ID: 950383593

View in Genome Browser
Species Human (GRCh38)
Location 3:12638037-12638059
Sequence CTGAGTAAAGAGAAGAATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 701
Summary {0: 1, 1: 0, 2: 4, 3: 59, 4: 637}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950383593_950383595 24 Left 950383593 3:12638037-12638059 CCATCATTCTTCTCTTTACTCAG 0: 1
1: 0
2: 4
3: 59
4: 637
Right 950383595 3:12638084-12638106 TCACCATTTGAAATAATATTAGG 0: 1
1: 0
2: 4
3: 55
4: 663

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950383593 Original CRISPR CTGAGTAAAGAGAAGAATGA TGG (reversed) Intronic
904345717 1:29867554-29867576 TTGAGTGAATGGAAGAATGAAGG + Intergenic
904859592 1:33525510-33525532 TGGAGTAGAGAGTAGAATGATGG + Intronic
906155433 1:43611472-43611494 CTGAGCCAAGAGAAGACTGGAGG + Intronic
906301000 1:44681575-44681597 AGGAGTAATGAGTAGAATGAGGG + Intronic
906403467 1:45522360-45522382 GTAATTAAAGAGAACAATGAAGG - Intronic
909033327 1:70567457-70567479 CTGTGGAAAGACAAAAATGATGG - Intergenic
909319386 1:74264064-74264086 ATGAGAAAATAGAAGAAGGAGGG + Intronic
909509858 1:76440157-76440179 CTGAGTAAAGAGACGAAGCATGG + Intronic
909511721 1:76460927-76460949 ATGGGTAAAGAGAGGAATGGTGG + Intronic
909536798 1:76746044-76746066 CTGAGTAAAGTTAACAGTGAGGG + Intergenic
909896465 1:81077014-81077036 GTGAGTAGATAGAAAAATGATGG - Intergenic
910206963 1:84757998-84758020 CTGAGTAAATAGCAGAAACAGGG + Intergenic
910663258 1:89696446-89696468 CTGAGTAAAGAACAGACAGAGGG + Intronic
911117563 1:94261953-94261975 CTAAGCAAAAAGAAGAATGCTGG + Intronic
911413906 1:97546611-97546633 CTGAGGAAAAACAAGAATGGTGG + Intronic
911728274 1:101265311-101265333 TTGGGGAAAGAGACGAATGATGG - Intergenic
911957511 1:104256346-104256368 GAGAGAAAAGGGAAGAATGAAGG - Intergenic
912743149 1:112221099-112221121 CTGAGCAAAAAGAAGAAAGCTGG + Intergenic
913010443 1:114677845-114677867 TTGAGGAAAGGGAAGAAGGAAGG - Intronic
913045752 1:115072333-115072355 GGGAGGAGAGAGAAGAATGAGGG - Intronic
913404810 1:118477840-118477862 CAGAGGAAAGAGAAGATAGATGG - Intergenic
914084541 1:144440962-144440984 CTGAGTAAAGAGAAGTCGGCCGG - Intronic
914190554 1:145406228-145406250 CTGAGTAAAGAGAAGTCGGCCGG - Intergenic
914588360 1:149083102-149083124 CTGAGTAAAGAGAAGTCGGCCGG - Intronic
915774459 1:158467553-158467575 CCCAGTAAACAGAAAAATGAGGG + Intergenic
915967334 1:160322160-160322182 CTGAGCAAAAAGAACAAAGATGG + Intronic
915982360 1:160428279-160428301 CAGAGGAAAGAGAAGACAGACGG - Exonic
916220680 1:162441997-162442019 ATGAGAAAAGGGAAGAGTGAAGG + Intergenic
916633180 1:166638522-166638544 CTTAGTGAAGAGAAGAAAGATGG - Intergenic
916793582 1:168145723-168145745 ATGAGGAAAGAGAGGAACGAAGG + Intergenic
916986184 1:170193477-170193499 CTGAGCAAAAAGAAGAAAGCTGG - Intergenic
917177880 1:172258985-172259007 TTGAGTCAAGAGAAAAATTAAGG - Intronic
917349409 1:174061708-174061730 CTGTCTAAAAAGAAGAAAGAAGG - Intergenic
917580455 1:176372392-176372414 CTGAGCAAAAAGAACAATGCTGG - Intergenic
917681089 1:177368411-177368433 CTGAGTAATGAGAACAGAGAGGG - Intergenic
917803253 1:178589943-178589965 CTGAGTAAAAAGAACAAAGCTGG - Intergenic
917830043 1:178873014-178873036 ATGAGGAAAAAGAAGAATGGTGG + Intronic
917856917 1:179108580-179108602 AAGGGTAAAGAGAAGAATGGTGG - Exonic
917902009 1:179552043-179552065 AAGAGGAAAGTGAAGAATGAAGG - Intronic
918824524 1:189306162-189306184 AGAAGTAAAGAGTAGAATGATGG - Intergenic
919034410 1:192288032-192288054 CTGAGTAAAAAGAACAAAGCTGG + Intergenic
919345910 1:196378124-196378146 CTCCGTAAAGAGAAGAATCAAGG + Intronic
919525662 1:198646817-198646839 AAAAGTAAAGAGAAGAATCAAGG + Intronic
920824651 1:209413993-209414015 CTGAGCAAAGAGAAGGAAAACGG + Intergenic
921039237 1:211414496-211414518 CTGAGCAAAAAGAAAAAAGAAGG + Intergenic
923274761 1:232386406-232386428 CTGAGTGAGGAGAGGAAGGAAGG + Intergenic
923322190 1:232845585-232845607 CAGAGTCAAGGGAAGAAAGATGG - Intergenic
923515073 1:234690282-234690304 GAGAGAAAAGAGAATAATGATGG + Intergenic
923677611 1:236093547-236093569 CTGATTTAAGAAAAGAATGAAGG - Intergenic
923811189 1:237318634-237318656 CTGACAAAAGAGAAGACAGAAGG - Intronic
924689067 1:246327304-246327326 CTGACTGAAGATAAGAAAGAGGG - Exonic
924704206 1:246486017-246486039 CTCAGTATAGAGGAGGATGATGG - Intronic
1062940518 10:1417462-1417484 CTGACTCAAAAGAAGGATGAAGG + Intronic
1063093833 10:2891485-2891507 CTGGGAAATGAGAAGAGTGAGGG + Intergenic
1063333754 10:5188674-5188696 CTGTGTAGAGAGTAGAATGTAGG + Intergenic
1063621735 10:7655573-7655595 CAAAATAAATAGAAGAATGAGGG + Intronic
1066197149 10:33111491-33111513 GTGAGTAAAGACTAGCATGAAGG - Intergenic
1067702531 10:48584015-48584037 CTGGGGACAGAGGAGAATGAAGG - Intronic
1068068873 10:52170186-52170208 CTGAGGACAAAGAAGAAAGAAGG + Intronic
1068124499 10:52822347-52822369 CTGAGTTCAGAGAAGGAAGATGG + Intergenic
1068264591 10:54630215-54630237 CTAAGTGAAGAGAAGAAAGCTGG + Intronic
1068334295 10:55611980-55612002 AGAAGTAAAGAGTAGAATGATGG + Intronic
1068593329 10:58873505-58873527 CTGAGTTAACAGAAGCATAAAGG + Intergenic
1068984336 10:63093118-63093140 CTGAGTAGAGAGTAGAATGGTGG - Intergenic
1069420504 10:68242297-68242319 GTGAGTAATGAGAAAAAGGAGGG - Intergenic
1070060245 10:72975546-72975568 CTGAGCAAAAAGAAGAAAGCTGG - Intergenic
1070226374 10:74511303-74511325 CTGAGTAAAAAGAACAAAGCTGG - Intronic
1070558939 10:77551278-77551300 CTAGGGAGAGAGAAGAATGAAGG - Intronic
1070616051 10:77969989-77970011 CTCAGAAAAGAGAAGCAGGATGG - Intronic
1071366366 10:84904490-84904512 GAGAGAAAAGAGAAAAATGAAGG - Intergenic
1071421616 10:85505603-85505625 GTGAGAAAAGAAAAGAATCAAGG + Intergenic
1071498924 10:86189958-86189980 CTGAGCACAGAGAAGCACGAGGG - Intronic
1071557871 10:86619838-86619860 CTGTGTCAAGAAAAGAATGGTGG + Intergenic
1072435818 10:95414141-95414163 CTGAGGAAAGCTAAGAATTATGG - Intronic
1073135589 10:101218341-101218363 CTCATTAAAGAGAAGAAAGTTGG - Intergenic
1074148881 10:110740710-110740732 CTGAGTAAGGGGATGAATAAAGG - Intronic
1074157110 10:110808736-110808758 CAGAGTAAAGGTGAGAATGAAGG - Intronic
1074710633 10:116174372-116174394 GTTATTAAAGAGAAGAATGCAGG - Intronic
1074806266 10:117055867-117055889 CTAAGTAGAGAGAAAAATAATGG + Intronic
1075105566 10:119538103-119538125 CTGACTACAGAAAAGAAGGAAGG + Intronic
