: 13
4: 167
950375508_950375518 19 Left 950375508 3:12568945-12568967 CCGTCCACCATCTGCAAGTACTA 0: 1
1: 0
2: 4
3: 8
4: 140
Right 950375518 3:12568987-12569009 TATGGAACTCGGTGCAGGCAAGG 0: 1
1: 0
2: 0
3: 7
4: 71
950375508_950375515 8 Left 950375508 3:12568945-12568967 CCGTCCACCATCTGCAAGTACTA 0: 1
1: 0
2: 4
3: 8
4: 140
Right 950375515 3:12568976-12568998 GCTACTGTGCCTATGGAACTCGG 0: 1
1: 0
2: 0
3: 17
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950375508 Original CRISPR TAGTACTTGCAGATGGTGGA CGG (reversed) Exonic
905787131 1:40767244-40767266 TATTACTTGCAGAAGATGGGGGG + Intronic
907371878 1:54009067-54009089 CAGTACTTGAAGAAGGTTGAAGG + Exonic
907851999 1:58264002-58264024 ATGTACTTGCAGATTTTGGAAGG + Intronic
907996535 1:59638388-59638410 TAGTCCTTGCACATGGGTGAAGG + Intronic
908209648 1:61887185-61887207 TAGTCTGTGGAGATGGTGGAGGG + Intronic
908785895 1:67734218-67734240 TAGTACAAGCAGATGGTGAGAGG + Intronic
917218785 1:172705381-172705403 TAGTACTTTAATATGGTTGACGG + Intergenic
919987899 1:202688720-202688742 AAGAACTTCCTGATGGTGGAAGG + Intronic
920560454 1:206934784-206934806 TGGTACTTGGAGATGCTGCAGGG + Intronic
923347723 1:233072309-233072331 TAATATTTGCATATGGTGTAAGG + Intronic
923458247 1:234185126-234185148 AAATACTTGCAGAAGGAGGAGGG + Intronic
924226873 1:241929112-241929134 CTGTACCTGCAAATGGTGGAGGG - Intergenic
924327661 1:242911875-242911897 TTGTATCTGCAGATGGAGGAAGG - Intergenic
1062970134 10:1641626-1641648 TAAGACGTGCAGATGGAGGAGGG - Intronic
1064480136 10:15732179-15732201 AAGTACTTGGAGATGGGGGTGGG - Intergenic
1064623235 10:17236081-17236103 TAGTACTTGCAGCAGGAAGAAGG - Intronic
1064668400 10:17682154-17682176 TAGTACTTGCATAAGGTGGAAGG - Intronic
1066320322 10:34296696-34296718 CAGTACATGCTGATGGTGGATGG + Intronic
1067669012 10:48302928-48302950 CAGTTCTTGCAGCTGGAGGATGG + Intergenic
1069555007 10:69392160-69392182 AAGAACGTGGAGATGGTGGAGGG + Exonic
1071683096 10:87727365-87727387 TTGTCCTGGCACATGGTGGACGG + Exonic
1073164692 10:101435362-101435384 CAGTAATTGCATATGGGGGATGG - Intronic
1074483975 10:113854990-113855012 CAGTATCTGCAGAAGGTGGACGG + Exonic
1075838808 10:125479549-125479571 TAGGACTTGTAGATGTGGGAGGG + Intergenic
1076028463 10:127137533-127137555 TATTACTTGCAGATCGGGGGTGG + Exonic
1079191559 11:18281899-18281921 TAGTGCTTGGAGAAGGTAGAAGG - Intronic
1079637164 11:22758037-22758059 TAGTACTTTCAGTTTGTGGTAGG + Intronic
1081588932 11:44407536-44407558 TAGGACTGGGAGATGGGGGAAGG - Intergenic
1084125585 11:67096865-67096887 TTGAACTTGCAGATGTGGGAAGG - Intergenic
1085146810 11:74207663-74207685 TAGTACTTGCTGATGGGAGAAGG - Intronic
1087574422 11:99972469-99972491 TAGTACTTTCAGCTGGGAGAGGG - Intronic
1087757953 11:102074202-102074224 TAGGACTTGGAGGTGGGGGAGGG + Intronic
1090838488 11:130470772-130470794 TAGTGCTTTCAGATGGGGGGAGG + Intronic
