ID: 950390632

View in Genome Browser
Species Human (GRCh38)
Location 3:12693894-12693916
Sequence CACCTTAGGAATCCTGCATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950390632_950390637 -9 Left 950390632 3:12693894-12693916 CCTGATGCAGGATTCCTAAGGTG No data
Right 950390637 3:12693908-12693930 CCTAAGGTGGAGGGAGAAGCAGG No data
950390632_950390644 29 Left 950390632 3:12693894-12693916 CCTGATGCAGGATTCCTAAGGTG No data
Right 950390644 3:12693946-12693968 GCCTCCTGAGAAGTTGGTGGGGG No data
950390632_950390638 -5 Left 950390632 3:12693894-12693916 CCTGATGCAGGATTCCTAAGGTG No data
Right 950390638 3:12693912-12693934 AGGTGGAGGGAGAAGCAGGCTGG No data
950390632_950390639 23 Left 950390632 3:12693894-12693916 CCTGATGCAGGATTCCTAAGGTG No data
Right 950390639 3:12693940-12693962 AGCTCCGCCTCCTGAGAAGTTGG No data
950390632_950390643 28 Left 950390632 3:12693894-12693916 CCTGATGCAGGATTCCTAAGGTG No data
Right 950390643 3:12693945-12693967 CGCCTCCTGAGAAGTTGGTGGGG No data
950390632_950390640 26 Left 950390632 3:12693894-12693916 CCTGATGCAGGATTCCTAAGGTG No data
Right 950390640 3:12693943-12693965 TCCGCCTCCTGAGAAGTTGGTGG No data
950390632_950390642 27 Left 950390632 3:12693894-12693916 CCTGATGCAGGATTCCTAAGGTG No data
Right 950390642 3:12693944-12693966 CCGCCTCCTGAGAAGTTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950390632 Original CRISPR CACCTTAGGAATCCTGCATC AGG (reversed) Intergenic
No off target data available for this crispr