1075642057 10:124072002-124072024 CTGGGTAAGGAGAGGAATGGAGG - Intronic
1075755215 10:124805762-124805784 TTGAGTAAAGACCTGAATGAAGG + Intronic
1075829896 10:125399721-125399743 CAGAGTAAAGTGAGCAATGATGG + Intergenic
1076173621 10:128345622-128345644 CTAAGTAGAGAGTAGAATCATGG + Intergenic
1077172442 11:1173653-1173675 ATGAGTAAAGGAATGAATGAGGG - Intronic
1077757383 11:5047288-5047310 GTAAGGAAAGAGAAGACTGAAGG - Exonic
1078323369 11:10357345-10357367 CAGAGGAAAGAGAAGACAGAAGG + Intronic
1078360855 11:10666722-10666744 CTGAGTAAAGAGAGCTCTGAGGG + Intronic
1079265162 11:18924025-18924047 CTGGGTAAATAAAAAAATGAAGG + Intergenic
1079612389 11:22449234-22449256 CTCAGTAAAGACAAGAATACTGG - Intergenic
1081101679 11:39009688-39009710 TTGAGAAAATAGAAGAATGCAGG - Intergenic
1081129146 11:39355512-39355534 CTGATAAAAGGAAAGAATGATGG - Intergenic
1081135075 11:39430642-39430664 CTAAGTAAAAAGAACAAAGATGG + Intergenic
1081204352 11:40257796-40257818 CTGAGAACAGAGCAAAATGATGG + Intronic
1081238203 11:40671625-40671647 CTGAATAAGGACAAGAATGAAGG - Intronic
1082900231 11:58241170-58241192 CTGAGCAAAAAGAACAATGTTGG - Intergenic
1085028005 11:73249845-73249867 CTGAGGAACAAGAAGAATGCTGG + Intergenic
1085229810 11:74956488-74956510 CAAAGCAAAGAGAAGAATCAAGG - Intronic
1085325592 11:75604098-75604120 GTGAGGAAGGAGAAGTATGAAGG - Intronic
1085800540 11:79585372-79585394 CTGAGGAAAGAGTAGAATATGGG + Intergenic
1086344512 11:85882567-85882589 CTGAGTGAAGAGAAGGCAGAGGG + Exonic
1086440113 11:86821137-86821159 CTGGGGAAAGTGAAGCATGAAGG - Intronic
1086442325 11:86840861-86840883 CTGGGTAAATAGCAAAATGATGG + Intronic
1086446251 11:86874101-86874123 CTTTGTGAAGAGAAGAATAAAGG + Intronic
1086581026 11:88398586-88398608 CTGAGTAGAGTGATGAATCAGGG - Intergenic
1087063617 11:94007536-94007558 CTGAGTAAATAACAAAATGAAGG - Intergenic
1087955756 11:104285995-104286017 GTGAGGAAAGAGAAAAAAGAAGG + Intergenic
1088034811 11:105298544-105298566 CTAAGGGAAGACAAGAATGAAGG + Intergenic
1088865929 11:113848083-113848105 GTGAGTAAAGAAAACACTGATGG + Intronic
1090248429 11:125234464-125234486 ATGTGCATAGAGAAGAATGATGG - Intronic
1090350163 11:126102902-126102924 CTGGGCAAAGAGAAGAAAGGAGG + Intergenic
1090719894 11:129461928-129461950 CTGAGCAAAAAGAACAAAGATGG - Intergenic
1090767551 11:129889736-129889758 ATGAGGAAAGAGAAAAAAGACGG + Intronic
1090936076 11:131343748-131343770 CTGAGTAAAGAGAAGTTGGAAGG + Intergenic
1091239071 11:134040383-134040405 AAGAGGAAAGATAAGAATGAGGG + Intergenic
1091516758 12:1191937-1191959 CTGAATAAACAGTAGAATCATGG + Intronic
1091838490 12:3602619-3602641 CTGAAGAAAGAGTAGAAGGATGG - Intergenic
1092829599 12:12430906-12430928 ATGAACAAAGAAAAGAATGAGGG - Intronic
1092923217 12:13250868-13250890 ATGGCTAGAGAGAAGAATGAAGG + Intergenic
1092951804 12:13510556-13510578 GTGAGGAAAGAGAAGGATCAGGG + Intergenic
1093006464 12:14057011-14057033 CTGAATCAAGAGCAGAATGCTGG - Intergenic
1093102896 12:15049200-15049222 ATGAGGAAAGAGAAAAATAAAGG + Intergenic
1093326009 12:17774764-17774786 GTGAGCAAGGAGAAGAATCATGG - Intergenic
1093335769 12:17903308-17903330 CTGAGTAAATAAAAAAATTAAGG - Intergenic
1093836385 12:23834692-23834714 CTGAGTAAGGATAACAATGGAGG + Intronic
1094004311 12:25731174-25731196 CAGAGTACAGAACAGAATGAGGG + Intergenic
1094244430 12:28272600-28272622 ATGAATAAAGAGAAGGAGGAAGG - Intronic
1094348876 12:29500710-29500732 ATGAGTAAATGAAAGAATGAAGG + Intergenic
1094418981 12:30250405-30250427 CTGAATAGAGAGAGGAGTGATGG + Intergenic
1094800524 12:34028500-34028522 AGAAGTAGAGAGAAGAATGATGG - Intronic
1095113321 12:38322791-38322813 AGAAGTAGAGAGAAGAATGATGG - Exonic
1095399845 12:41801408-41801430 CAGATGAAAGAGAAGAATGATGG + Intergenic
1095554107 12:43480763-43480785 ATAAGTAGAGAGAAGAATGGTGG + Intronic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096923692 12:55117972-55117994 CTAAATAAAGAGAAAAATGAGGG + Intergenic
1097155894 12:57012166-57012188 CAGAGGAAAGAGATGAAAGACGG + Exonic
1097156366 12:57015132-57015154 GGGAGAAAAGAGAAGAAGGAAGG + Intronic
1097864454 12:64547946-64547968 CTGAAAAAAGAGAGGAATGAAGG - Intergenic
1097986794 12:65791668-65791690 CTGAGAAAAGAGAATTATAATGG - Intergenic
1098769006 12:74528690-74528712 CAGAAAAAAAAGAAGAATGATGG - Intergenic
1098957722 12:76704826-76704848 CTGAGCAAACAGAAAGATGAAGG - Intergenic
1099945079 12:89234784-89234806 GTGAGGACAGAGGAGAATGATGG + Intergenic
1100664829 12:96739634-96739656 ATGAGTGAATAGAAGAATAAAGG - Intronic
1100776635 12:97982124-97982146 CTGAGTAAAAAGAATAAAGTTGG + Intergenic
1101536351 12:105620769-105620791 CTGAGTAAAGAGAACAAAGCTGG - Intergenic
1101553259 12:105783324-105783346 CTCTGTAAAGAGTAGAATGATGG - Intergenic
1101814972 12:108139158-108139180 CTTAGGAAAGAAAATAATGAAGG + Intronic
1102216511 12:111165272-111165294 CTGAGAAAAGAGAAGTAGGAAGG + Intronic
1102527235 12:113520617-113520639 ATGAGTAAAGAGCAGAACGAGGG - Intergenic
1102939959 12:116931323-116931345 CTGAGCAAAAAGAACAATGCTGG - Intronic
1102987844 12:117293072-117293094 CTGAGTTAAGAGAACTATCATGG + Intronic
1103768382 12:123299886-123299908 CTGTGAAAAGAAAAGAAGGAGGG + Intronic
1103861006 12:124013949-124013971 TTGAATGAAGAAAAGAATGATGG - Exonic
1104104172 12:125643315-125643337 CTAGGTAGAGAGAAGAAAGAGGG - Intronic
1104761045 12:131297715-131297737 CTGAGAAAAGAGAAGACACAGGG + Intergenic
1104818733 12:131663077-131663099 CTGAGAAAAGAGAAGACACAGGG - Intergenic
1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG + Intergenic
1106312930 13:28569406-28569428 CTTAGGAAAGACAAGAAAGATGG - Intergenic
1106634550 13:31513622-31513644 CTGAGAGAAGAGACGAATGCAGG + Intergenic
1106808281 13:33333680-33333702 CTGATTAAAGGAAAGACTGAAGG - Intronic
1107106210 13:36645525-36645547 CTTGGAAAAGAGAAGACTGAAGG + Intergenic
1107465619 13:40647258-40647280 CTGAGCTAAGAAAAGAATTAGGG - Intronic
1108854132 13:54772695-54772717 CTGTGGAAAAATAAGAATGATGG + Intergenic
1108863718 13:54896016-54896038 CTGAGTGAAGAGGAGAGTGACGG - Intergenic
1108893825 13:55297527-55297549 ATGAGTGAAAAGAAAAATGATGG - Intergenic
1109239557 13:59868718-59868740 CTGAGGAGAGGGAAGAAGGAAGG - Intronic
1109290038 13:60462817-60462839 CTGAGTAAAAAGAACAAAGCTGG + Intronic
