ID: 950397977

View in Genome Browser
Species Human (GRCh38)
Location 3:12748828-12748850
Sequence GTCCCTGGGGTGGGAAGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 708
Summary {0: 1, 1: 0, 2: 4, 3: 84, 4: 619}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950397977_950397991 6 Left 950397977 3:12748828-12748850 CCCACCCTTCCCACCCCAGGGAC 0: 1
1: 0
2: 4
3: 84
4: 619
Right 950397991 3:12748857-12748879 GTCCTCTCCAGGGTTCTACTTGG 0: 1
1: 0
2: 0
3: 11
4: 135
950397977_950397986 -5 Left 950397977 3:12748828-12748850 CCCACCCTTCCCACCCCAGGGAC 0: 1
1: 0
2: 4
3: 84
4: 619
Right 950397986 3:12748846-12748868 GGGACCACCCAGTCCTCTCCAGG 0: 1
1: 0
2: 0
3: 24
4: 166
950397977_950397996 25 Left 950397977 3:12748828-12748850 CCCACCCTTCCCACCCCAGGGAC 0: 1
1: 0
2: 4
3: 84
4: 619
Right 950397996 3:12748876-12748898 TTGGATTTGGAGAGCCAGGAAGG 0: 1
1: 0
2: 0
3: 34
4: 342
950397977_950397987 -4 Left 950397977 3:12748828-12748850 CCCACCCTTCCCACCCCAGGGAC 0: 1
1: 0
2: 4
3: 84
4: 619
Right 950397987 3:12748847-12748869 GGACCACCCAGTCCTCTCCAGGG 0: 1
1: 0
2: 0
3: 20
4: 177
950397977_950397997 30 Left 950397977 3:12748828-12748850 CCCACCCTTCCCACCCCAGGGAC 0: 1
1: 0
2: 4
3: 84
4: 619
Right 950397997 3:12748881-12748903 TTTGGAGAGCCAGGAAGGACTGG 0: 1
1: 1
2: 2
3: 31
4: 333
950397977_950397995 21 Left 950397977 3:12748828-12748850 CCCACCCTTCCCACCCCAGGGAC 0: 1
1: 0
2: 4
3: 84
4: 619
Right 950397995 3:12748872-12748894 CTACTTGGATTTGGAGAGCCAGG 0: 1
1: 0
2: 0
3: 8
4: 127
950397977_950397993 12 Left 950397977 3:12748828-12748850 CCCACCCTTCCCACCCCAGGGAC 0: 1
1: 0
2: 4
3: 84
4: 619
Right 950397993 3:12748863-12748885 TCCAGGGTTCTACTTGGATTTGG 0: 1
1: 0
2: 1
3: 7
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950397977 Original CRISPR GTCCCTGGGGTGGGAAGGGT GGG (reversed) Intronic
900105200 1:978145-978167 GTTCCTGGGGTTGGAGGGGGAGG - Intronic
900119041 1:1040899-1040921 GTGCCTGGGGCGGGGAGGGGCGG + Intronic
900142603 1:1144935-1144957 CTCCTGGGGGTGGGAAGGGAGGG - Intergenic
900326466 1:2110800-2110822 GTCCCTGTGGGGGGCAGGGCTGG + Intronic
900375082 1:2350564-2350586 GTCCCTGGGGTGGGGATGGCTGG + Intronic
900404782 1:2487745-2487767 GCCCCAGAGGTGGGCAGGGTAGG + Intronic
900418496 1:2545798-2545820 AGCCCAGGGGAGGGAAGGGTCGG + Intergenic
900540317 1:3199477-3199499 GTTCCTGGGGTGGGCAGGAAGGG - Intronic
900605136 1:3520526-3520548 GTCTCTGGGGTGGGAAGAGCAGG - Intronic
900713332 1:4128795-4128817 GGCCTTGGTGTGGGAATGGTCGG - Intergenic
901149023 1:7088010-7088032 GGCCATGGGCTGGGAAGGCTGGG + Intronic
901700999 1:11044762-11044784 GTCTCTGGGGTGGGAGGGTCGGG - Intronic
902066216 1:13690344-13690366 GTCGCTGGGGAGGGAAGGTAAGG + Intergenic
902211486 1:14907860-14907882 GGCTCTGGGGAGAGAAGGGTTGG - Intronic
