ID: 950380374

View in Genome Browser
Species Human (GRCh38)
Location 3:12608673-12608695
Sequence TAGATTTTGACTGACAGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 112}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950380374_950380378 27 Left 950380374 3:12608673-12608695 CCAGACCTGTCAGTCAAAATCTA 0: 1
1: 0
2: 0
3: 9
4: 112
Right 950380378 3:12608723-12608745 CTCCTCATCCCTATCTTCCTTGG 0: 1
1: 0
2: 1
3: 30
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950380374 Original CRISPR TAGATTTTGACTGACAGGTC TGG (reversed) Intronic
901812989 1:11778400-11778422 TAGATTCTGACTTAATGGTCAGG - Intronic
902723987 1:18323207-18323229 TAAATCATGACTGGCAGGTCTGG + Intronic
904252040 1:29231853-29231875 AAGATTTTGAATCACAGGGCTGG - Intergenic
905454308 1:38077179-38077201 TAGAGTTTGAATGGCAGGGCAGG - Intergenic
908914678 1:69112389-69112411 TAGCTTGTGTCTGACAGGCCTGG - Intergenic
919411124 1:197244537-197244559 CAGATTTTTACTTACAGGTAGGG + Intergenic
922709785 1:227817589-227817611 TAAATGTTGATTGACAGGTGGGG - Intronic
922738773 1:228004415-228004437 TAGACCTTGACAGACTGGTCAGG + Intergenic
923363042 1:233231612-233231634 TAGATTTTACCTGAAAGGGCAGG + Intronic
923879543 1:238088308-238088330 TAGATTTTGCCTGAGAGTTTTGG + Intergenic
1066808790 10:39296553-39296575 TATCTTTTGACTGAGAGGTTTGG - Intergenic
1071533059 10:86403434-86403456 CAGAAATTGACTGACAGGTTTGG + Intergenic
1071803934 10:89095898-89095920 TAGGTCTGGACTGACAGGTTAGG + Intergenic
1073093096 10:100960949-100960971 TGGATTCTGACTCATAGGTCTGG + Intronic
1073885732 10:108037540-108037562 TAATTTTTGACTGTCAGGTATGG + Intergenic
1075897439 10:126009250-126009272 GAGTTTTTGACAGACAGGTTGGG + Exonic
1077786228 11:5386686-5386708 TGCATGTTGAATGACAGGTCAGG + Intronic
1078389157 11:10920978-10921000 CAGATTTTGATAGACAGGGCTGG + Intergenic
1079137376 11:17783501-17783523 TAGGGTTTGACTGTCAGATCTGG + Intergenic
1080460831 11:32453479-32453501 TAGAGTGTGACTGACAATTCAGG + Intergenic
1080884917 11:36358368-36358390 TGGCTTCTGACTGACTGGTCAGG - Intronic
1092166422 12:6345510-6345532 TAGAGTCTGAATGGCAGGTCTGG - Intergenic
1095630935 12:44376578-44376600 TTGATTTTCTCTGACAGGACTGG + Exonic
1109707595 13:66117730-66117752 TTGACTTTGATTGACAGGTAAGG - Intergenic
1112875567 13:104033868-104033890 TACATTTTGACTCACAGTACAGG - Intergenic
1115317151 14:32036820-32036842 CAGATTCTGATTGACAGGCCTGG - Intergenic
1120649121 14:87109867-87109889 TTGATTTTGAATGACATTTCAGG - Intergenic
1120883842 14:89436134-89436156 TAGATTTTGATCTACAGGCCGGG - Intronic
1128245200 15:66128123-66128145 TAGATTCTGTCTGGAAGGTCAGG - Intronic
1128743779 15:70099770-70099792 GTGGTTTTGACTGACAGCTCTGG - Intergenic
1130407392 15:83614071-83614093 TAGACTTTGACTCACAGCTCAGG + Intronic
1135841148 16:25877462-25877484 GAGATTTTGAATGACACCTCTGG - Intronic
1135993546 16:27231850-27231872 TAGTTTTTAGCTGACAGCTCAGG - Intronic
1140145882 16:72308114-72308136 TAGATTTTGACAGACAGGCATGG - Intergenic
1143687290 17:8528105-8528127 TAGATTGCAGCTGACAGGTCCGG - Intronic