1110297365 13:73884233-73884255 CTGAGAAAAGAGAAGAATATAGG - Intronic
1110409319 13:75186549-75186571 CTGCTTCAAGAGAAGAATCAGGG - Intergenic
1111179845 13:84650172-84650194 TTGAGAAAAGAAAAAAATGAAGG + Intergenic
1111260788 13:85737517-85737539 CTTAGAAAAGAAAAGCATGATGG - Intergenic
1112130825 13:96522091-96522113 CTGAGTAAATAACAAAATGAAGG - Intronic
1112218194 13:97458195-97458217 CTGTGTGAAAAGATGAATGAGGG + Intronic
1112417353 13:99214703-99214725 CTGCTTAAGGAGAACAATGAGGG - Intronic
1113070199 13:106412783-106412805 AGGAATGAAGAGAAGAATGAGGG - Intergenic
1113237929 13:108302328-108302350 ATGAATAAAAAGAAGATTGAGGG - Intronic
1113282313 13:108802271-108802293 AAAAGTAGAGAGAAGAATGATGG - Intronic
1113322193 13:109244895-109244917 GTGAGTAAGGAGAAGAATGTTGG + Intergenic
1114192074 14:20447326-20447348 ATGAGGGCAGAGAAGAATGAAGG - Intronic
1114255982 14:21001656-21001678 CTGAGTAAAGAAATGTCTGAGGG - Exonic
1114989488 14:28269720-28269742 CTAAGTGAAGAGAAGAAAGCAGG + Intergenic
1115131532 14:30057762-30057784 CTGAGAAAACAGAAGAAAGGGGG + Intronic
1115402372 14:32976819-32976841 CTGAGAAATCAGAAGAATCAAGG + Intronic
1115449509 14:33530137-33530159 CTCACTAAAGAGCAAAATGATGG - Intronic
1115521910 14:34241534-34241556 CTGAGTAAAGGAGAGATTGATGG - Intronic
1115854936 14:37621227-37621249 CTGAAAAAAAAGAAAAATGAAGG - Intronic
1116364646 14:44044794-44044816 CTGAATAAAGAGCTGAATAAAGG + Intergenic
1116475283 14:45331933-45331955 CGGTGTAAAGAAAAGAATGAGGG - Intergenic
1116842022 14:49828067-49828089 CTGAGTGAACAGAAAAATGAAGG + Intronic
1117267256 14:54102797-54102819 ATGAGTAAAGGAAAGAATAAAGG - Intergenic
1117441966 14:55768459-55768481 TTGAATGAAGAGAAGAATGGTGG + Intergenic
1117487574 14:56213589-56213611 CATTGTAAAGAGAAGAATGGTGG + Intronic
1117751451 14:58928374-58928396 CTAAGCAAAGAGAAGAAAGTTGG + Intergenic
1118723294 14:68609160-68609182 CTGAGTAAAGTTGAGAGTGAGGG - Intronic
1119128860 14:72153477-72153499 CTCACTGATGAGAAGAATGAGGG - Intronic
1120551271 14:85876017-85876039 CTAAGTGAAACGAAGAATGAAGG + Intergenic
1120701470 14:87703756-87703778 CTGAGCCATGAGAAGAATGGTGG + Intergenic
1120871383 14:89340082-89340104 GAGAGGAAAGAGAAGAAGGAAGG + Intronic
1123800632 15:23816214-23816236 CTGGGTAATGAGGAGCATGAGGG + Intergenic
1123910794 15:24964975-24964997 CTGAGTAAAGTGTAGAGTTAGGG + Intronic
1123960575 15:25395413-25395435 CAGAGTAAACAGAAGTATAATGG + Intronic
1124078324 15:26467446-26467468 CTAAGTAAAAAGAAGAAAGCTGG + Intergenic
1125329722 15:38570849-38570871 CTGGGTAAATAAAAAAATGAAGG - Intergenic
1125382214 15:39098645-39098667 CTAAGCAAAAAGAACAATGATGG - Intergenic
1125786263 15:42320994-42321016 CTGAGTAAAGAGAAGAAAAAAGG - Intronic
1125989745 15:44094802-44094824 CTGATTAAAGAGATGAAAAATGG - Intronic
1127027523 15:54823896-54823918 TTGAGCAAAGAGAAGAAAGATGG - Intergenic
1127562785 15:60156976-60156998 GTGCGTAAAGTGAAGAATTAGGG - Intergenic
1127598124 15:60507617-60507639 GTGAGTAAAGACAAAAATAATGG + Intronic
1127700392 15:61494328-61494350 ATGAGTAAAGAATAGAAGGAAGG - Intergenic
1127820046 15:62646822-62646844 CTGGGGACAGAGAAGAATCAGGG - Intronic
1128035720 15:64524193-64524215 CTAAGTAAAATGAAGAATTAGGG - Intronic
1128301045 15:66566383-66566405 GTGAGGAAAGAAATGAATGAGGG - Intergenic
1128663551 15:69521603-69521625 CTGAGTAGTGAGAGGAATCAGGG + Intergenic
1129372711 15:75107986-75108008 GTAAGAAAACAGAAGAATGATGG + Intronic
1129699423 15:77759036-77759058 CTGAGTAAGGAGTAAAATCAGGG + Intronic
1130082903 15:80750190-80750212 CTTTGTAAATAGAAGAATAAAGG + Intronic
1130683844 15:86020053-86020075 TTGACTGAAGGGAAGAATGAAGG + Intergenic
1130827257 15:87562076-87562098 GTGAGTAGAGAGAAGAAACATGG - Intergenic
1130856999 15:87848636-87848658 AGGAGTAGAGAGTAGAATGACGG - Intergenic
1131105478 15:89731287-89731309 CTTCATAAAGAGAAGGATGATGG + Intronic
1131579046 15:93622876-93622898 CTGATCAAAGAGAAAAATGAAGG - Intergenic
1131660475 15:94509953-94509975 CTGAGCAAAGAGAAAAAAGCTGG + Intergenic
1131860840 15:96651688-96651710 TTGAGGAGAGAGAAGAAAGAAGG + Intergenic
1132003590 15:98205252-98205274 TTGAGCAAAGAGAAGAAAGCTGG + Intergenic
1132157714 15:99508117-99508139 CAAAGTACAGAGAAGATTGATGG - Intergenic
1132322959 15:100940269-100940291 TTTAGAAAAAAGAAGAATGAAGG - Intronic
1133351228 16:5101981-5102003 CTGATAAAAGAAGAGAATGAGGG + Intergenic
1133534781 16:6691353-6691375 CAGAGAAGAGTGAAGAATGATGG - Intronic
1133919759 16:10141519-10141541 ATGAATACAGAGAAGAATCAAGG + Intronic
1134301669 16:12997114-12997136 CTGAATGAAAAGAAGCATGAGGG - Intronic
1134754363 16:16653082-16653104 CTGAGCAGAGACCAGAATGATGG + Intergenic
1134908940 16:18006613-18006635 CTGACTACAGAGGAGAATGAGGG - Intergenic
1134991698 16:18705952-18705974 CTGAGCAGAGACCAGAATGATGG - Intergenic
1135734275 16:24918351-24918373 CTGAGTAAAGATGAAAATGTGGG + Intergenic
1137308559 16:47230440-47230462 CTGAGAAAAGAAAAGAGAGATGG + Intronic
1138637671 16:58354753-58354775 CTGAGTAAAAAGAACAAAGCTGG - Intronic
1139144767 16:64310036-64310058 ATGAAGAAAGAGAAGAAGGAAGG + Intergenic
1139249043 16:65477210-65477232 CTGAGCACAAAGAAGAATGCAGG + Intergenic
1139314251 16:66054941-66054963 CTGAGTGCAGTGAAGAATCAAGG + Intergenic
1141336370 16:83158892-83158914 GTGAGTAAAGTAAAGAAAGAAGG - Intronic
1141417909 16:83891050-83891072 CTGAGTAAAGAGAAGCGGAATGG - Intergenic
1141525909 16:84611652-84611674 ATGAATAAACAGGAGAATGAAGG + Intronic
1141645531 16:85365382-85365404 CAGGGAAAAGAGAAGAGTGAAGG - Intergenic
1141754916 16:85984419-85984441 GTAAGTGAAGAGAAGAATGAGGG - Intergenic
1143714188 17:8755408-8755430 CAGAGTAAAGAGGAGAAGTAGGG + Intronic
1145190100 17:20832932-20832954 AGAAGTAAAGAGTAGAATGATGG + Intergenic
1145282036 17:21475218-21475240 CTGTGTAAAGAGATAAACGATGG + Intergenic
1145353241 17:22109270-22109292 ATGAGTAAATAGAAGAATCAAGG - Intergenic
1145395409 17:22490388-22490410 CTGTGTAAAGAGATAAACGATGG - Intergenic
1145401299 17:22536801-22536823 AGAAGTAAAGAGTAGAATGATGG + Intergenic
1146061233 17:29608416-29608438 CAGAGTGAAGAGAATAATAATGG - Intronic
1146228368 17:31087557-31087579 CTGAGAAAAGTAAAGAAAGAGGG - Intergenic
1146503510 17:33384683-33384705 CTGAGCACAGAGAGGACTGAAGG - Intronic
1146518082 17:33504990-33505012 CTCAGTAAAGTGAAGAAAGTTGG + Intronic
