ID: 950396456

View in Genome Browser
Species Human (GRCh38)
Location 3:12737746-12737768
Sequence CTCTTGTTCTTAAGGAGAAG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 194}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950396456_950396459 9 Left 950396456 3:12737746-12737768 CCACTTCTCCTTAAGAACAAGAG 0: 1
1: 0
2: 0
3: 33
4: 194
Right 950396459 3:12737778-12737800 TATTTAACTTTGATGCAGGACGG 0: 1
1: 0
2: 2
3: 13
4: 281
950396456_950396458 5 Left 950396456 3:12737746-12737768 CCACTTCTCCTTAAGAACAAGAG 0: 1
1: 0
2: 0
3: 33
4: 194
Right 950396458 3:12737774-12737796 TGAATATTTAACTTTGATGCAGG 0: 1
1: 0
2: 0
3: 16
4: 216
950396456_950396461 13 Left 950396456 3:12737746-12737768 CCACTTCTCCTTAAGAACAAGAG 0: 1
1: 0
2: 0
3: 33
4: 194
Right 950396461 3:12737782-12737804 TAACTTTGATGCAGGACGGGAGG 0: 1
1: 0
2: 0
3: 1
4: 68
950396456_950396460 10 Left 950396456 3:12737746-12737768 CCACTTCTCCTTAAGAACAAGAG 0: 1
1: 0
2: 0
3: 33
4: 194
Right 950396460 3:12737779-12737801 ATTTAACTTTGATGCAGGACGGG 0: 1
1: 0
2: 0
3: 17
4: 149
950396456_950396462 16 Left 950396456 3:12737746-12737768 CCACTTCTCCTTAAGAACAAGAG 0: 1
1: 0
2: 0
3: 33
4: 194
Right 950396462 3:12737785-12737807 CTTTGATGCAGGACGGGAGGTGG 0: 1
1: 0
2: 1
3: 8
4: 165
950396456_950396463 17 Left 950396456 3:12737746-12737768 CCACTTCTCCTTAAGAACAAGAG 0: 1
1: 0
2: 0
3: 33
4: 194
Right 950396463 3:12737786-12737808 TTTGATGCAGGACGGGAGGTGGG 0: 1
1: 0
2: 0
3: 14
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950396456 Original CRISPR CTCTTGTTCTTAAGGAGAAG TGG (reversed) Exonic
900295480 1:1947047-1947069 CTCTGGTTCTGGAAGAGAAGGGG + Exonic
900545518 1:3226885-3226907 GTCTTGGTCTTAAAGAGAACGGG - Intronic
900775829 1:4584885-4584907 CTCTTGTTTTGAAGGAAAACAGG + Intergenic
901099573 1:6708996-6709018 CTCTCTTTTTTAAGGAGATGGGG + Intergenic
901242300 1:7702625-7702647 TTCTTGTTCTCAAGGAGATGAGG + Intronic
901589698 1:10330662-10330684 CTCTTATCTTTAAGTAGAAGTGG - Intronic
902139211 1:14338165-14338187 CACATGTTCTTAACCAGAAGGGG - Intergenic
902739033 1:18421600-18421622 CTCTTTTTCTTAGGGGAAAGGGG - Intergenic
903434701 1:23338406-23338428 CTTTTTTTCCTATGGAGAAGTGG - Intronic
903886454 1:26543633-26543655 CCCTAGTACTGAAGGAGAAGGGG + Intronic
905789300 1:40782029-40782051 CTCTTGTTCTGTAGCAGAAATGG - Intergenic
906034333 1:42741123-42741145 CTCTTGGTCTTCAGGAGTAGGGG + Intergenic
906045344 1:42825817-42825839 TTCTTGTGCGTAAGGAGAAAGGG - Intronic
906048214 1:42849154-42849176 CTCTGGTTCTTAAAGAGTTGAGG + Intronic