902229560 1:15019244-15019266 GTCCCTGGTGTAGCAAGGCTGGG - Intronic
902283028 1:15388294-15388316 GGGCCTGGGGAGGGAAGGGAAGG - Intronic
902320765 1:15663783-15663805 AACCACGGGGTGGGAAGGGTGGG + Exonic
902375017 1:16026517-16026539 GGCCCTGCAGAGGGAAGGGTGGG - Exonic
903216439 1:21846079-21846101 GTCCCTGCAGTGGGACGGGAAGG - Intronic
903754653 1:25652449-25652471 GCCTGTGGGGTGGGAAGGGCTGG - Intronic
904108326 1:28105118-28105140 GTCCCAGAGGTGGGAAGGGCGGG + Intergenic
904282081 1:29427643-29427665 GTCCCTGGGGTGGGAATGTGTGG - Intergenic
904296979 1:29526160-29526182 GTGGCTGGGGAGGGATGGGTCGG + Intergenic
904380774 1:30109271-30109293 GTCCCTGGAGGGGGATGGGATGG - Intergenic
904618517 1:31762613-31762635 GTTCTGGGGGTGGGATGGGTTGG - Intronic
904880758 1:33695096-33695118 GTCGGTTGGGTGGCAAGGGTAGG + Intronic
905036162 1:34919289-34919311 GTCCCTGGAGTGGCATGGGGTGG + Intronic
905214256 1:36395861-36395883 ATCTCTGGGGTGGGGAGGTTGGG - Intronic
905432041 1:37931592-37931614 GGCCCTCGGGTGGGCAGGGTCGG - Intronic
905775423 1:40664888-40664910 AGCCCTGGGGTGGGAAGAGGGGG - Intronic
905777609 1:40679287-40679309 GTGCCTGGGGAGGGGATGGTGGG - Intergenic
907245048 1:53103162-53103184 GCCCCTGGGGTGGGGTGGGGAGG + Intronic
907782505 1:57580110-57580132 GGCCCTGGGGTGGTTAGGGTGGG + Intronic
907923085 1:58931327-58931349 GACCATGTGGTGGAAAGGGTTGG - Intergenic
908509764 1:64842450-64842472 GGCCCTGGGGTGGGGTGGGGTGG + Intronic
908829868 1:68168188-68168210 GTCCCTGGGGTGGGAATGTGGGG + Intronic
912738915 1:112175414-112175436 GTACCTGGGTTGGGAAGGGGAGG - Intergenic
912752570 1:112297959-112297981 CTGCCTGGGGTGGGAAGATTTGG - Intergenic
914904810 1:151735159-151735181 GTCCACGGGGTGGGAAGGAAGGG + Intergenic
914992443 1:152510667-152510689 GTCCCTGGGATGCGAGGGGAGGG + Intergenic
915318220 1:155041623-155041645 ATCCCTGGGGAGTGGAGGGTGGG + Intronic
915365406 1:155312440-155312462 GTGACTTGGGTGGGAAGGGGAGG + Intronic
915368175 1:155326879-155326901 CTCCCTGGTGTGGGAAGGTTTGG - Exonic
915474880 1:156147466-156147488 GTCCCTGGGGTGGGAGGGAGGGG + Intronic
915510010 1:156381728-156381750 GTCACTGTGGTGTGTAGGGTTGG + Intronic
915672221 1:157499269-157499291 GAACCTGGGATGTGAAGGGTGGG + Intergenic
915973779 1:160371657-160371679 GGCCCTGGGGAGGCAGGGGTTGG + Exonic
916572335 1:166038766-166038788 GTCCCTGTGGAGGGCATGGTGGG - Intergenic
917068714 1:171125840-171125862 GTCCCTTGGTGGGGCAGGGTGGG - Intergenic
917504194 1:175613456-175613478 GGCTCTGGGGTGGGATGGGGTGG - Intronic
917804981 1:178605381-178605403 ATCCCTTGGGTTGGCAGGGTTGG + Intergenic
919638804 1:200029767-200029789 GTGCTTGGGTTGGGAAGGGGCGG - Intronic
919858137 1:201719622-201719644 GTCTCTGGGCTTGGAAGAGTTGG - Intronic
919913247 1:202124813-202124835 CTCCCTGGGTTGGGAAGGACAGG - Intronic
920182867 1:204143364-204143386 GGCCTTGGGGTGGGCAGGGTGGG - Intronic
