ID: 950383618

View in Genome Browser
Species Human (GRCh38)
Location 3:12638399-12638421
Sequence TGTTGACTGGCAGTCAGCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 118}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950383618 Original CRISPR TGTTGACTGGCAGTCAGCTA AGG Intronic
912634102 1:111275244-111275266 GGTTGCCTGGCTGTCAGCTGAGG + Intergenic
916660358 1:166917812-166917834 AGTTGACGGGCTGTCAGATAGGG + Exonic
916953643 1:169809017-169809039 TCTTCCCTGCCAGTCAGCTATGG + Intronic
922777941 1:228225839-228225861 TCTTGGCTGGCTGTCAGCCAGGG + Intronic
1068439077 10:57029073-57029095 TATTGACTGGCAGTCATTTTTGG - Intergenic
1071191734 10:83109030-83109052 TGTGCACTGGCAGTCAGAGAAGG - Intergenic
1072020246 10:91392117-91392139 TCCTGACTGGCAGTCAGCCAGGG + Intergenic
1072607422 10:96996479-96996501 GGTGGCCTGGCAGTCAGCTGTGG - Intergenic
1073596865 10:104809342-104809364 GGTTGGCTGGCTGTCAGCTGGGG + Intronic
1075527046 10:123195558-123195580 TGTTCACTGGGAATCAGCCAGGG - Intergenic
1084164335 11:67368007-67368029 TGAAGACTGGCAGGAAGCTAGGG - Intronic
1084282548 11:68107852-68107874 TATTGACTGGGAGTCAGCGTGGG - Intronic
1086046667 11:82541009-82541031 TGTTGACTGCCAGGCAACTATGG - Intergenic
1087824727 11:102752200-102752222 TGTTGACAGGCAGTAAGCACTGG - Intergenic
1202815235 11_KI270721v1_random:44011-44033 GGTTGACAGGCAGGGAGCTAAGG + Intergenic
1091515020 12:1170674-1170696 TCTTGACTGGCAGTGACCTTTGG + Intronic
1091633849 12:2182666-2182688 TGTGGACTGGAAGTGTGCTAGGG + Intronic
1091792707 12:3280870-3280892 GGTTGGGTGGCAGTCAGCTTGGG + Intronic
1091844244 12:3643205-3643227 TGTTTGCTGCCAGTCAGCAATGG + Intronic
1097614301 12:61865037-61865059 TGTTCACTGTCAGTCATCTATGG - Intronic
1100438829 12:94596738-94596760 TGTTGACTAGCAGCCAACTAGGG + Intronic
1109038907 13:57304736-57304758 TGTTGACTTGCAGGCAGTGATGG + Intergenic
1110469524 13:75843219-75843241 GGTTGGCTGGCTGTCAGCTGGGG + Intronic
1112858702 13:103803684-103803706 AGTTGACTGGCTGTCAGCTTTGG + Intergenic
1114812330 14:25915688-25915710 TGTTGACTGGGAGACAGTTTGGG - Intergenic
1115824117 14:37246222-37246244 TGTTGACTGGCAGTCTCGTTGGG + Intronic
1117279620 14:54225609-54225631 TGTTGTCTGGCAGCCAGTCAAGG + Intergenic
1119736223 14:76984536-76984558 TGTTGATTGAGAGTCAGCCAGGG - Intergenic
1128082367 15:64864255-64864277 TGTTCTCTGGCAGTCAGCTGTGG + Intronic
1128114101 15:65094659-65094681 TGTTGCCTGGCCCTCAGCTCAGG - Intronic
1132634614 16:937486-937508 TGTTGACTGACAGGCTGCTGGGG + Intronic
1133580613 16:7141147-7141169 TCTAGACTTGCAGTCAGCTGGGG + Intronic
1138162771 16:54771556-54771578 TATTAACTGGAAGTCTGCTATGG + Intergenic
1140687117 16:77444117-77444139 GGCTGACTGGAAGTCAGCCAGGG + Intergenic
1140842871 16:78857553-78857575 TCTTGACCGACAGTCAGCTTGGG - Intronic
1141164528 16:81651558-81651580 TGAAGACAGGTAGTCAGCTAGGG - Intronic
1142033586 16:87850479-87850501 TGGTGACTCGCAGTCACCGATGG - Intronic
1150384845 17:64750614-64750636 TGCTGAGTTGCAGTCAGATACGG + Intergenic
1152609397 17:81308202-81308224 GGTTGCCAGGCAGTGAGCTAGGG - Intergenic
1152681767 17:81672111-81672133 TGGGGCCTGGCAGTCAGCTCTGG - Exonic
1153833941 18:8947746-8947768 TCTTTACTGGCTGTCAGCCAGGG - Intergenic