908110914 1:60896387-60896409 CTCTTTTTCATATAGAGAAGTGG - Intronic
910538347 1:88325668-88325690 CTAATGTTTTTAAGGATAAGAGG + Intergenic
911125975 1:94341232-94341254 CTCTGGTACCTTAGGAGAAGGGG - Intergenic
911975518 1:104489471-104489493 CTCCTTTTCTCAAGCAGAAGGGG - Intergenic
912011851 1:104976627-104976649 CTGTTGTACTTAAGAAGCAGGGG - Intergenic
916155743 1:161845240-161845262 CTGTGGTTCTAAAGGAAAAGCGG - Intronic
916321818 1:163512951-163512973 CTCTTTTTTTCAAGCAGAAGGGG - Intergenic
916614030 1:166421359-166421381 CTCTTCTTCTCAAATAGAAGGGG + Intergenic
916869459 1:168896940-168896962 CTGTGGTTCTTAAGGAAAAGTGG - Intergenic
917191364 1:172422581-172422603 CTGTTCTTCTCAAGCAGAAGTGG - Intronic
917825212 1:178812783-178812805 CCCATGTTCTTAAGGAAAATAGG - Intronic
919256626 1:195133426-195133448 CTTATGTTTTTAAGGAGAACAGG + Intergenic
919676443 1:200388160-200388182 CACTTCCTCTTAATGAGAAGGGG - Intergenic
919900687 1:202042309-202042331 CTATTGTTATTACTGAGAAGAGG + Intergenic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
921897832 1:220419620-220419642 CTCTCATTCTTATGTAGAAGTGG + Intergenic
923858299 1:237867936-237867958 CTTTTGTCCTCAAGGAGGAGTGG - Intergenic
1064287038 10:14000686-14000708 ATCGTGTTCTCAAGGAGAAAGGG - Intronic
1064847231 10:19668762-19668784 CTCTTTTTTTGGAGGAGAAGGGG - Intronic
1066783920 10:38980860-38980882 TTCTTGTTCTAAAAGAGAGGTGG + Intergenic
1068318154 10:55374258-55374280 CTTTTGTTTTTCAGCAGAAGAGG + Intronic
1068459411 10:57307343-57307365 CTCTTATTCTTTTGGTGAAGTGG + Intergenic
1073056669 10:100707522-100707544 CTTTAGATCTTAAGGAGCAGTGG - Intergenic
1075150557 10:119926070-119926092 CTCTTGTCCTTTTGTAGAAGTGG - Exonic
1075584826 10:123650106-123650128 CTCTAGTGCTTCAGGTGAAGGGG - Intergenic
1076370618 10:129950393-129950415 GTGTTGTTTTTAAGGGGAAGGGG + Intronic
1080957818 11:37121242-37121264 CTCATTTTCTTAAGGACAAAGGG - Intergenic
1081071896 11:38621070-38621092 CTTTTGTTTATAAGTAGAAGGGG + Intergenic
1081919946 11:46765293-46765315 ATCATATTCTTAAGGAGAAGTGG - Intronic
1086432466 11:86748751-86748773 CTATTCTTCGTAAGCAGAAGGGG + Intergenic
1088092154 11:106055001-106055023 ATATAGTTCTTTAGGAGAAGGGG + Intronic
1088775462 11:113078284-113078306 CTCGTGTCCTTAAAGAAAAGGGG - Intronic
1089110189 11:116049428-116049450 CTTTTTTCCTGAAGGAGAAGGGG - Intergenic
1089158668 11:116421513-116421535 CTCTTGTTGGGAAGGGGAAGGGG + Intergenic
1089442079 11:118525794-118525816 TTTTTGTTTTTAAGGAAAAGCGG + Exonic