920387877 1:205580928-205580950 GTCCCTGGGGTGGGCCAGGTAGG + Intronic
920416238 1:205800820-205800842 GGGGCTGGGGTGGGAAGGGAGGG - Intronic
920675039 1:208032705-208032727 GTAGCTGGGGTGGGATGGGATGG + Intronic
920676306 1:208040849-208040871 AGCCCTGGGATGGGAAGGGGAGG - Intronic
921032522 1:211345859-211345881 GGCACTGGGATGGGAAGAGTGGG - Intronic
921179432 1:212619904-212619926 GTACCTCGGGTGGGAGGGATGGG + Exonic
922197953 1:223376097-223376119 GGACCTGGGGTGGTAAGGGCAGG - Intergenic
922465955 1:225845723-225845745 GCCCCTGCGCTGGGAGGGGTGGG - Exonic
922571829 1:226638940-226638962 GTCCCTGGCGTGCGGCGGGTAGG - Intronic
922756127 1:228097832-228097854 GTCCTGGGGGAAGGAAGGGTTGG - Exonic
922865938 1:228861635-228861657 AGCCCTGGGGTGGGCTGGGTGGG + Intergenic
923617338 1:235548709-235548731 GTCCCTGCTGTAGGAAGGGAGGG + Exonic
924002420 1:239568597-239568619 GTCCCTGGGATGGGAAGGTAGGG - Intronic
1064261263 10:13788260-13788282 GTCCCTAGGGTGGTGAGGGCAGG - Intronic
1064316926 10:14266153-14266175 GTCCTGGGGGTGGGAGGGGGTGG + Intronic
1064364377 10:14693764-14693786 TTCCCAGGGGTGGGAAGGGTAGG - Intronic
1064466111 10:15583697-15583719 GTCTCGGGGTGGGGAAGGGTTGG + Intronic
1064585673 10:16837281-16837303 GTTCATTGAGTGGGAAGGGTGGG + Intronic
1065550763 10:26866696-26866718 GTGCATGGGGTGGCAGGGGTTGG - Intergenic
1066108015 10:32172364-32172386 TCCCCTGGGGTGGGAGGTGTGGG - Intergenic
1067106503 10:43370610-43370632 GTCTCTGGGCTGGGAGGGCTGGG - Intergenic
1067208469 10:44239348-44239370 TCCCCTGGGGTGGGGAGGGCAGG - Intergenic
1067877340 10:50018243-50018265 GTCCATGGGCTGGGCTGGGTGGG + Intergenic
1068267583 10:54673218-54673240 GTCGCGGGGGTGGGGAGGTTAGG - Intronic
1069718906 10:70537954-70537976 GTCACTGCGGTGGGGAGGCTGGG - Intronic
1072205690 10:93203516-93203538 GTCCCTGAGTCTGGAAGGGTTGG + Intergenic
1072722468 10:97789329-97789351 GTCACTGCGCTGGGAAGGGCAGG + Intergenic
1072736367 10:97882178-97882200 GTCACTGGGATGGAAAGTGTTGG + Intronic
1073095123 10:100974823-100974845 GGCCCTGGGCTGGGCATGGTGGG + Intronic
1073290696 10:102411905-102411927 GCAGCTGGGGTGGGAAGGGGAGG + Intronic
1073290970 10:102413138-102413160 GCAGCTGGGGTGGGAAGGGGAGG - Intronic
1073301824 10:102475556-102475578 GTCACTGAGATGGGAAGAGTAGG + Intronic
1073526211 10:104184652-104184674 GGCCCTGGGGTGATTAGGGTGGG - Intronic
1073889959 10:108090306-108090328 GTCCCTGGGGTGGGGTGGGAGGG - Intergenic
1074941197 10:118237222-118237244 GGGCCTGGGGTGGGGAGAGTTGG - Intergenic
1075060989 10:119256544-119256566 GTACATGGAGTGGGAAGGGGAGG + Intronic
1075917693 10:126183357-126183379 GTCCCTGGTGCTAGAAGGGTTGG + Intronic
1076333631 10:129690714-129690736 GTCCCAGGAGTGGGAAGGCCTGG + Intronic
1076613183 10:131738940-131738962 GAGCATGGGGTGGGCAGGGTGGG - Intergenic
1077317729 11:1926854-1926876 GACCCTGGCTTGGGAAGGGCTGG + Intronic