1154121579 18:11656643-11656665 TGTTGATTGGGATGCAGCTAGGG - Intergenic
1157090637 18:44632647-44632669 TGTTGACAGGCTATCAGCTGAGG - Intergenic
1160001249 18:75026028-75026050 TGTTGTCTTGCAGGCAGCTTGGG + Intronic
1164089712 19:21937982-21938004 TGGTGTCTGGCAGCCAGGTAAGG + Intronic
1164442662 19:28291293-28291315 TGTTGACTGGCAGGGAGGGAGGG - Intergenic
1164967077 19:32494656-32494678 TCTTGGCTGGCTCTCAGCTAGGG + Intergenic
1165292114 19:34895056-34895078 TGTTGACTGTATGTTAGCTATGG - Intergenic
1168616152 19:57838660-57838682 TGGTGTGTGGCAGTCAGCTGGGG + Intronic
1168701744 19:58444044-58444066 TGTTGAGTGGAAGACAGCTGTGG + Intergenic
925895129 2:8465404-8465426 TGTTGTCTGGATCTCAGCTAAGG + Intergenic
927410197 2:22815965-22815987 TGCTGTCTGGCAGGCAGCTATGG - Intergenic
927621680 2:24667394-24667416 AGTTGACTGGCAGTTAGGTGAGG - Intronic
931011447 2:57919708-57919730 TCTTACCTGGCAGGCAGCTAGGG + Intronic
933850398 2:86361928-86361950 TGTTGACTGTCTGTGTGCTAAGG + Intergenic
934680138 2:96277824-96277846 TGCTGAGTTGCAGTCAGATACGG - Exonic
935096212 2:99946611-99946633 TGGTAACTGTCAGTCTGCTAGGG - Intronic
935585682 2:104798121-104798143 GCCTGACTGGCAGTCAGCGAGGG + Intergenic
938173655 2:129104666-129104688 GGTTGACTGACAGGCAGCTGAGG + Intergenic
940900975 2:159125900-159125922 TCTTTACTGGCTGTCAGCTGAGG + Intronic
945312780 2:208334291-208334313 TGTTAAGGGGCAATCAGCTAAGG + Intronic
946755703 2:222945131-222945153 TATTGACTGGCAGTCAAAGATGG - Intergenic
946896239 2:224327461-224327483 TCTTGAGGGGAAGTCAGCTAGGG - Intergenic
947809647 2:232996045-232996067 TGTTGACTGCCAGGAAGCTTAGG - Intronic
1168950921 20:1801582-1801604 AGTTGACTGGCTATCAGCTAGGG - Intergenic
1170913887 20:20603636-20603658 GGTTGACTGGCTGTCAGCAGGGG - Intronic
1172060454 20:32183807-32183829 TGGTGACTGGAAGTCAGATCAGG + Intergenic
1174940252 20:54919088-54919110 TGATGGCTGGCTGTCAGCTGGGG + Intergenic
1175249759 20:57602158-57602180 GGTTGAGTAGCAGTGAGCTAAGG + Intergenic
1179841965 21:44082342-44082364 TGTAGACTGGCAGACACCTGGGG + Intronic
1180150687 21:45945711-45945733 TGTTGGCTGGTTGTCAGCTGGGG - Intergenic
1184343577 22:43899514-43899536 TGTTGCCAGGCAGTCAGCATGGG + Intergenic
1184922087 22:47612975-47612997 TCCTTGCTGGCAGTCAGCTAGGG - Intergenic
950383618 3:12638399-12638421 TGTTGACTGGCAGTCAGCTAAGG + Intronic
950715469 3:14844611-14844633 TCTTGCCTGTCAGTCAGCTTTGG + Intronic
953090204 3:39717098-39717120 AGTTGAGTGACAGTCAGCAAGGG - Intergenic
953671870 3:44969727-44969749 TGTTGGCTGGTATTCAGCCAGGG - Intronic
954702372 3:52456869-52456891 GGCTGACTGGCCATCAGCTATGG + Intronic
954920587 3:54187560-54187582 TGGGGACTGGCAGTCAGGAAGGG + Intronic
959748118 3:109801335-109801357 TTTTATGTGGCAGTCAGCTATGG - Intergenic
961139133 3:124540856-124540878 GGTTGACTGGCATGCAGCTAGGG - Intronic
966231100 3:177653112-177653134 TTTTGACTGCCAGTCAGTCAAGG + Intergenic
967286409 3:187875132-187875154 TGTTGACTTCCTGTCAGCTCAGG + Intergenic
969241839 4:5904068-5904090 TGGTGACTGGAAGTCAGATCTGG - Intronic
970422879 4:15921508-15921530 TGTTGCCTGGCACACAGCCATGG - Intergenic
973578035 4:52312671-52312693 TGAGGATTGGCAATCAGCTATGG - Intergenic