1089625147 11:119746323-119746345 CTCCTGTTCTTTAGAAGAAAGGG + Intergenic
1089997707 11:122924720-122924742 TGATTGTTCTTAAGGAGAATGGG - Intronic
1091426016 12:389874-389896 CACTTGTTTTGATGGAGAAGAGG - Intronic
1093135505 12:15445126-15445148 CTCTTGTTCTTTAATAAAAGTGG - Intronic
1094087729 12:26612062-26612084 CTCTTATAAATAAGGAGAAGGGG - Intronic
1094452440 12:30596961-30596983 ATCTTGTTCAGAAGGAGAAGAGG - Intergenic
1095155138 12:38843686-38843708 GTCTTGTCCTTATGGAGGAGGGG - Intronic
1098383676 12:69896377-69896399 CTCTTGTTCTCTAAGAGAATAGG + Intronic
1098444796 12:70555464-70555486 CTGTTTTCCTTCAGGAGAAGGGG - Intronic
1099142969 12:79002750-79002772 CTATTGTTGTTAAGGAGATGAGG + Intronic
1099576409 12:84389437-84389459 TTCTTGTTCTTAGGGTGGAGTGG + Intergenic
1101393820 12:104326112-104326134 CTCTTTTTCCTAATCAGAAGTGG + Intronic
1102569674 12:113819779-113819801 CTCTTCTTCCTTTGGAGAAGAGG - Intronic
1103824689 12:123728257-123728279 CTTTTTTTCTTAAGGAGATGGGG + Intronic
1104389631 12:128380736-128380758 CTCTTTTTTTTAAAGAGATGGGG - Intronic
1106236911 13:27870272-27870294 CTCTTTTTTTTAAAGAGATGGGG + Intergenic
1108368971 13:49747992-49748014 CTCTGAATCTTAAGGAGAAAGGG + Intronic
1110739358 13:78976626-78976648 CTCTTCTGCTCAAGGATAAGTGG - Intergenic
1111968189 13:94882216-94882238 GTCATGTTCTAAAGGAGAAAAGG - Intergenic
1112180146 13:97070216-97070238 TGCTTGTTCTAAAGGAGACGTGG + Intergenic
1112658245 13:101475461-101475483 CTATTTGTCTTAAGGAGAAGGGG + Intronic
1112945993 13:104927764-104927786 CCATTGATCTTAAAGAGAAGAGG + Intergenic
1113375051 13:109757527-109757549 CTCGAGTTCATAAGGAGATGTGG - Intronic
1114764483 14:25355611-25355633 CTCTTGTTGTCAGGAAGAAGTGG - Intergenic
1115705178 14:35990906-35990928 GTCTTGTTCTGAGAGAGAAGGGG + Intergenic
1116338318 14:43688295-43688317 CTCTTGTAGTTAAGGAGAATGGG + Intergenic
1117307498 14:54490575-54490597 TCCTTATTCTTAAGGAGAAAGGG + Intergenic
1117866740 14:60157906-60157928 ACCTTTTTCTTAAGGACAAGTGG - Intronic
1118113875 14:62752301-62752323 CTCCTCTTCTCAAGCAGAAGGGG - Intronic
1120100120 14:80435220-80435242 CTCTTTTCCCTAAGCAGAAGGGG - Intergenic
1127145389 15:56018185-56018207 CTCTTGCTCTTCAGGAGAGAAGG - Intergenic
1127310335 15:57746566-57746588 CTATTGCTTTTAAGTAGAAGGGG + Intronic
1129358607 15:75010392-75010414 GTCTTGGTTTTAAGGAGTAGGGG - Intronic
1135715611 16:24763466-24763488 CTCTGTTTATTAATGAGAAGGGG - Intronic
1138920215 16:61518482-61518504 CTTTGGCTCTTAAAGAGAAGAGG + Intergenic
1140795906 16:78437572-78437594 CTCTGGATCTGAAGAAGAAGAGG - Intronic