1077416650 11:2427120-2427142 TTCCCTGGGCTGTGAAGGGCCGG - Intergenic
1077664110 11:4092944-4092966 GTCTAGAGGGTGGGAAGGGTGGG - Exonic
1079674014 11:23202552-23202574 GTCCCTTGGGGGGGAAGGGGTGG + Intergenic
1080497467 11:32833887-32833909 GTGCCAGGGGTGGGTAGGGATGG + Intronic
1081612029 11:44568560-44568582 CTCCCTGGGCTGGGATGGGAGGG - Intronic
1081666016 11:44917533-44917555 GGCCCTGGGGCTGGCAGGGTGGG + Intronic
1081836488 11:46159857-46159879 CTCTCTGGGTGGGGAAGGGTGGG - Intergenic
1081836916 11:46163344-46163366 GGCCCTGAGGTGGGAGGGGTAGG - Intergenic
1083278560 11:61611359-61611381 CTGCCTGGGGTGGGGAGGGGAGG - Intergenic
1083307954 11:61770545-61770567 CTCCATGGGGTGGGAAGGTGGGG + Intronic
1083333295 11:61909056-61909078 GACCCTGGAGAGGGAAGGGAGGG + Intronic
1083386445 11:62313772-62313794 GTCCCACGTGTGGGAGGGGTGGG - Intergenic
1083955909 11:65982619-65982641 GTGCCATGGGTGGGAAGGGCGGG + Intergenic
1084178423 11:67435107-67435129 GTCCCTGAGGGGGGACGGATGGG - Exonic
1084423449 11:69071845-69071867 TCCCCAGGGGAGGGAAGGGTCGG + Intronic
1085082715 11:73647556-73647578 CTCCCTGGGGTGGGCAGGTCCGG + Intronic
1085387961 11:76167988-76168010 AGCCCTGGGGTGGGAGGGGAGGG - Intergenic
1086525016 11:87714814-87714836 GTTCCTGTGGTGGCAAGGGTAGG - Intergenic
1088699042 11:112395576-112395598 GTCCCTGGGCTGGCATGGGGAGG - Intergenic
1088831926 11:113544159-113544181 GGCCCTGGGGTGATGAGGGTGGG + Intergenic
1089395756 11:118135670-118135692 GACCCTGGGGAGGGGAGGGCTGG + Exonic
1089504820 11:118956246-118956268 GTCCTGGGGGTGGGAGGGGCTGG - Intronic
1090074944 11:123574496-123574518 GGCCCTGGGGAAGGAAGGGAAGG + Intronic
1090272925 11:125400468-125400490 GCCCCTGGGGGTGGAAGGGAGGG + Intronic
1090286597 11:125505067-125505089 GTCCCCGGGGAGGGGAGGCTGGG + Intergenic
1090364032 11:126191531-126191553 GTGCCTGGGCTGGGAAGGACGGG - Intergenic
1090367741 11:126221671-126221693 GTGAATGGGGTGGGAAGGGAAGG + Intronic
1090482536 11:127080863-127080885 GTCCCTGGGGTGGGGTGGGGTGG + Intergenic
1091367968 11:135037862-135037884 GTGCCGGGGGTGGGAGGGGCGGG - Intergenic
1091840649 12:3618008-3618030 TTCCATGGGGTGGGAATAGTGGG + Intronic
1092245788 12:6863593-6863615 CTCCCTGGTTTGGGTAGGGTGGG + Intronic
1095500311 12:42830307-42830329 GTCCCTGCGGTGGGGAGTGGAGG + Intergenic
1095621489 12:44260752-44260774 CTAGCTGGGGTGGGAAGGGGTGG - Intronic
1096081127 12:48833244-48833266 TTCCCTGGGCTGGGAAAAGTTGG - Intronic
1096496701 12:52043023-52043045 GTGGCTGGGGTGGGGAGGATGGG + Intronic
1096572889 12:52533871-52533893 GTCACTGGGGAGGGAATGCTGGG - Intergenic
1096626384 12:52898613-52898635 GGACCTGGGGTGGGGACGGTGGG - Intronic
1096809938 12:54162798-54162820 GGCCATGGGGTGGGGAGGGCAGG - Intergenic
1098262762 12:68687340-68687362 GCTCCTGGGGTGGGCGGGGTAGG + Intronic