1090970696 11:131640236-131640258 CAGTACTTCCTGATGCTGGAAGG + Intronic
1090992181 11:131827864-131827886 TAGTACCTGATGATGGTAGAGGG - Intronic
1091043604 11:132305468-132305490 TATTAATTTCAGATGGTGTAGGG + Intronic
1091462675 12:656974-656996 TAATTCTTGTAGAGGGTGGAAGG - Intronic
1092284119 12:7119100-7119122 CAGTACCTGCAGCTGGTGGCTGG + Intergenic
1102597347 12:114002953-114002975 TTGTATTTGGAGATGGGGGAGGG - Intergenic
1106973608 13:35177405-35177427 TAGTACCTGCAAATGGAGCAAGG - Intronic
1111918062 13:94382468-94382490 TCGTCCTTGCAGATAGTGTAGGG - Exonic
1114939001 14:27582152-27582174 TACTACCTGCAGGTGGAGGATGG + Intergenic
1115008876 14:28520519-28520541 TAGTTTTTGCATATGGTGTAAGG + Intergenic
1117313045 14:54547634-54547656 TTCTACTTGGACATGGTGGAGGG - Intergenic
1117588894 14:57244333-57244355 TAGTTCTTGGAAATGTTGGAAGG + Exonic
1119677069 14:76563688-76563710 AAGTACTTGCATTTGGGGGAAGG + Intergenic
1121890732 14:97588115-97588137 TAGTAATGGCAGAAGGTGAAGGG + Intergenic
1202884432 14_KI270722v1_random:90942-90964 TAGTACTTGCAGGAGGTGGAAGG - Intergenic
1126136686 15:45399494-45399516 TTGTACCTGCACATGGTGGAAGG - Intronic
1127646354 15:60963280-60963302 TAGAATGTGCAGATGGTGCAGGG + Intronic
1128413768 15:67424614-67424636 GAGTTCTAGCAGATGCTGGATGG + Intronic
1128839311 15:70836854-70836876 TAGTACTTTCAGAGGGCGCATGG + Intronic
1129865869 15:78908141-78908163 TATTTCTTCCAGATGGAGGAAGG + Intergenic
1130177318 15:81587246-81587268 TAGTATTTTCAAATTGTGGAAGG - Intergenic
1131777836 15:95821935-95821957 TATCACTTGCATATTGTGGAAGG - Intergenic
1131887100 15:96927826-96927848 TACTGCTTGCAGATGCTTGATGG - Intergenic
1133883586 16:9805718-9805740 TTGTAATTGCAGATGCTGGTGGG + Intronic
1135016846 16:18930589-18930611 CAATACTTGCAGATGGTGCTGGG - Intergenic
1135322482 16:21506442-21506464 CAATACTTGCAGATGGTGCTGGG - Intergenic
1136333960 16:29599568-29599590 CAATACTTGCAGATGGTGCTGGG - Intergenic
1136750436 16:32630703-32630725 TAGTACGTGCAGGTGGGGGAGGG + Intergenic
1137315799 16:47321107-47321129 TAGATTTTCCAGATGGTGGAAGG - Intronic
1137527573 16:49249771-49249793 TCTTACTTGCAGATTCTGGAAGG - Intergenic
1138220238 16:55244075-55244097 TGGTATTTGCAGGTGGTGTAAGG + Intergenic
1139136422 16:64210211-64210233 TAATACTTGGAAAAGGTGGAGGG - Intergenic
1203052567 16_KI270728v1_random:889907-889929 TAGTACGTGCAGGTGGGGGAGGG + Intergenic
1151141210 17:71993654-71993676 GTGCACTTGCAGATGGTGGTGGG - Intergenic
1151246362 17:72798022-72798044 TAGTGAGTGCAGATGTTGGAAGG + Intronic
1153752820 18:8250990-8251012 TAGTACATGCATATGGAAGAGGG - Intronic
1155240084 18:23856629-23856651 AAGGACCTGCAGATGGTTGAGGG + Intronic
1156772533 18:40746937-40746959 AAGTGCTTGCAGATGGTCAATGG + Intergenic
1157385819 18:47259578-47259600 TAGAAATTGGAGATGGTAGAAGG + Intergenic