1146805545 17:35862332-35862354 CTGAATAAATGGATGAATGATGG + Intronic
1147123523 17:38350757-38350779 CTGTGTAAAGATAAGAAGGCCGG + Intergenic
1148727783 17:49807827-49807849 GTGAGAAAAGAGAAGAATCTAGG + Intronic
1151887552 17:76932130-76932152 CTGTGTAAGAAGAAGAAAGAAGG - Intronic
1155716890 18:28954826-28954848 CTAAGTAAAGAGAACAAAGCTGG + Intergenic
1155872720 18:31047186-31047208 CTGAGTAAAAAGAAGACTGATGG - Intergenic
1156135924 18:34037463-34037485 CTGAGTAAAAAGAACAAAGCTGG + Intronic
1156443510 18:37216386-37216408 CTGAGTAAATAACAAAATGAAGG - Intronic
1157133605 18:45032513-45032535 ATGAGTGAAGAGATGAATGAAGG - Intronic
1157136217 18:45058455-45058477 ATGAGTATAGAAAAGAATTACGG + Intronic
1157519957 18:48338637-48338659 CTGAGGTAAGAAAGGAATGAAGG - Intronic
1158283933 18:55857705-55857727 CTCAGTAAATAGAAAAACGATGG + Intergenic
1158552323 18:58446507-58446529 CTGAGGAAACAGAATAATCATGG - Intergenic
1158621686 18:59038123-59038145 CTTATTAAGGAGAAGAAAGAAGG + Intergenic
1158750967 18:60260363-60260385 CAAAGTAGAGAGTAGAATGATGG - Intergenic
1158891969 18:61880850-61880872 GTGAGTAAAGAGAAGAATAAGGG - Intronic
1158937011 18:62373829-62373851 CTGAGGACAGAGGAGGATGAGGG - Intronic
1159275264 18:66211132-66211154 CTGATTAATCAGAAGAAGGAGGG - Intergenic
1159333540 18:67032789-67032811 CTGAGTAAATAAAAGCCTGAAGG - Intergenic
1163674486 19:18648625-18648647 CTGAGCAAGGAGAGGCATGAAGG - Intronic
1164405983 19:27946920-27946942 CTGAGTAAATAACAAAATGAAGG - Intergenic
1165343052 19:35225939-35225961 GTGAGTAAAGGGGAGAGTGAAGG - Intronic
1165922287 19:39306957-39306979 ATGAGTAAAGAGAAGAAATCAGG + Exonic
1166385446 19:42378093-42378115 CTGAGTGAAGAGATGTCTGAAGG - Intronic
1168067511 19:53926910-53926932 CTCAGAAAAAAGAAGAGTGAGGG + Intronic
1168479239 19:56704613-56704635 CTGAGCAAAGAGAACAAAGCTGG + Intergenic
925210190 2:2038846-2038868 CTGAGTTCAGAGAAGGGTGAGGG - Intronic
925913110 2:8586211-8586233 CTGAGGAAACAGAAGCATGACGG + Intergenic
926081678 2:9992070-9992092 CTGAGTATCGAGATCAATGAAGG - Exonic
926676339 2:15625140-15625162 CTGAGTAAACACAGCAATGATGG + Intronic
926805895 2:16710725-16710747 AAGAGTAGAAAGAAGAATGATGG + Intergenic
926999083 2:18773473-18773495 CTGAATAAAGAGAAAAGTGAGGG - Intergenic
927003577 2:18824777-18824799 CTGAGTAAATAGAAAAAGGGAGG + Intergenic
927269899 2:21195429-21195451 CTGAAGAAAGGGAAGAAGGAAGG - Intergenic
927291885 2:21412762-21412784 CAGAGTAAAGAAAAGTATCATGG + Intergenic
929288375 2:40162250-40162272 CTGAGTTGAGAAAAGAAAGATGG - Intronic
929375393 2:41280948-41280970 CTCAGTAGAGAGTAGAATGGTGG + Intergenic
929391678 2:41475682-41475704 CTGGGAAAGGAGAAGAATTAGGG - Intergenic
929460120 2:42097202-42097224 GTGAGCAAAGAGAATATTGATGG - Intergenic
929612076 2:43278295-43278317 CTGATTAAAGAAAAAAATCAGGG + Intronic
929747952 2:44678762-44678784 CTGAGAAAAGATGAGAAGGAAGG - Intronic
929897263 2:45972953-45972975 CTGAGTTAAAAGAACAAAGATGG + Intronic
929968064 2:46550428-46550450 CTGTGTAAAGACAAAACTGATGG - Intronic
930590572 2:53321973-53321995 CAGAGTAAAGAGAAGAAGTGTGG - Intergenic
931644680 2:64411279-64411301 TTGAGAAAAGAGAAGAAGGCAGG - Intergenic
931646951 2:64432395-64432417 CTTAGTGAAAAGCAGAATGAAGG - Intergenic
931856049 2:66302727-66302749 ATGAGTAAACAGATGAATAAAGG - Intergenic
932150473 2:69366662-69366684 CTGAGTAAAGTGGAAATTGAGGG - Intronic
932319468 2:70810795-70810817 CTGGGGAAAGTGAAGCATGAAGG - Intronic
932375998 2:71236284-71236306 CTAAGAAAAGAGAAGAATGGCGG + Intergenic
932502701 2:72197979-72198001 CAGAGCAAAGAGGAGAATGTTGG + Intronic
933323546 2:80807566-80807588 CTGAGTAAAAAGAACAAAGCTGG + Intergenic
933409386 2:81906137-81906159 CTGAGTCAAGAGAACATTTACGG + Intergenic
934678954 2:96268903-96268925 GTGAGTAAAGATAACAATGGCGG + Intronic
935394108 2:102587444-102587466 CTGGGGAGAGAGTAGAATGATGG + Intergenic
937173972 2:119907666-119907688 CTGAGTCAAGAGGACAAAGATGG + Intronic
937383971 2:121408859-121408881 ATGAATAAAGACAACAATGATGG + Intronic
938635032 2:133214798-133214820 CTGGGCAAAGAGAAGACTAAGGG - Intronic
938654645 2:133418528-133418550 GTGAGAAAAGAGAAGGATCAGGG + Intronic
939180669 2:138798828-138798850 CTGAGTAAATAGCAAAATTAAGG + Intergenic
939455204 2:142425396-142425418 CAGAGTAAGGTGAAGAATGATGG - Intergenic
939633138 2:144549848-144549870 CCCAGTGAAGACAAGAATGAAGG - Intergenic
939889893 2:147723827-147723849 CTGAGTAAAGAATGGATTGAAGG - Intergenic
940424677 2:153516856-153516878 CTGTGTAAAGAGAAGTGGGAAGG - Intergenic
940730909 2:157390158-157390180 CTAAGCAAAAAGAAGAAAGATGG - Intergenic
941071100 2:160955524-160955546 TTTAATGAAGAGAAGAATGAAGG + Intergenic
941858413 2:170253711-170253733 TTGAGATAAGAGAAGAATAAGGG + Intronic
941919769 2:170838755-170838777 CTGAGCTAAGAGAAGAGTAAGGG - Intronic
942058367 2:172205959-172205981 CTGAATTAAGAGGAGAAGGAAGG + Intergenic
942117575 2:172743219-172743241 CTGAGGAAAGAGAAAGAGGATGG + Intronic
942199634 2:173558322-173558344 CTGAGGAGAGAGAACAGTGATGG - Intergenic
942911617 2:181251274-181251296 CTGAATGAAGAGAGGAATGCAGG + Intergenic
943459801 2:188158304-188158326 CAGAGTAATGATTAGAATGAAGG - Intergenic
943799150 2:192035888-192035910 CTGAGCACTGAGAAGAATAATGG - Intronic
944247877 2:197550627-197550649 CTGGGGAAAGTGAAGCATGAAGG + Exonic
944679571 2:202064862-202064884 GTGAGTCAAGAGAAGGATTATGG + Intergenic
945110990 2:206359481-206359503 CTGAGTAAAAAGAACAAAGATGG + Intergenic
945517086 2:210775614-210775636 TTGAGTAAAGGGAAAATTGAAGG + Intergenic
945524653 2:210873104-210873126 CTGATTTACTAGAAGAATGAAGG - Intergenic
946549910 2:220789949-220789971 CAGAGTGAAGAGAAGAATTTTGG - Intergenic
947615487 2:231554470-231554492 CTGAGTACACAGACGAAGGAAGG - Intergenic
948324710 2:237104890-237104912 CTGAGCAAAGAGAACAAAGCTGG + Intergenic
948533180 2:238626523-238626545 CTGAGAAAGGAGAACAAGGAGGG - Intergenic
1168926001 20:1579422-1579444 TTGAGTTATGAGCAGAATGATGG + Intronic
1169369378 20:5016835-5016857 GGGAGTAAAGAGGAAAATGATGG + Intergenic
1169564042 20:6833354-6833376 CAGAGTAAAAAGAACCATGAAGG + Intergenic
1169568614 20:6882841-6882863 CTAAGTAAAGAAAACAAAGATGG + Intergenic
1169726689 20:8741390-8741412 ATGAGTAAGTAGATGAATGATGG + Intronic
1169988201 20:11470306-11470328 CTGAGGAAATAGAATAATGTTGG - Intergenic