1144511642 17:15882071-15882093 TTCGTGTCCTTAAGGAAAAGGGG + Intergenic
1144663396 17:17086173-17086195 CTTGTGTTCACAAGGAGAAGCGG + Intronic
1146105537 17:30032477-30032499 CTCTTTTTCTTCTGGAGAATAGG + Intronic
1146505117 17:33398185-33398207 CTTTTGTTCTAATGTAGAAGGGG - Intronic
1146701028 17:34960581-34960603 TTTCTGTTCTTAAGGAGATGTGG - Intronic
1147243432 17:39105615-39105637 CTCTGGTTGTTAAGGTGAAAGGG - Intronic
1147752703 17:42745948-42745970 CTCTTCTTTTTAAGGAGACAGGG + Intergenic
1149025480 17:52022528-52022550 TTCTAGTTATTAAGGAGAATAGG - Intronic
1151781946 17:76252559-76252581 CTGTGTTTCTGAAGGAGAAGGGG + Intergenic
1152171379 17:78751384-78751406 CTATTGTTCCTAAGTACAAGAGG - Intronic
1153692473 18:7607412-7607434 CTCTCCTACTTAAGGAGAGGAGG + Intronic
1153786392 18:8538813-8538835 GTTTTGTTATTAAGGAGAAAGGG - Intergenic
1154381116 18:13850783-13850805 TTCATGTTCTTACTGAGAAGTGG + Intergenic
1155282023 18:24250003-24250025 TCCTTCTGCTTAAGGAGAAGAGG + Intronic
1156248120 18:35322918-35322940 TCCTTATTCTTAAGGAGAAGGGG - Intergenic
1156987099 18:43361406-43361428 TCCTTATTCTTAAGGAGAAGGGG - Intergenic
1162866199 19:13549059-13549081 CTCTTATTTTTCAAGAGAAGTGG + Intronic
1164405214 19:27938154-27938176 TCCTTGTTCTAAAAGAGAAGTGG + Intergenic
1164691682 19:30215545-30215567 CTATTGCTCTAAAAGAGAAGGGG - Intergenic
1168003900 19:53470191-53470213 CTCTTGTTCTAAAGGGGAGGAGG + Intronic
1168128886 19:54304542-54304564 CTCTTATTGTGAAGGACAAGTGG - Intergenic
1168128891 19:54304574-54304596 CTCTTATTCTGTAGGACAAGTGG - Intergenic
925522534 2:4763037-4763059 CTTTTTTTCTCAAGGAGAAAAGG + Intergenic
928015520 2:27653371-27653393 CTCCTGTTCTTAAACACAAGTGG - Exonic
928214989 2:29353974-29353996 CTCTTGTGCTTAAGGACCAAAGG - Intronic
928877302 2:36054989-36055011 TTCCTGTTCTTAAAGAGCAGAGG - Intergenic
928932329 2:36637241-36637263 CTCCTTTCCTTAAGCAGAAGGGG - Intronic
929178899 2:39011432-39011454 CTTTTGGTCTAAAGGAGGAGAGG + Intronic
930817673 2:55616271-55616293 CTTTTGTTCTTAATGAGGAAAGG - Intronic
931633145 2:64319401-64319423 TTCTTGTTCTTAGGAAGCAGAGG + Intergenic
933914610 2:86976590-86976612 TTCTTGTTCTTCAGGAAAAACGG - Exonic
934008383 2:87793309-87793331 TTCTTGTTCTTCAGGAAAAACGG + Exonic
934086972 2:88517887-88517909 GTTTTGTTCTTCAGGTGAAGGGG + Intergenic
935511116 2:103975284-103975306 CTCATGTTTTTAAAGAGAATTGG + Intergenic
935772030 2:106434315-106434337 TTCTTGTTCTTCAGGAGAAAGGG + Exonic
935908039 2:107861631-107861653 TTCTTGTTCTTCAGGAGAAAGGG - Exonic