1099653688 12:85461743-85461765 TTCCCTGGGTCGGGGAGGGTGGG + Intergenic
1099715384 12:86287194-86287216 TTCCCTGGTGTGTGTAGGGTGGG - Intronic
1100493723 12:95105268-95105290 GTCCTGGAGGTGGGAAAGGTGGG - Intronic
1100821146 12:98431558-98431580 GTCCCTTGGGTGGCAATGTTTGG - Intergenic
1100955993 12:99909009-99909031 GGGCCTGGGGTGGGGAGGGAGGG - Intronic
1101391103 12:104301283-104301305 CACCATAGGGTGGGAAGGGTTGG + Intronic
1101569164 12:105937209-105937231 GTGCATGAGGTGGGAGGGGTGGG - Intergenic
1101817701 12:108158454-108158476 GTCCCTGGGGCGGGCGGGGTGGG + Intronic
1102212709 12:111138753-111138775 GCCCCTAGGGTGGGATGGGATGG - Intronic
1102401174 12:112630906-112630928 GTCCCTGGGGTGGGAGATGATGG + Intronic
1102910977 12:116713977-116713999 GCTCCTGAGGTTGGAAGGGTAGG - Exonic
1103289238 12:119830617-119830639 GTGCCTGGGGTAGGAGGGTTGGG - Intronic
1103323038 12:120102685-120102707 CTCCCGAGGGTGGGAAGTGTGGG - Intronic
1104928797 12:132327806-132327828 GGCCGTGGGGTGGGAGGGGGAGG - Intronic
1105038506 12:132943683-132943705 GACCCTGGGGTAGGGAGGGAGGG - Intronic
1105303510 13:19154386-19154408 CTCCCTGGTCTGGTAAGGGTAGG + Intergenic
1105780862 13:23704364-23704386 ATCCTTGGGGTGGGAGGGGTGGG - Intergenic
1106118633 13:26838711-26838733 GTCCCTGCGGACGGAAGTGTTGG + Intergenic
1106549640 13:30760243-30760265 GAACCTGGGGTGGGAAGTGGAGG + Intronic
1107014138 13:35695310-35695332 GGCCCAGGAGTGGGAGGGGTGGG - Intergenic
1107078171 13:36346172-36346194 GTCCCTTGGGTGGGCGGGGTGGG - Intronic
1107478792 13:40767631-40767653 GTCCTTGGGGTGGCCAGGGGAGG + Intronic
1107723370 13:43273137-43273159 CTGGTTGGGGTGGGAAGGGTAGG - Intronic
1108071625 13:46634842-46634864 TTTCCTGGGGCGGGAAGGGTTGG + Intronic
1108507023 13:51121352-51121374 ATACCTGGGGTTGCAAGGGTGGG + Intergenic
1109248064 13:59982413-59982435 GTTCCTGGGGTGGGGGGAGTGGG - Intronic
1109336803 13:61004551-61004573 GTTCCTGTGGTGGTGAGGGTGGG + Intergenic
1110521083 13:76477746-76477768 GTCTCTGGGGGAGGAGGGGTGGG - Intergenic
1111122824 13:83877676-83877698 GTTGCTGGGGCGGGGAGGGTGGG + Exonic
1111876976 13:93909938-93909960 GGCCCTGGGGTGGGTAGGAGCGG - Intronic
1112496649 13:99910717-99910739 GAACCTGGGGTGGGGAGGGAGGG + Intergenic
1112922269 13:104628268-104628290 GTCCCTGGTGTCAGAAAGGTTGG + Intergenic
1113220528 13:108096262-108096284 TTTCATGGGGTGGGAAAGGTTGG + Intergenic
1113565570 13:111317764-111317786 AGCCCTGGGGTGGGAGGGGCAGG - Intronic
1113784987 13:112997738-112997760 CTCCTTGGGGTGGGAAGCGATGG + Intronic
1114314922 14:21500909-21500931 GTACCTGAGGTGGGAAGAGTCGG + Exonic
1114852932 14:26402169-26402191 CTCCCTGGGGTGGGAGGTGGGGG - Intergenic
1115119331 14:29921904-29921926 GTCCATGGGCTGGGAAGAGTTGG - Intronic
1115850661 14:37587898-37587920 GTCCCCGGGGAGGGGAGGGAGGG - Intergenic