1170160965 20:13310619-13310641 CAGAGTAAAGAGAAAAATTATGG + Intergenic
1170218174 20:13914252-13914274 CTGAGTAAAGTGAAAAATTGAGG + Intronic
1170306098 20:14939531-14939553 CTGAGCAAAAAGAACAATGCTGG - Intronic
1170772365 20:19344117-19344139 GTGAATAAAGAGAACAATGGTGG + Intronic
1171039654 20:21748912-21748934 CTGGGTAAATAGCAAAATGAAGG - Intergenic
1171513869 20:25711744-25711766 CTGGGTAAATAGCAAAATGAAGG - Intergenic
1171559387 20:26109213-26109235 CTGAATACAAAAAAGAATGAAGG + Intergenic
1171563487 20:26153466-26153488 ATGAGTAAATAGAAGAATCGAGG - Intergenic
1172334010 20:34098999-34099021 AAGAATAAAGAGATGAATGAGGG - Intronic
1173343095 20:42172071-42172093 TTGATTAAAGAGAAAAAAGAAGG + Intronic
1173623681 20:44455812-44455834 ATGAGTGAAGAGAAGAAGGGAGG + Intronic
1173920220 20:46738865-46738887 GTGAGCAAAGGGTAGAATGATGG + Intergenic
1174267395 20:49341519-49341541 TTGAGTAAAGAAAAGAAGGCTGG - Intergenic
1174289243 20:49496013-49496035 CTGAGTATATAGATGGATGAGGG - Intergenic
1174596864 20:51691042-51691064 CTGAGTAAACAGAGAAACGAGGG - Intronic
1174655028 20:52164322-52164344 ATTAGTAAAGAGAGGAATAAGGG - Intronic
1174767329 20:53266248-53266270 AGGAGTAAAGAGATGAAGGAGGG + Intronic
1175055572 20:56194415-56194437 CTGAGAAAAAAGAAAAAAGAGGG - Intergenic
1175534849 20:59702374-59702396 CTGAATAAAAAGAAGAAAAAAGG - Intronic
1176901772 21:14451028-14451050 CCGATGAAACAGAAGAATGAAGG - Intergenic
1177104575 21:16938649-16938671 CTGAGCAAAGAGAACAAAGCTGG - Intergenic
1178144945 21:29728441-29728463 CTCAGTGAAGAGATGAGTGAAGG + Intronic
1178702633 21:34846290-34846312 CCGGGGAAAGAGATGAATGAAGG - Intronic
1179284361 21:39964068-39964090 CTGAATTGAGAGAAGACTGAGGG - Intergenic
1180541275 22:16450115-16450137 CTGGGTAAATAAAAAAATGAAGG + Intergenic
1181780706 22:25190896-25190918 CTGTGTAAGGGGAAGAATGAGGG + Intronic
1184418293 22:44364561-44364583 CTGCTTAAGGAGAAGGATGAGGG + Intergenic
949166311 3:945700-945722 CAGAGCAAAGACAAGAATGCTGG + Intergenic
950366909 3:12492930-12492952 CTGAGGAAAGAGAGGAATGGGGG - Intronic
950383593 3:12638037-12638059 CTGAGTAAAGAGAAGAATGATGG - Intronic
950951230 3:17001797-17001819 CTGAGTAAAAAGAACAAAGCTGG - Intronic
951282362 3:20767774-20767796 CTGAGTAAAAAGAACAAAGCTGG - Intergenic
951431946 3:22618394-22618416 AAGAGGAAAGAGAAGAAGGAAGG + Intergenic
951977656 3:28530897-28530919 CTGAGTAAAAAGAACAAAGCTGG + Intronic
952253845 3:31678906-31678928 CTGAGTGAAGAATAGACTGAAGG - Intronic
952740718 3:36731644-36731666 ATGAGGAAAGAGAAGACTCAAGG - Intronic
953100760 3:39824293-39824315 CAGAGCAAAGAGAACAATGCTGG - Intronic
953681013 3:45038028-45038050 TTAAGTAAAGACAAGATTGAAGG - Intergenic
953787284 3:45920713-45920735 CAGAGTAAACAGAGGCATGATGG - Exonic
954680218 3:52341770-52341792 CTGAGTCAAGTGAGGAAGGATGG + Intronic
955035641 3:55264571-55264593 ATGAGGAGAGAGAAGAAGGAGGG + Intergenic
955369179 3:58336283-58336305 CTGAGTCACCAGAAGGATGAAGG + Intronic
955470136 3:59278269-59278291 CAAAGTAAAGAGAGGAATCAAGG - Intergenic
955534450 3:59908267-59908289 CTTTGCAAAGAGAATAATGAAGG + Intronic
955767141 3:62356743-62356765 ATGAGTAAGGAGAAGGATGGAGG + Intergenic
955993666 3:64655692-64655714 CTAAATACAGAGAAGAATTATGG + Intronic
956051603 3:65254218-65254240 CTAAGCAAAGAGAACAATGCTGG - Intergenic
956448285 3:69347115-69347137 CAAAATAAAGAGATGAATGAAGG + Intronic
956608960 3:71102592-71102614 CTTGGGAAAGAGAAGAAAGACGG - Intronic
957083788 3:75661322-75661344 CTAAGCAAAGAGAATAAAGATGG - Intergenic
957627608 3:82673836-82673858 TTTAGTAAAGAGAATATTGATGG - Intergenic
958122512 3:89309838-89309860 TTGTGAAAAGAGAAGAAAGAAGG - Intronic
959038456 3:101392738-101392760 CTGAGCAAAAAGAACAATGCTGG + Intronic
959902157 3:111673616-111673638 CTGAGCTAAGACAAGACTGAAGG - Intergenic
960431685 3:117576905-117576927 ATCAGGAAGGAGAAGAATGAGGG - Intergenic
961139750 3:124545915-124545937 CTGAGAAAAGAGATGCATTATGG + Intronic
961346623 3:126267563-126267585 GTGATTAAAGAAAAGAAAGAAGG + Intergenic
961379980 3:126490746-126490768 CTGACTAAAGAGAAGGAGTAGGG + Intronic
962560113 3:136597286-136597308 CTTAGTAAAGAAAAGAAAGAAGG + Intronic
962580492 3:136793270-136793292 CTGGGCAAACAGAAAAATGATGG + Intergenic
963005310 3:140721637-140721659 CTGACTGAAGACAAGAATGCTGG - Intergenic
963285614 3:143431787-143431809 CTGAGTTTAGAGAAGTAAGAGGG - Intronic
963608314 3:147433471-147433493 CTGAGTAAAGAGAAAGGTAAAGG + Intronic
964114808 3:153124693-153124715 CTGAGTAAAAAGAACAAAGCTGG - Intergenic
964242600 3:154614584-154614606 CAGAGGAAAGTGACGAATGATGG - Intergenic
964883705 3:161454710-161454732 CTGAGTAAACAGAACAAATAGGG + Intergenic
965408161 3:168296372-168296394 CATAGTAGAGAGGAGAATGATGG - Intergenic
965670139 3:171139640-171139662 CTAAGTAAAGTGTAGAAGGAAGG + Intronic
965689798 3:171343451-171343473 CTGGGGAAAGAGAAGCCTGAAGG + Intronic
965886978 3:173458016-173458038 CAGAGTACAGAGATGAATTAAGG + Intronic
966138189 3:176725041-176725063 CTGAGTAAAAAGAACAAAGCTGG - Intergenic
966948984 3:184798772-184798794 CTAAGCAAAGAAAAGAAAGAAGG - Intergenic
967008229 3:185405535-185405557 CTGCGCAAAGAAAAGAATGGAGG - Intronic
967468820 3:189839188-189839210 CTCTGAAGAGAGAAGAATGAAGG + Intronic
969921242 4:10541821-10541843 ATGATTAAATAGATGAATGAAGG + Intronic
970119907 4:12741965-12741987 CTGAGGAAGTAGAATAATGAAGG - Intergenic
970227136 4:13870893-13870915 CTTGTCAAAGAGAAGAATGAAGG - Intergenic
970346878 4:15160799-15160821 CTGAGGATGGAGGAGAATGAGGG + Intergenic
970385026 4:15547489-15547511 GTAAGAAAAGAGTAGAATGATGG - Intronic
970551661 4:17187846-17187868 CTTAGCAGAGAAAAGAATGAAGG - Intergenic
970923005 4:21417094-21417116 CTTGAGAAAGAGAAGAATGATGG - Intronic
971005579 4:22370619-22370641 CTGAGTAAACAGAACAAAGCTGG + Intronic
971289489 4:25323721-25323743 CTCAGTAAAGGTAAAAATGATGG - Intronic
971961031 4:33487300-33487322 GAGGGAAAAGAGAAGAATGAGGG + Intergenic
971988003 4:33851509-33851531 ATGAATAAATAGAAGAATCAAGG + Intergenic
972128209 4:35797197-35797219 CTGAGCAAAGAGAACAAAGCTGG + Intergenic
973619167 4:52710651-52710673 CTTAGTAAAGAGACTAATGCAGG - Intergenic
973769282 4:54191788-54191810 CTGAGCAACCAGAAGAATGCAGG + Intronic
973952942 4:56036033-56036055 TGGAGTAAACAGAAGACTGATGG - Intergenic