1158667431 18:59445205-59445227 TAATTTTTGCAGATGGTGTAAGG + Intronic
1202659840 1_KI270708v1_random:58071-58093 TAGTACTTGCAGGAGGTGGAAGG - Intergenic
926932296 2:18052721-18052743 TAGTAATGGCAGATGGTGGGTGG + Intronic
928885349 2:36142183-36142205 TTGTACATGCATATGGAGGAAGG - Intergenic
933429454 2:82156989-82157011 TTGTAATTGCAGATGGATGATGG - Intergenic
935067232 2:99659872-99659894 TAGTGCTTTCATCTGGTGGAGGG - Intronic
936262590 2:110974462-110974484 TAGTAATTGGATTTGGTGGAGGG - Intronic
936988944 2:118341693-118341715 GAGTACTGTCAGATGGTAGAAGG + Intergenic
941513740 2:166445852-166445874 TAGTTTTTGTATATGGTGGAAGG - Intronic
941765106 2:169288402-169288424 TGGTGCTTCCAGATGGTGGCTGG - Intronic
942135475 2:172920791-172920813 TAGTTCTTTCAGATGGATGATGG + Intronic
942281470 2:174368208-174368230 TAGTACATCCAGTTGATGGATGG - Intronic
943191868 2:184687188-184687210 TAGTTTTTGCATATGGTGAAAGG + Intronic
946994163 2:225371929-225371951 TAGTCCTTGCAGGTTGAGGAAGG + Intergenic
1171397998 20:24851371-24851393 TAATTTTTGCATATGGTGGAAGG - Intergenic
1177973685 21:27821738-27821760 TAGTATTTGTACATGGTGAAAGG - Intergenic
1180058800 21:45374374-45374396 CAGTGCTTGGACATGGTGGAGGG - Intergenic
1180327314 22:11441633-11441655 TAGTACTTGCAGGAGGTGGAAGG - Intergenic
949143250 3:662380-662402 TCCTTCTTGCAGATAGTGGAGGG + Intergenic
949624033 3:5848219-5848241 TCGTACTGGCAAATGGGGGATGG - Intergenic
950375508 3:12568945-12568967 TAGTACTTGCAGATGGTGGACGG - Exonic
952279797 3:31911893-31911915 TAGTACAGGCAGGTGCTGGAAGG + Intronic
956566318 3:70642552-70642574 GTGTACTTACAGATGGTGGCTGG - Intergenic
958598633 3:96263963-96263985 TAGTAGTTACAGATGTTGAATGG + Intergenic
960524156 3:118690598-118690620 AAGTACTTTAAGATTGTGGAAGG - Intergenic
961857594 3:129888155-129888177 TAATTCTGGCAGATGGTGGGAGG + Intronic
968223790 3:196959457-196959479 GAGAACTTGCAGCTGGTGGGAGG - Intronic
971530407 4:27680981-27681003 TAGGTCTTACACATGGTGGATGG + Intergenic
972867064 4:43245782-43245804 TAATATTTGCATATGGTGAAAGG - Intergenic
974509320 4:62817095-62817117 TAGTTCTTGGAAATGTTGGAAGG - Intergenic
975850476 4:78566764-78566786 TCTTACATGCAGATGGTGCATGG - Intronic
976318238 4:83682495-83682517 TAGTACCTGAACTTGGTGGAAGG + Intergenic
980260140 4:130437995-130438017 TAGTTTTTGCATATGGTGTAAGG + Intergenic
982905928 4:161070625-161070647 TTGTACTTGCGGAAGGTTGAAGG - Intergenic
984265025 4:177487954-177487976 CAGTACTGGCAGATGGTTTAGGG + Intergenic
986006622 5:3673693-3673715 CAGTATTTGCAGGTGGTGGTAGG - Intergenic
988521667 5:31951015-31951037 CTGTACCTGCACATGGTGGAAGG + Intronic
989725806 5:44585053-44585075 TTGCATTTGAAGATGGTGGATGG + Intergenic
990254636 5:53954288-53954310 AGGTATTTGCAGATGATGGATGG - Intronic
991576487 5:68109098-68109120 CAGTAATTGCAGGTGGTGAAAGG + Intergenic
993016037 5:82535780-82535802 TAGTACTTGCCGATTCAGGAGGG + Intergenic