1144805156 17:17960675-17960697 TAAAATATGACTGACAGGCCTGG + Intronic
1146274078 17:31503844-31503866 TCGCTTTTTCCTGACAGGTCTGG - Intronic
1147563635 17:41523629-41523651 TAAATTTTTATTGGCAGGTCAGG + Exonic
1153303174 18:3609525-3609547 TAGCTTGTAACTGGCAGGTCAGG - Intronic
1158891575 18:61876988-61877010 GGGATTTTGACTGACAGGTATGG + Intronic
1162832162 19:13292107-13292129 TAGATTTTTACTGACAGTCTGGG + Intronic
1165737862 19:38188521-38188543 CAGGTTCTGACTGACAGGACTGG - Intronic
925918745 2:8625187-8625209 TAGAATTTGGCTGAAAGGTCTGG + Intergenic
926635511 2:15174726-15174748 TAGACTTTGAATGTTAGGTCTGG + Intronic
932141537 2:69282671-69282693 TAGATTTTGACTGGGAGGAAAGG + Intergenic
932670782 2:73736564-73736586 TAGGATTTGAGTGACAGGTTGGG - Intronic
932857257 2:75248781-75248803 AAGATTATGACTCACAGGCCAGG - Intergenic
937517301 2:122670013-122670035 TATATTTTGACCGTCAGGTGAGG - Intergenic
938724066 2:134091359-134091381 GAGTTTCTGACTGAGAGGTCTGG + Intergenic
940580835 2:155577441-155577463 TAGAATTTGACAGATAGGTTTGG + Intergenic
942196438 2:173525123-173525145 CAGAGTATGATTGACAGGTCTGG + Intergenic
942861361 2:180616708-180616730 TACATTTTGAGTGAGAGGTTTGG - Intergenic
946232160 2:218298305-218298327 AAGATTCTGATTCACAGGTCTGG - Intronic
948778127 2:240300549-240300571 GAGCCTTTGACTGACAGGCCAGG + Intergenic
1168935058 20:1657856-1657878 TAGATTGTGACTTACAAATCAGG + Intergenic
1170226114 20:13993819-13993841 TAGATTTTGAAAGAAAGGTGAGG - Intronic
1170372457 20:15664517-15664539 TTTATTTTGACTTACATGTCTGG + Intronic
1170655166 20:18279847-18279869 TACATTGTAAGTGACAGGTCAGG - Intergenic
1170673657 20:18458635-18458657 TGGATCTTGAATGACAGGCCTGG - Intronic
1175567366 20:59991101-59991123 TAGAATTTGATTGAGAGGTCTGG + Intronic
1181077486 22:20391232-20391254 TGGCTGTTGACTAACAGGTCAGG - Intergenic
1182162440 22:28136566-28136588 TAGATTTTGAATTTAAGGTCTGG - Intronic
1183236214 22:36620223-36620245 AAGATTTGGACTGAAAGGTGAGG - Intronic
1183906513 22:41045013-41045035 TAGATTTAAAATGACATGTCAGG - Intergenic
1184512947 22:44943660-44943682 TAGATTTCGACGGACAGGTTTGG + Intronic
949659744 3:6264818-6264840 TGCATTTTGACTGCGAGGTCAGG - Intergenic
950380374 3:12608673-12608695 TAGATTTTGACTGACAGGTCTGG - Intronic
954860910 3:53689594-53689616 TGGATTTTGATTGTCAAGTCTGG + Intronic
955719078 3:61862760-61862782 TAGATTTTTACAAGCAGGTCTGG - Intronic
958111764 3:89157070-89157092 TAAACTTTCACTGACAGTTCTGG + Intronic
959104089 3:102046509-102046531 AAGATTCTGACAGACAGGACAGG - Intergenic
959514831 3:107253534-107253556 TTGAGTTTGACTGCCAGGGCTGG - Intergenic
960022590 3:112971886-112971908 TAGGCTTTGAATGACAGGTTTGG - Intronic
964166553 3:153713643-153713665 TAGGTTATAAATGACAGGTCAGG - Intergenic
964204323 3:154155114-154155136 TAGATTTTGTCTGATAGGTAAGG + Intronic
965659526 3:171026819-171026841 TAGACTTGGACTCTCAGGTCTGG - Intergenic
970531943 4:16993853-16993875 TGGACCTTGACTGACAGGTAGGG - Intergenic
971515302 4:27478655-27478677 TAGATTTTGACACAAATGTCAGG - Intergenic
972128049 4:35794097-35794119 CATATTTTGTATGACAGGTCTGG - Intergenic