974229113 4:59086588-59086610 CTGCGGAAAGAGAAGGATGGAGG + Intergenic
974230965 4:59112993-59113015 CTGGGTAAACAAAAAAATGAAGG - Intergenic
974243149 4:59278668-59278690 CTGAGTAAAAAGAAGACAGCTGG + Intergenic
974263680 4:59557703-59557725 CTGAGTAAATAACAAAATGAAGG - Intergenic
974367844 4:60975289-60975311 CTGGGTACATAGAAAAATGAAGG - Intergenic
974920458 4:68232906-68232928 CAGAGTAAAGAGAATTATCATGG - Intronic
975551019 4:75612514-75612536 CTTAGTACAGAGATGAATGTAGG + Intronic
975796644 4:78012922-78012944 CTGTGTACCAAGAAGAATGATGG - Intergenic
976022976 4:80653086-80653108 CTGAGAAAAGAGATGTAGGATGG - Intronic
976263802 4:83171473-83171495 CTGAGTAAAAAGAAAGATGGTGG - Intergenic
977049960 4:92117408-92117430 CTAAGCAAAAAGAACAATGATGG - Intergenic
977182629 4:93896076-93896098 CTGAGCTACTAGAAGAATGAAGG + Intergenic
977967948 4:103177417-103177439 AAGAGTCAAGAGAAGAATGGTGG - Intronic
978215876 4:106202323-106202345 ATAAGAAAACAGAAGAATGATGG + Intronic
978461602 4:108960530-108960552 CTGAGGATAGGGAAGAATCAAGG + Intronic
978752011 4:112260288-112260310 CTGAGAAAAGGGAAGGATGAAGG + Intronic
979115550 4:116817957-116817979 CTGGGTAAATAAAAAAATGAAGG + Intergenic
979934331 4:126672619-126672641 CTGAGTAAATAACAAAATGAAGG + Intergenic
980559838 4:134459071-134459093 CACAGAAAGGAGAAGAATGAAGG - Intergenic
981075460 4:140586891-140586913 CTGAACAAAGGGAAGAATGGAGG + Intergenic
981294859 4:143120212-143120234 ATAAGTAAAGAAATGAATGAAGG + Intergenic
981753111 4:148112372-148112394 CTGAGTAGAGAATAGAATGGAGG - Intronic
981786876 4:148489440-148489462 CTGAGGAACTGGAAGAATGAAGG - Intergenic
981787093 4:148491767-148491789 CTGAGGAATTGGAAGAATGAAGG - Intergenic
981851220 4:149232488-149232510 CTGAGCAAAGAGAACAAAGCTGG + Intergenic
981863579 4:149386252-149386274 CAGTGGAGAGAGAAGAATGAGGG + Intergenic
982336777 4:154248636-154248658 CTAAGTAAAAAGAAGAAAGCCGG + Intronic
983398181 4:167230048-167230070 CTTAGAAAAAAGAGGAATGATGG - Intronic
983594567 4:169451537-169451559 CTGGGTAAATAAAAAAATGAAGG + Intronic
983669728 4:170222132-170222154 CTGAGCAAAGAGAACAAAGCTGG + Intergenic
984058631 4:174963488-174963510 CTTAGCAAAAAAAAGAATGAAGG + Intronic
984136555 4:175947943-175947965 ATGAATAAAAAGATGAATGAAGG + Intronic
984549257 4:181141130-181141152 CTGGGTAAAGAGGAAATTGAGGG - Intergenic
985088356 4:186338401-186338423 CTGAGTGAAAAGAAGAACGCTGG - Intergenic
986034921 5:3928083-3928105 CTGAGTTGAGTGAAGAATGTGGG - Intergenic
986422873 5:7601696-7601718 CAGAGTGAAGAGAAGAATGAAGG - Intronic
986446021 5:7822014-7822036 CGGAGAAAAGTGAAGAAGGAAGG + Intronic
986872051 5:12059949-12059971 CTGAGAAAAGTTAAGAGTGACGG + Intergenic
986949373 5:13063161-13063183 ATGAGTAAAGTGAAGAAGGCAGG + Intergenic
987395862 5:17422750-17422772 GTGAATAAAGAGAAGAATTGGGG - Intergenic
987665150 5:20927688-20927710 CTGAGCAAAAAGAAGAAAGATGG - Intergenic
987924548 5:24323445-24323467 CTGAGTAAAGATGAGAACCAGGG - Intergenic
987995592 5:25273685-25273707 TTGAGTAAAGAGAAGAAAGGTGG + Intergenic
988096890 5:26626505-26626527 ATTACTAAAGAAAAGAATGAGGG + Intergenic
988185595 5:27857548-27857570 CTGAGAATAGAGAAGAATATGGG + Intergenic
988284844 5:29199278-29199300 GTGAGCAAAGAGAAAAATTATGG - Intergenic
988757537 5:34274494-34274516 CTGAGCAAAAAGAAGAAAGATGG + Intergenic
989078003 5:37585645-37585667 CTGGATCAAGAGCAGAATGATGG - Intronic
989597949 5:43174354-43174376 CTCTGTAAAGAAAAGATTGAAGG - Intronic
990140277 5:52695249-52695271 CTGAGAAAGGAGATGAAGGAAGG - Intergenic
990533615 5:56698405-56698427 CAGAGTACAGAGAACAATGCTGG - Intergenic
990587761 5:57228621-57228643 CTGAGTAAAATAAAGAATGGAGG - Intronic
991212406 5:64120870-64120892 CTGAGTAAGGTGAAGAGGGAAGG + Intergenic
991266196 5:64721058-64721080 TTGATTAAGGATAAGAATGAGGG - Exonic
992059831 5:73031996-73032018 ATGATTAAATAGCAGAATGATGG + Intronic
992537739 5:77727906-77727928 ATGAGTAAAGCTAAGAGTGAAGG + Intronic
993118963 5:83751846-83751868 CTGAGGACAGAGAAGTTTGAAGG - Intergenic
993367620 5:87052484-87052506 CTGAGCAAACAGAACAAAGAAGG + Intergenic
993398365 5:87418548-87418570 CTGGGTAATGGGGAGAATGATGG + Intergenic
993415447 5:87624327-87624349 CTGAGGAAAGAAAATATTGATGG - Intergenic
993791315 5:92215057-92215079 CTAAGTAAAAAGAAGAAAGCTGG - Intergenic
993958753 5:94270463-94270485 CTGAGCAAAAAGAACGATGAGGG + Intronic
994238323 5:97391653-97391675 ATGAGCAAAGAGGAGAAAGATGG + Intergenic
994380661 5:99067143-99067165 ATGAGTAAAGAGAAGAAAAATGG + Intergenic
994982558 5:106894700-106894722 CTAAGCACGGAGAAGAATGAGGG - Intergenic
995569937 5:113469423-113469445 CTGGGTAAATAGTAAAATGAAGG - Intronic
995701116 5:114937075-114937097 CTGAGAAAAGGGAAGAAGGCAGG + Intergenic
995721919 5:115144342-115144364 CTGAGGGAAGAGAAGGATGAAGG - Intronic
995778575 5:115751765-115751787 TTGCGTTAAGAGAAGAAAGAGGG + Intergenic
996008053 5:118447330-118447352 ATGAGTAAATACAAGAATGAGGG + Intergenic
996369834 5:122741475-122741497 TAAGGTAAAGAGAAGAATGAAGG - Intergenic
996667020 5:126071719-126071741 CTAAGCAAAAAGAAGAATGCTGG - Intergenic
996837019 5:127804645-127804667 CTGGGATAAAAGAAGAATGATGG - Intergenic
997990358 5:138540019-138540041 CTGAATAAAGGGAAGTATGTTGG - Intronic
998605251 5:143627105-143627127 CTGAGTAGAGTGAACGATGAGGG + Intergenic
998676224 5:144411234-144411256 CTGAGTAAAAAGAACAAAGCTGG + Intronic
1000448322 5:161352514-161352536 CTAAGTAGAGAGTAGAATGACGG + Intronic
1000570589 5:162908665-162908687 CTGAATAAAGAGAATTCTGATGG + Intergenic
1000624332 5:163521987-163522009 ATGAATAAATAGAATAATGAGGG - Intergenic
1001192606 5:169644502-169644524 CTGAATAGCTAGAAGAATGAGGG + Intronic
1001256661 5:170188639-170188661 ATGAGGATAGAGAAGAAGGAGGG + Intergenic
1002363868 5:178695184-178695206 CTGAGTAGAGCAAAGAATGATGG - Intergenic
1002516628 5:179763816-179763838 CTGTCTAAAGATAATAATGAGGG + Intronic
1002886013 6:1295047-1295069 CTGAGTAAAGAAGAGAGTGTTGG - Intergenic
1003408204 6:5840378-5840400 CTGTGTAAGTAGAAGTATGAAGG - Intergenic
1003745200 6:8993333-8993355 GTGAGTTCAGAGAAAAATGAAGG + Intergenic
1005124080 6:22425832-22425854 GTGAATAAAAATAAGAATGAAGG - Intergenic
1006553481 6:34845292-34845314 CTGAGCAAAGAGAAGAAAACTGG - Intronic
1006762879 6:36478888-36478910 TTGTGTACAAAGAAGAATGAAGG - Intronic