935982275 2:108639074-108639096 CTGGTGTTCTTAAGGAGATGAGG + Intronic
935994447 2:108753862-108753884 TTCTTGTTCTTCAGGAGAAAGGG - Exonic
936129830 2:109826738-109826760 TTCTTGTTCTTCAGGAGAAAGGG - Exonic
936214867 2:110544747-110544769 TTCTTGTTCTTCAGGAGAAAGGG + Exonic
936424004 2:112399310-112399332 TTCTTGTTCTTCAGGAGAAAGGG + Exonic
937815248 2:126243999-126244021 CTCTTGGTCTGAAGGAGAATGGG - Intergenic
939557013 2:143687164-143687186 CTATTTTTCTTAAAGAAAAGAGG + Intronic
939900798 2:147846847-147846869 CTCTTGCCCTTGAGGAGGAGGGG + Intronic
942320097 2:174729215-174729237 CAATTCTTCTTAAGGAAAAGTGG + Intergenic
943356944 2:186867680-186867702 CTCTTCTTCTTAAGGTCAATCGG + Intergenic
946599297 2:221342006-221342028 CTCATGTTCTTACGTAGATGTGG + Intergenic
1169091568 20:2864215-2864237 CTCTTCATCTTTAGGAGAAGGGG - Exonic
1169359528 20:4936458-4936480 CTTTTTTTCTTAAAGAGAGGGGG + Intronic
1170364047 20:15580792-15580814 CTCTTCTTCTTAGGGGAAAGGGG + Intronic
1170559818 20:17547288-17547310 TTCTTATTCTTAAGGAGACAGGG + Intronic
1172303263 20:33864321-33864343 CCCTTGCTCTCAAGGACAAGCGG - Intergenic
1173086769 20:39927247-39927269 CTCTTATTCTTTATAAGAAGTGG - Intergenic
1173379570 20:42527572-42527594 TTTTTCTTCTTATGGAGAAGGGG + Intronic
1176273802 20:64251997-64252019 TTCCTGATCTTAAGGAGAAAGGG + Intergenic
1176658180 21:9607273-9607295 CTCTGGGACTTGAGGAGAAGTGG - Intergenic
1180728717 22:17965119-17965141 CTCTTCTTTTTAAATAGAAGGGG - Intronic
1184305888 22:43601687-43601709 TTCTTGTCCTCAAGGGGAAGGGG + Intronic
949869466 3:8575546-8575568 CTCTTGTTCTAAAGGAGTGACGG + Intergenic
950396456 3:12737746-12737768 CTCTTGTTCTTAAGGAGAAGTGG - Exonic
952294711 3:32051069-32051091 CTCTTGTTTTTCTGGAAAAGAGG + Intronic
955543217 3:60000096-60000118 TTCTTGTTCATAAGCAGTAGTGG + Intronic
961093573 3:124136417-124136439 CTCTCGTTCTAAAGGATCAGGGG - Intronic
962085531 3:132187633-132187655 CTCTTATTATTAATGAAAAGGGG + Intronic
963365989 3:144335142-144335164 CTACTGTTCTTCTGGAGAAGTGG + Intergenic
964083586 3:152789527-152789549 TCCTTTTTCTTAAGGAGAAGGGG - Intergenic
964140772 3:153396697-153396719 CTCCTTTTCTCAAGCAGAAGGGG + Intergenic
965448742 3:168809897-168809919 ATCTTGTTCTTCAGGAGCAATGG + Intergenic
965792433 3:172404180-172404202 TTGTTGTTTTTATGGAGAAGTGG - Intergenic
966401072 3:179547225-179547247 CTGTGGTTCTTAAAGAGTAGAGG - Intergenic
969226709 4:5803333-5803355 CTCAAGTTCTTCAGGAGAAGGGG - Intronic
974812493 4:66962866-66962888 CCATTGTTCCTAAGGAGAATAGG + Intergenic