996642848 5:125777785-125777807 TAGTACTTCCTGCTGGTGTATGG - Intergenic
998134914 5:139669460-139669482 TGTCACTTGCAGATGGCGGAGGG - Intronic
1002757381 6:174855-174877 TAGTATATGCAGGTGGGGGAGGG + Intergenic
1003469924 6:6420103-6420125 AGTTACCTGCAGATGGTGGAAGG + Intergenic
1005247323 6:23902820-23902842 TGGAACTTTCACATGGTGGAAGG + Intergenic
1006586252 6:35115844-35115866 TAGTATTTGTATATGGTGTAAGG - Intergenic
1008879035 6:56362084-56362106 TGGTAGTAGGAGATGGTGGACGG - Intronic
1015494684 6:133867513-133867535 CAGTTCTTGGATATGGTGGATGG + Intergenic
1016448687 6:144158429-144158451 GAATAGTTGCAGATGGGGGATGG + Intronic
1016828360 6:148408834-148408856 TAATATTTGCATATGGTGTAAGG + Intronic
1018162881 6:161064800-161064822 TATTACTTGCAGGTTCTGGAGGG + Intronic
1019117273 6:169775097-169775119 CAGTACATTCAGATGGGGGAAGG - Intronic
1023700512 7:42888114-42888136 TGGTACTTACAGATCCTGGAGGG - Intergenic
1027498240 7:78915257-78915279 TTGTATTTGCAGCTGGTGGCTGG - Intronic
1028619690 7:92811519-92811541 TAGCACTTGAAGATGGCAGAAGG + Intronic
1030638180 7:111973795-111973817 TAGTTGTTGAAGCTGGTGGAGGG + Intronic
1031145074 7:117988693-117988715 TAATAGTTGGAGAGGGTGGAGGG + Intergenic
1033929948 7:146508674-146508696 GACTACTTGCAGATGGGTGAAGG - Intronic
1033986592 7:147234170-147234192 AAGTATTTGGAGATGATGGATGG - Intronic
1039467485 8:37795115-37795137 TAGTGATTGCAAATGGAGGAAGG - Intronic
1041673135 8:60512856-60512878 TGGTACTTGGAGATGGCTGAAGG + Intergenic
1043153603 8:76749185-76749207 TATCACATACAGATGGTGGAAGG - Intronic
1044360254 8:91275001-91275023 GAGTACCTGCAGATGTTGAATGG - Intronic
1046713845 8:117545658-117545680 TTTTTCTTTCAGATGGTGGAGGG + Intergenic
1050673920 9:8030182-8030204 TAGTTCTTTCATATTGTGGATGG - Intergenic
1055355322 9:75431669-75431691 TAGCACTCCTAGATGGTGGAGGG + Intergenic
1057769531 9:97955367-97955389 TACTTCTTGCTGATGGTGGGGGG - Intergenic
1059860463 9:118454933-118454955 TAATCCTTCCAGATGATGGAAGG - Intergenic
1186442258 X:9596484-9596506 TAGTACTGGCATCTGGTGGGTGG + Intronic
1187034378 X:15522447-15522469 TGGTACTTGAAGATGGTGGCTGG - Exonic
1188986167 X:36770202-36770224 TAGGACCTGCAGAAGGTAGATGG - Intergenic
1189745381 X:44163092-44163114 TAGAACTTCCAGATGGTTGGGGG - Intronic
1191593097 X:62911251-62911273 TCGTACTTGCAGATGTTTGTTGG + Intergenic
1192315468 X:70048019-70048041 TAGGACTTGAAGATGGGGGGTGG - Intronic
1192838224 X:74825387-74825409 GAGGACTTCCAGATGGTGGGGGG - Intronic
1194914766 X:99691987-99692009 TACTACTGGTAGAGGGTGGAAGG + Intergenic
1195205958 X:102600438-102600460 CAGTACTTGGAGGTGGTAGATGG + Exonic
1197297314 X:124734643-124734665 TAGTACTTGCAGTTTGTTGATGG + Intronic
1200034302 X:153318247-153318269 CAGTCCTGGGAGATGGTGGAAGG - Intergenic
1201225074 Y:11810788-11810810 TTGTATCTGCAGATGGAGGAAGG - Intergenic