976070479 4:81234531-81234553 TTTTGACAGGCAGTCAGGCAGGG - Intergenic
977801610 4:101240771-101240793 TGTTGACTTGGAGTCTTCTAAGG - Intronic
980548448 4:134301752-134301774 TATTGTCTGGCAGTGTGCTATGG - Intergenic
984114701 4:175665171-175665193 TGTTGACTAGTAGACACCTAAGG - Intronic
984445292 4:179828961-179828983 TGTTGTCTGCCAGTCAGATTAGG + Intergenic
984657426 4:182333973-182333995 GGTAAACTGCCAGTCAGCTACGG - Intronic
988662021 5:33280797-33280819 AGTGGACTGGGAGTCAGCTCTGG + Intergenic
988912290 5:35855565-35855587 TTTTGACTGGCATTCAGGTTTGG + Intronic
989150857 5:38298552-38298574 TGTTCACAGGCATTCAGATAGGG - Intronic
989222017 5:38977163-38977185 TCTTTACTGGCTGTCAGCTGGGG - Intronic
990682896 5:58265538-58265560 TGTGGACTGGGAGTCAGCGATGG + Intergenic
991934320 5:71786816-71786838 TGTTGAGATGCAGTCAGCCATGG - Intergenic
992072524 5:73161180-73161202 TTTTGTCAGGCAGTCAGCAAGGG - Intergenic
993541410 5:89157365-89157387 TGTTGAGAAGGAGTCAGCTATGG + Intergenic
996015194 5:118525883-118525905 TCCTTACTGGCTGTCAGCTAGGG - Intergenic
999214117 5:149917458-149917480 GGTTGACGGGCAATCAGCAATGG + Intronic
1003683397 6:8277860-8277882 TGTTGCCTGGCAGTCCCCTGCGG + Intergenic
1004741268 6:18463601-18463623 TGTTGACTGCCTGGCAGCTCTGG - Intronic
1005702267 6:28413873-28413895 TGTTACTTGGCAGTCAGCCATGG - Intergenic
1005911836 6:30317475-30317497 TGGGGACTGGCAGACAGGTAAGG - Intergenic
1011239900 6:85259874-85259896 TGTTGTCTGGCAGGGAGGTAGGG + Intergenic
1019848247 7:3528024-3528046 TGTTGGATGATAGTCAGCTAGGG + Intronic
1019848276 7:3528150-3528172 GGTTGGATGACAGTCAGCTAGGG + Intronic
1020756726 7:12211917-12211939 TGTTGACTTTCAGTAAACTAAGG + Intronic
1021604952 7:22400724-22400746 GGTTGAGTGGCTGTCAGCTAGGG - Intergenic
1024358168 7:48439290-48439312 TTTTGGCTGGCTGTCAGCTGGGG + Intronic
1028454682 7:91026096-91026118 TGTTGACAGGCAGTCTTCTAAGG + Intronic
1034449080 7:151127878-151127900 TGTTTACTGGGTGTCAGCTGTGG + Intronic
1035623351 8:1051850-1051872 AGTCGACTGGGAGTCTGCTACGG + Intergenic
1036397443 8:8381339-8381361 TGGTGACTGGCTGGCAGCCAGGG - Intronic
1036423961 8:8626014-8626036 TGTTGGCTGGCTGCCAGCTGGGG - Intergenic
1037355067 8:18010115-18010137 TGTTGACTGGGAGTGACCTCTGG - Intronic
1041907637 8:63051195-63051217 TGTTGAGTGCCAGTCAGTTATGG + Intronic
1044655482 8:94543837-94543859 TATTGTCTGGCAGACTGCTATGG + Exonic
1045015660 8:97999571-97999593 TGTTTCCTGGCACTCAGTTATGG + Intronic
1048011026 8:130456472-130456494 TGATGAGTGCCAGTCAGCTGAGG + Intergenic
1051524961 9:18032574-18032596 TGCTGGCTGGCAGTCAGCAGGGG + Intergenic
1058459731 9:105171924-105171946 GGTTGAATGGCGGTCAGCTGGGG + Intergenic
1060260370 9:122069346-122069368 TGTTCACTGCTAGTCAGCCAGGG + Intronic
1187124729 X:16444646-16444668 AGTTGGCTGGCTGTCAGCTGAGG + Intergenic
1187469080 X:19552461-19552483 TGCTGACTGGCAGCCAGTGAAGG + Intronic
1189947340 X:46192701-46192723 TGATGTCTGAAAGTCAGCTAAGG + Intergenic
1191593419 X:62914641-62914663 TATAGACTGGCATTCACCTAAGG + Intergenic
1192550587 X:72050243-72050265 TTTTGACTGACAGCCAGCAAAGG + Intergenic
1193204521 X:78732347-78732369 TGTTGACTGGTAGTTTGCTGAGG + Intergenic
1198403667 X:136291407-136291429 TGTTATCTGCCAGTGAGCTAAGG - Intergenic