975190887 4:71460727-71460749 CTGATATTCTGAAGGAGAAGGGG + Intronic
976571279 4:86614028-86614050 CTATTGTTTTTAAGGGTAAGGGG + Intronic
979087836 4:116436331-116436353 CTTTTGTTCTGAAGGAGAAATGG + Intergenic
982297909 4:153848784-153848806 CTCCTGCTCTCAAGGAGAATAGG - Intergenic
982900189 4:160989150-160989172 CTGTTTATCATAAGGAGAAGAGG + Intergenic
983558809 4:169081478-169081500 CTCTTTGCCTTAAGGAAAAGGGG - Intergenic
985096326 4:186416334-186416356 CTCCTGTTTTTGAGGAGAAAAGG + Intergenic
985375990 4:189339069-189339091 TCCTTTTTCTTAAGAAGAAGAGG - Intergenic
985417230 4:189748801-189748823 CTCTGGGACTTGAGGAGAAGTGG + Intergenic
989309715 5:40000581-40000603 CTCTTATTCTTTAAGAGAAGTGG + Intergenic
990777296 5:59316570-59316592 CACATGTTCAGAAGGAGAAGTGG + Intronic
990862823 5:60346842-60346864 ATTTTGTTCTTAAGGGGAACTGG - Intronic
991134482 5:63165344-63165366 CTCTGGTCCTTGGGGAGAAGTGG + Intergenic
992470920 5:77052449-77052471 CTCTAGTACCAAAGGAGAAGAGG + Intronic
993323293 5:86502470-86502492 CTCTTGTTCTACATCAGAAGTGG - Intergenic
994310851 5:98268454-98268476 CCCTTTTTCTTAAGCAGAAAGGG - Intergenic
995399014 5:111719589-111719611 TCCTTGTTCTTATGGTGAAGTGG - Intronic
997156103 5:131559821-131559843 CTTTTTTTCTTAAAGAAAAGGGG - Intronic
998637198 5:143968935-143968957 CTGTTTTTCCTGAGGAGAAGTGG + Intergenic
1001143725 5:169166271-169166293 CACATGTTCTTAATGAGAAAAGG + Intronic
1001817368 5:174681210-174681232 AACTTATTCTTAAGGAGAATGGG - Intergenic
1004049071 6:12056317-12056339 ATGATGTTCTTAAGGAAAAGTGG + Intronic
1005836813 6:29716027-29716049 CTCTGGTTTTTAATGAGACGTGG - Intergenic
1006625348 6:35393569-35393591 CCCATGTTCTTACTGAGAAGTGG + Intronic
1008099946 6:47379718-47379740 CTATTGTTCTCAGGCAGAAGAGG - Intergenic
1010596537 6:77769949-77769971 CTCCTTTTCTCAAGCAGAAGTGG - Intronic
1012190775 6:96277145-96277167 CTCTTTTTCTCAAGCAGAAGGGG - Intergenic
1013692785 6:112666288-112666310 GTCTTGTTCTGAAGCAGAAGTGG + Intergenic
1014073934 6:117215399-117215421 CTCATTTTCTCAAGCAGAAGGGG + Intergenic
1014787899 6:125638971-125638993 CTCTGGTTCTTAAGAAGTAGAGG - Intergenic
1014827440 6:126062303-126062325 ATTTTGTTCTTAAGGCGTAGAGG + Intergenic
1015209790 6:130683945-130683967 CTCTTGTTTTGAAGAAGCAGTGG - Intergenic
1015403272 6:132810897-132810919 GTCTTGTTCTGAAGTGGAAGGGG - Intergenic
1015754331 6:136592489-136592511 CTCTTGTTTTGAAAGAGAAGGGG + Exonic
1017243447 6:152196327-152196349 CTCTTTTTTGTAAGCAGAAGAGG + Intronic