1006957554 6:37887967-37887989 CTTAGTATAGTCAAGAATGACGG - Intronic
1007898369 6:45385921-45385943 CTGAGTAGAAAGAAGAAAAAGGG - Intronic
1008019436 6:46559211-46559233 CTGAGTATAGAGTAACATGAGGG - Intronic
1008071720 6:47105240-47105262 CTGAGTAAAGGTTAGAACGAGGG + Intergenic
1008307516 6:49921837-49921859 ATGAGAAAAGAGAATCATGAGGG + Intergenic
1008937395 6:57006789-57006811 CTGAGCAAAAAGAACAATGCTGG + Intronic
1010158877 6:72828170-72828192 CTGAGCAAAAAGAACAAAGATGG - Intronic
1010467377 6:76184778-76184800 AGAAGTAGAGAGAAGAATGATGG - Intergenic
1010682263 6:78810637-78810659 ATGGGTAAAGAGAGGAAGGAAGG - Intergenic
1010961437 6:82150563-82150585 CTGAGCAAAGAGAACAAAGCTGG + Intergenic
1011116812 6:83902461-83902483 CTGAGCAAAAAGAACAAAGATGG - Intronic
1011172602 6:84522500-84522522 CAGAGTAAAGACAAGAAGGGAGG + Intergenic
1011796106 6:90954300-90954322 CTGAATCAATAGAAGAATTAGGG - Intergenic
1012227949 6:96726410-96726432 CTGAGCCATCAGAAGAATGAGGG + Intergenic
1012409689 6:98942821-98942843 CTTATTAATGGGAAGAATGAGGG + Intronic
1012795863 6:103760311-103760333 TGAAGTAAAGAGCAGAATGATGG + Intergenic
1012931957 6:105326785-105326807 CAGAGAAAAGAGAAAAATGGAGG + Intronic
1013890009 6:115015170-115015192 ATGAGTATAGAATAGAATGAAGG - Intergenic
1015046893 6:128787072-128787094 CTAAGTAAAAAGAAGAAAGCTGG - Intergenic
1015602952 6:134928230-134928252 CTGAGAAAACAGAAGAAATAAGG + Intronic
1016405799 6:143728535-143728557 CTGAGCAAAAAGAAGAAAGCTGG + Intronic
1017099886 6:150839041-150839063 CTGAGACAAAAAAAGAATGATGG + Intronic
1017278922 6:152602550-152602572 CTGCACAAAGTGAAGAATGAAGG + Intronic
1018294067 6:162326868-162326890 CTAAGTAAAGAGAGGAGTTATGG + Intronic
1018345173 6:162892415-162892437 TTGAGTAATGACCAGAATGAAGG + Intronic
1018360160 6:163059256-163059278 ATGAGAAAAGAGAAAAAAGACGG - Intronic
1018661684 6:166093210-166093232 CTGACTAAAGAATAGGATGATGG + Intergenic
1019207465 6:170374684-170374706 CTGAGTGAAGGGAAGAAGAAAGG - Intronic
1019867553 7:3726826-3726848 TTGAGTAAAGAGAAGAGTTGGGG - Intronic
1020107082 7:5427112-5427134 CTGGGTAAACAAAAGTATGAGGG - Intergenic
1020510527 7:9050783-9050805 CTGGGAGGAGAGAAGAATGAGGG + Intergenic
1020810252 7:12842435-12842457 CTGGGTAAATAGCAAAATGAAGG + Intergenic
1020991519 7:15202567-15202589 CTGACTAATGTGAAGGATGATGG - Intronic
1022346638 7:29522140-29522162 CTGAGTAAAAAGAACAAAGCTGG - Intergenic
1022770756 7:33470281-33470303 CTGAGAAAAAAAAAGAATGCTGG - Intronic
1023634651 7:42197613-42197635 CTCAGTACAGAGAAGGATGGGGG + Intronic
1023991879 7:45133394-45133416 CTGAGTAAAGACAGGGATGGAGG + Intergenic
1024150144 7:46563190-46563212 CTAAGTAAAAAGAAGAAAGCTGG + Intergenic
1025274230 7:57560829-57560851 ATGAGTAAATAGAAGAATCAAGG + Intergenic
1025554829 7:62293938-62293960 CTCAGTATAAAGAAGAATCAGGG + Intergenic
1026455658 7:70570485-70570507 CTGAGTAAAGATGAGATTGAAGG - Intronic
1026477783 7:70751577-70751599 CTGAGTAAAGATGAAATTGAAGG - Intronic
1026600925 7:71776658-71776680 CTGAGAGCAGAGAAGAAAGATGG + Intergenic
1026658078 7:72274903-72274925 TTGTGTAAAGAGAAGAAATAGGG + Intronic
1026725934 7:72869928-72869950 CTGAGTCAAAAGAAAAACGAAGG - Intergenic
1027332857 7:77117653-77117675 ATAAGAAAACAGAAGAATGATGG + Intergenic
1027714757 7:81656015-81656037 GTGATTAAAGAAAAAAATGAAGG + Intergenic
1027727448 7:81825520-81825542 CTAAGCAAAAAGAAGAAAGATGG - Intergenic
1028278887 7:88895701-88895723 CTCAGTAAAGAAAACTATGAAGG + Intronic
1028292100 7:89077323-89077345 ATGAGGAAAGTGAAGAAAGAAGG + Intronic
1028556447 7:92131097-92131119 AAGAGGAAAGTGAAGAATGAAGG + Intronic
1029379606 7:100204544-100204566 CTGAGTAGAGAAGAGAATGCTGG + Intronic
1029782927 7:102753644-102753666 ATAAGAAAACAGAAGAATGATGG - Intronic
1030294866 7:107913236-107913258 CTGAATAAAAAGAAGAAAGCTGG - Intronic
1030501609 7:110366531-110366553 ATAAGTAAAGAGTAGAATAATGG + Intergenic
1030880121 7:114867472-114867494 ATGACAAAAGAGAAGAAGGAGGG - Intergenic
1031399639 7:121315869-121315891 CGGAGCAAAGAGCAGAAGGACGG - Intergenic
1032205254 7:129858656-129858678 CTGGGTAACAAGAAAAATGAAGG + Intronic
1032358062 7:131228544-131228566 CTGAGAAAGGATAAGAATTAGGG - Intronic
1032676279 7:134132743-134132765 CTGAGGAAAGAGAAGGGTGTGGG + Intronic
1032878693 7:136065704-136065726 ATAAATAAAGAGAAGAATGATGG + Intergenic
1032940760 7:136787732-136787754 CTGAGCAAAGAGAACAAAGCTGG - Intergenic
1033238319 7:139656084-139656106 AAGAGGAGAGAGAAGAATGATGG - Intronic
1033849082 7:145472466-145472488 CTGAGTAGACAGAAGACTGTGGG - Intergenic
1034212521 7:149376606-149376628 CTAAGAAAAGAAAAGAAGGAAGG - Intergenic
1035082296 7:156226907-156226929 CTGAGCCAGCAGAAGAATGAGGG + Intergenic
1035287725 7:157816867-157816889 CTGAGTAAAGAGAAAAGAGGAGG - Intronic
1035886456 8:3296380-3296402 CTGAGAGCAGAGAAGAATGGGGG + Intronic
1036427099 8:8654763-8654785 CTGAGAAAAGAGTAAAAGGAAGG - Intergenic
1036466990 8:9007711-9007733 CTAAGTAAAAAGAAGACTGGTGG - Intronic
1036558428 8:9881251-9881273 CTAAGCAAAAAGAAGAATGCTGG + Intergenic
1037799113 8:22022665-22022687 GGGAGTAGAGAGTAGAATGATGG + Intergenic
1037872219 8:22509220-22509242 GGGAATAAAGTGAAGAATGATGG - Intronic
1038071649 8:24021443-24021465 CTGAGGAACAAAAAGAATGAAGG + Intergenic
1038560766 8:28577355-28577377 TAGATTAAAGAGAAAAATGAAGG - Intergenic
1038595692 8:28883806-28883828 TTGAGTAAATACATGAATGATGG + Intronic
1038650334 8:29397130-29397152 CTGTGTAGAGAAGAGAATGAAGG - Intergenic
1040494634 8:47955640-47955662 CTGAGTTGTGAGGAGAATGAAGG - Intronic
1040956135 8:52981983-52982005 CTGAGCAAAGAGAAAAATGGAGG - Intergenic
1041660980 8:60400787-60400809 CTGAGTAAATAGGAGAATTGTGG + Intergenic
1041706293 8:60849729-60849751 CTGACTAAAGGGGAGAATGATGG + Intronic
1042023979 8:64403104-64403126 CTGAGTAAATAACAAAATGAAGG - Intergenic
1042037901 8:64557068-64557090 CTATGAAAAGAAAAGAATGAAGG + Intergenic
1042038267 8:64562240-64562262 CTAAGTAAAAAGAATAAAGATGG - Intergenic
1042634497 8:70858558-70858580 CTGAGCAAAAAGAACAATGCTGG + Intergenic
1043331926 8:79127893-79127915 CTCAATAAAGATAAGAATAATGG + Intergenic
1043725413 8:83604623-83604645 CTGGGTAAATAAAAAAATGAAGG + Intergenic
1044751095 8:95416036-95416058 CTGCTGAAAGAGAAGAAAGAAGG - Intergenic
1044892471 8:96851895-96851917 CTGAATAAAGAGAAGGAAGAGGG - Intronic