972153835 4:36131074-36131096 GAGATTTTAACCCACAGGTCAGG + Intronic
972689867 4:41386311-41386333 TAGATCCTGACTGACAAGGCTGG + Intronic
973713453 4:53651834-53651856 TACATTTTTACTGACCTGTCTGG + Intronic
975393000 4:73841691-73841713 TGGATTTTGGCTGACAGTCCTGG + Intronic
976192926 4:82505882-82505904 TAGATTTTGTCTGGCAGTTAAGG - Intronic
980127330 4:128786601-128786623 GAGATTTTGGCTGATGGGTCAGG + Intergenic
982258995 4:153477166-153477188 TAGATTTTGGCTTAAATGTCTGG + Intronic
982885007 4:160767567-160767589 TATAATTTGACTTACAGGTCTGG - Intergenic
984610747 4:181834373-181834395 TGGTTTGTGACTGACAGGACAGG - Intergenic
984697019 4:182789310-182789332 TAGATTATGACGGACAGGGGAGG + Exonic
986519939 5:8604520-8604542 CAGCTTTTGACTGAGAGGTTTGG + Intergenic
987485231 5:18517906-18517928 TAGCTTTTTATTCACAGGTCAGG + Intergenic
990462732 5:56044924-56044946 TAGTTTTTGACTCACCTGTCAGG - Intergenic
991614300 5:68480072-68480094 AAAATTTTGTCTCACAGGTCAGG + Intergenic
993761913 5:91806196-91806218 TAAATTTTGACTGGAAGGTTTGG - Intergenic
996520696 5:124422537-124422559 TAGATTTCTGCTGAGAGGTCTGG - Intergenic
999051470 5:148528175-148528197 TAGATTGTTAGTGACAGGTAAGG + Intronic
1005308087 6:24533058-24533080 GAGAATTTGGCTGACAGGTTTGG + Intronic
1008086186 6:47247124-47247146 TAGATTTTTAATGACATTTCAGG - Intronic
1008532952 6:52481418-52481440 TGGAGTTTGAGTGAGAGGTCTGG + Intronic
1014411517 6:121128569-121128591 TACATTTTAAATGACAGATCTGG + Intronic
1017380190 6:153819542-153819564 TAGATACTTACTGACTGGTCGGG + Intergenic
1026363073 7:69620715-69620737 TAGATTTTGACTTCCGGGTGTGG + Intronic
1030773426 7:113503373-113503395 TAGTTTTTGAAGGACAGGTTAGG + Intergenic
1036135826 8:6160728-6160750 TAGATTATGTATGACAGGACAGG + Intergenic
1052386434 9:27828762-27828784 TAGATTACAGCTGACAGGTCAGG + Intergenic
1055747301 9:79463650-79463672 TAGCTTTTGATTGATAGGTGGGG - Intergenic
1056834979 9:89947281-89947303 AAGATTTTACCTGAAAGGTCAGG + Intergenic
1057140657 9:92725000-92725022 TTGATCTTGACTGGCAGGCCTGG - Intronic
1058077399 9:100664746-100664768 TAGAGTTTCACTGGAAGGTCTGG - Intergenic
1058123328 9:101163465-101163487 TAGTTTTAGTCTGACAGGTGTGG - Intronic
1059570245 9:115426566-115426588 TAAATTTTGTCTCACAAGTCAGG - Intergenic
1060197660 9:121633963-121633985 CTAATTTTGACTGACAGGGCAGG - Intronic
1060377079 9:123125774-123125796 TACATGTTGACTGACTGATCTGG - Intronic
1060694903 9:125700685-125700707 TAAATTTTGAATGACTGCTCAGG + Intronic
1186321753 X:8435044-8435066 TAGAAAATGAGTGACAGGTCAGG - Intergenic
1189875483 X:45432194-45432216 AAGACATTGACTGAAAGGTCAGG - Intergenic
1191653862 X:63574930-63574952 TTTATTTTGACTCACAGTTCTGG - Intergenic
1194725223 X:97388106-97388128 TACATGTTGTCTGACAGTTCTGG + Intronic
1196670945 X:118367297-118367319 TAGATTTTTACTGGCAGATTTGG + Intronic
1196748582 X:119094168-119094190 TTGAATTTGACTCACAGGTCTGG - Intronic
1198216317 X:134558300-134558322 TAGATGTTCTCTGACAGGTAAGG - Intergenic
1199262726 X:145794429-145794451 CACATCTTGACTGAGAGGTCAGG - Intergenic