1017854422 6:158337731-158337753 CTCTTGGTCTTTAGGAGTATTGG - Intronic
1019069262 6:169328620-169328642 CTCTTGTTTTCCAGGAGAAGGGG - Intergenic
1020239740 7:6384429-6384451 CTCTTCTTGTTAAGGACATGGGG - Intronic
1020361762 7:7334355-7334377 TTCTTATTCTTAAACAGAAGAGG + Intergenic
1021840237 7:24716534-24716556 CTCATGTTCCCAATGAGAAGAGG - Intronic
1022250699 7:28605033-28605055 CTCTTTTTTTTAATGAGAAAGGG - Intronic
1023557561 7:41439046-41439068 TTCTTCTTCAGAAGGAGAAGCGG + Intergenic
1028181542 7:87730467-87730489 CTCTTCTGCTTGAGGAAAAGGGG + Intronic
1033416327 7:141164727-141164749 CTCTTTTTCATAAGAAAAAGAGG + Intronic
1033889948 7:145999835-145999857 CACTTGTTCTTATAGATAAGGGG + Intergenic
1038369715 8:26976398-26976420 CACATGTTCTTATGGATAAGTGG + Intergenic
1042732670 8:71954599-71954621 CTCTTGTGCTGAAAGAGTAGAGG + Intronic
1043567331 8:81562369-81562391 CTCTTTTTCTCAAGCAGAAGGGG - Intergenic
1044264634 8:90167134-90167156 CTCATGTTCTAAAGGAGAGAAGG - Intergenic
1048273734 8:133049981-133050003 TTCTTGTTCTTACAGTGAAGGGG - Exonic
1050972776 9:11897797-11897819 CACTTGTTCTCAAGCATAAGTGG + Intergenic
1051376529 9:16408013-16408035 TTTTTTTTCCTAAGGAGAAGGGG + Intergenic
1051936689 9:22451052-22451074 CTCTTTTTGTTCTGGAGAAGAGG - Exonic
1053390430 9:37731213-37731235 CTCTTTATCTGAAGGAGAATGGG + Intronic
1056316735 9:85397548-85397570 CTCTTTTTCTTGAGGGGAAAGGG - Intergenic
1056615532 9:88162277-88162299 TTTTTGTTTTTAAAGAGAAGAGG + Intergenic
1056812785 9:89777218-89777240 CTCTTATTCTTAAGTATTAGTGG - Intergenic
1058265501 9:102894135-102894157 CTCTTTATATTAAGGGGAAGAGG + Intergenic
1058550392 9:106108596-106108618 ATCTTTTTCTCAAGGAAAAGTGG - Intergenic
1060088463 9:120722023-120722045 CATTTGCTCTTAGGGAGAAGAGG - Intergenic
1060909765 9:127340318-127340340 CTCTTGTGCTTTAAGAGATGTGG - Intronic
1203635909 Un_KI270750v1:110848-110870 CTCTGGGACTTGAGGAGAAGTGG - Intergenic
1186608880 X:11119302-11119324 CTCTTTTTCTCAAGGAGAATAGG + Intronic
1186790542 X:12993462-12993484 CTTCTATTTTTAAGGAGAAGTGG - Intergenic
1190603668 X:52118537-52118559 CTTTTGTTATTTAGGAGAACTGG - Intergenic
1190887028 X:54539420-54539442 CCCTGTTTCTTATGGAGAAGAGG + Intronic
1191611560 X:63120789-63120811 CTCTTGTTCTCACTTAGAAGTGG + Intergenic
1192078135 X:68021068-68021090 CTCTGGTTCTTAAGCACCAGTGG + Intergenic
1192406012 X:70887180-70887202 CTGCTTTTCTTAAGCAGAAGGGG - Intronic
1195199354 X:102532885-102532907 CTCTTTTTCTCAAACAGAAGGGG - Intergenic
1196096762 X:111808694-111808716 CTCCTTTTCTCAAGCAGAAGGGG + Intronic