1045180424 8:99775579-99775601 CTGATTAAAGTGAATAGTGATGG - Intronic
1045592791 8:103617068-103617090 CTGAGTAAAAAGAACAAAGCTGG + Intronic
1045717977 8:105070800-105070822 CTAAGTAAAGAGTAGACTGTAGG + Intronic
1046050961 8:109022144-109022166 ATAAGTAAAAAGAAAAATGAAGG - Intergenic
1046796960 8:118383990-118384012 CTGAAGAAAAAGCAGAATGAAGG + Intronic
1046816490 8:118589922-118589944 CTTAGTAAAGTTAAAAATGATGG + Intronic
1047719423 8:127625772-127625794 CTGAGTGAAGAGATGAATTGTGG - Intergenic
1047845451 8:128800769-128800791 AAGAGTAAAGAGAGGAAAGAAGG - Intergenic
1047895469 8:129361679-129361701 CAGAGTTAAGAGAAAAATGTTGG + Intergenic
1047984713 8:130220848-130220870 ATGAGTAAAGTGCAGAGTGAAGG + Intronic
1048149540 8:131880941-131880963 CTGGGTAAATAGCAAAATGAAGG - Intergenic
1049480558 8:142820531-142820553 CTGAGGAGAGGGTAGAATGAGGG - Intergenic
1050181649 9:2929180-2929202 TTGAAAAAAGAGAAGAAGGAAGG + Intergenic
1050309857 9:4341540-4341562 CTGAGGACAGAAGAGAATGAGGG - Intronic
1050379597 9:5013062-5013084 GTGAAAAAAGAGAAGAATAAAGG + Intronic
1050699910 9:8327269-8327291 CTGGGTAAATAACAGAATGAAGG - Intronic
1050700611 9:8334440-8334462 CTGGGTAAATAACAGAATGAAGG + Intronic
1050821853 9:9889077-9889099 ATAAGTAGAGAGTAGAATGATGG + Intronic
1051592329 9:18788961-18788983 CTGAGTCAAGAATAGAATTAAGG + Intronic
1052549439 9:29929272-29929294 CAGAGTAAAGACAAAAGTGAAGG + Intergenic
1055087160 9:72326040-72326062 CTGAGCAAAGTCAAGAATGTAGG + Intergenic
1055133481 9:72802587-72802609 CTGAGTAAATAATGGAATGAAGG + Intronic
1055211309 9:73796556-73796578 ATTAGTGAGGAGAAGAATGATGG - Intergenic
1055217649 9:73886002-73886024 CTAAGCAAAAAGAAGAAAGATGG - Intergenic
1055376412 9:75653374-75653396 CTGAGCAAAGAAATGAATGAAGG + Intergenic
1055500811 9:76900769-76900791 CTGAGCAGTGAGAAGAATGAGGG - Intronic
1055976353 9:81958982-81959004 TTTGGTAAAGAGAAGAAAGAAGG + Intergenic
1056135396 9:83625057-83625079 CTGAGTGAGGGGAAGCATGATGG + Intronic
1058624655 9:106922390-106922412 CAAAGTAAATAGCAGAATGAAGG + Intronic
1058762416 9:108147815-108147837 CTGAGTAAAGAAAAAAACAAGGG + Intergenic
1058989732 9:110243231-110243253 CTGAGTAAGCAGGAAAATGATGG - Intergenic
1059011443 9:110466191-110466213 CTTAGTATAGAGAAGCATGGTGG - Intronic
1059132457 9:111767627-111767649 CTGAGCAAAAAGAAGAAAGCTGG - Intronic
1059292588 9:113239977-113239999 CTGAGTCGAGAGAAGAAATAAGG - Intronic
1059489337 9:114654377-114654399 CTCAGAAAAGAGAAGAATAAAGG - Intergenic
1059545412 9:115171033-115171055 CTGAGTTGACAGAAGAGTGAGGG + Intronic
1059560118 9:115326211-115326233 ATGAGTAATGAGAAAAAAGAAGG + Intronic
1059630338 9:116115095-116115117 TTGAGTACAGTGAAGATTGAGGG - Intergenic
1059766103 9:117385545-117385567 ATGAGTACAGACAAGAGTGAGGG + Intronic
1060313990 9:122491398-122491420 CTGAGGAAAAAGAAGAAGGAGGG + Intergenic
1061875703 9:133542561-133542583 GTGAATATGGAGAAGAATGAGGG - Intronic
1061981345 9:134105680-134105702 CTGAGCAAAGAGAACAAAGCTGG + Intergenic
1185953949 X:4468484-4468506 CTTGGTAGAGAGAAGAATCATGG + Intergenic
1185954035 X:4469461-4469483 CTGAGTAAAGATAAGGAAGAGGG - Intergenic
1186373826 X:8976343-8976365 CGAAGTAGAGAGTAGAATGATGG + Intergenic
1186387670 X:9126396-9126418 CTAACTAAAGACAAGGATGAAGG + Intronic
1186829646 X:13377944-13377966 CTGAGAATAAAGAAGAATAAAGG - Intergenic
1187305620 X:18092967-18092989 CTGAGCAAAAAGAAGAAAGCTGG - Intergenic
1187352006 X:18527766-18527788 CTTAGGAAAGAAAAGAAAGAAGG - Intronic
1187691790 X:21876066-21876088 CTGATCAAAGAGAATACTGAGGG + Intronic
1187705141 X:22002687-22002709 CTGAGTAAATAACAAAATGAAGG - Intergenic
1188400709 X:29740486-29740508 CTGAGTAACTAAGAGAATGATGG - Intronic
1188492402 X:30751372-30751394 CTGAGCAAAAAGAACAATGCTGG - Intergenic
1189186534 X:39060052-39060074 CTGAGGAAAGATAAGGATCAGGG - Intergenic
1189648708 X:43164556-43164578 CTTTGTAAAGAGAAAAATGAAGG + Intergenic
1190718748 X:53129010-53129032 CTGAGGTAAAAGAAGAAAGATGG - Intergenic
1190992950 X:55571218-55571240 CTGAGCAAAAAGAACAAAGATGG + Intergenic
1191084550 X:56550110-56550132 CTGAGTAAATAACAAAATGATGG + Intergenic
1191997567 X:67112800-67112822 TTGAGTAAAGAGAACAAGAAAGG + Intergenic
1192006661 X:67221255-67221277 CTGAGTAAAAAGAACAAAGCTGG + Intergenic
1192964462 X:76162223-76162245 CTGGGTAAATAGCAAAATGAAGG + Intergenic
1193674532 X:84433627-84433649 CTGAGTAAAAAGAACAATGCAGG - Intronic
1193728224 X:85068704-85068726 CTTAGAAAAAAGAAGAATCAGGG - Intronic
1193879086 X:86899690-86899712 CTGGGTAAATAGCAAAATGAAGG - Intergenic
1193970439 X:88044474-88044496 CTGAGTAAAAAGAACAAAGATGG + Intergenic
1194022328 X:88707245-88707267 CAGAGTCAAGAGAAGAAGAAGGG + Intergenic
1194675324 X:96787371-96787393 CTGAGTAAAGAAAAAAATCATGG + Intronic
1194980200 X:100432715-100432737 CTGAATAAAGATGGGAATGAGGG - Intergenic
1195247272 X:103005831-103005853 CTGAGTAGGGAGAATCATGAAGG - Intergenic
1195514398 X:105756681-105756703 CTGCAGAAAGAAAAGAATGAAGG - Intronic
1195539879 X:106051289-106051311 CTGAGTAAAGAGAACAAAACTGG + Intergenic
1195660683 X:107374939-107374961 CTCAGAGAAGAGAAGAATGGTGG - Intergenic
1195666951 X:107440439-107440461 CTGAGCAAACAGAAGAGGGAGGG + Intergenic
1195976080 X:110528545-110528567 CTGAGTAAAAAGAATAAAGCTGG + Intergenic
1196305071 X:114092405-114092427 CTGAGCAAAGAGAACAAAGCTGG + Intergenic
1196473367 X:116053917-116053939 CTAAGTAAAAAGAACAAAGAAGG - Intergenic
1196570169 X:117256816-117256838 TTGAGTAAAAAGATGAATGGTGG + Intergenic
1197176926 X:123495899-123495921 TTGATTCAAGATAAGAATGAGGG - Intergenic
1197718935 X:129731565-129731587 CAGAGTAAAGAGAGGAAGGAAGG + Intergenic
1198060143 X:133037616-133037638 CTGAGCAAAAAGAACAATGCTGG - Intronic
1198335548 X:135662755-135662777 CTGGGTAAATAGCAAAATGAAGG - Intergenic
1198698965 X:139375940-139375962 CTGAGTAAATAACAGAATTAAGG - Intergenic
1199386723 X:147231784-147231806 AGGAGTAGAGAGTAGAATGATGG + Intergenic
1200274381 X:154717943-154717965 TTGAGCACAGAGAAGGATGACGG + Intronic
1200295168 X:154912642-154912664 CTGAGCAAAGAGAACAAAGCTGG - Intronic
1200428526 Y:3048775-3048797 CTAAGTAAAGAGAACAAAGCTGG - Intergenic
1201705422 Y:16931237-16931259 CTGAGTAAATAACAAAATGAAGG + Intergenic
1202112640 Y:21439619-21439641 CTGAGCAAAAAGAACAATGCTGG - Intergenic