1116572679 14:46537729-46537751 GACACTGTGGTGGGAAGGGGAGG - Intergenic
1116638505 14:47429992-47430014 GTCCCTGAGGTGGGAAAGAGAGG + Intronic
1117069085 14:52040379-52040401 GTCCATGGGGTGGGTAGGGATGG - Intronic
1117105504 14:52394004-52394026 TTCCCCGGGTTGGGAAGGATGGG - Intergenic
1117140090 14:52781134-52781156 GACAATGGGGTGGGAAGGTTGGG - Intronic
1119182627 14:72614914-72614936 GTGCCTGGGGAAGGGAGGGTGGG - Intergenic
1119573382 14:75695908-75695930 GACCCTGGGGAGGGAGGGGAGGG - Intronic
1121233059 14:92372441-92372463 GTCCCTGGGCTGGGTGTGGTGGG + Intronic
1121336177 14:93078778-93078800 GTCCCTGCGGGGGGAGGGGCAGG - Intronic
1121489936 14:94350587-94350609 GTCTCTGGGATGGGAGGTGTAGG + Intergenic
1121677523 14:95766196-95766218 GTCCCAGGGCTGGCAAGGGATGG - Intergenic
1121826204 14:97011541-97011563 GTCCCTGGATTGTGAAGGGGAGG + Intergenic
1122152956 14:99734527-99734549 CTCCCTGGGATGGGATGGGATGG - Intergenic
1122354835 14:101116627-101116649 GTGCTTGGAGTGGGAAGGGAGGG - Intergenic
1122452107 14:101817694-101817716 TTGCCTGGGGTGGGCGGGGTGGG - Intronic
1122542989 14:102508227-102508249 GTCCCTGGGTTGGAGAGGGGAGG - Intronic
1122857625 14:104567436-104567458 GCCCCTGGGGTAGGAAGGGCCGG + Intronic
1122863884 14:104594887-104594909 GGGTCTGGGGTGGGAAGTGTGGG - Intronic
1123019597 14:105391513-105391535 CTCCTGGGGGTGGGCAGGGTGGG - Intronic
1123031026 14:105451137-105451159 CCCCCTGGGATGGGCAGGGTGGG - Intronic
1123932139 15:25177094-25177116 TTCCCTGGGGTGGGACACGTTGG + Intergenic
1124229702 15:27933357-27933379 TTACCAGGGGTGGGCAGGGTGGG + Intronic
1124371497 15:29107030-29107052 TGGCCTGGGGTGGGAAGGGAGGG + Intronic
1124483984 15:30100128-30100150 GTCCCTGGGGGAGGAAAGGAGGG + Intergenic
1124490363 15:30151480-30151502 GACCCTGGGGGAGGCAGGGTGGG + Intergenic
1124519596 15:30397096-30397118 GTCCCTGGGGGAGGAAAGGAGGG - Intergenic
1124539057 15:30569125-30569147 GTCCCTGGGGGAGGAAAGGAGGG + Intergenic
1124753170 15:32386849-32386871 GACCCTGGGGGAGGCAGGGTGGG - Intergenic
1124759593 15:32438447-32438469 GTCCCTGGGGGAGGAAAGGAGGG - Intergenic
1124974909 15:34522549-34522571 GACCCTGGGGGAGGCAGGGTGGG - Intergenic
1125723082 15:41854395-41854417 GGCCAGGGGGTGGGGAGGGTGGG + Intronic
1128738074 15:70064741-70064763 GTCCCCAGGGTGGGGAGGGTAGG + Intronic
1128772749 15:70294651-70294673 GGCCCTGGGGCGGGAAGGGTTGG + Intergenic
1129660139 15:77548813-77548835 GTCCCGGCTGTGTGAAGGGTGGG + Intergenic
1129670690 15:77606189-77606211 GGTCCTGGGGTGGCCAGGGTGGG + Intergenic
1129848823 15:78780386-78780408 ATCCCTGGGGTGGCCAGGGGTGG - Intronic
1130300935 15:82679676-82679698 GTACATGGGGTGGGGAGGGCTGG + Intronic
1130819045 15:87473336-87473358 GTCTCTGCTGTGGGAAGAGTGGG - Intergenic
1130969069 15:88718267-88718289 GTGCCTGGGGTGGGATGGGGTGG + Intergenic
1131054168 15:89365839-89365861 CACCCAGGGGTGGGAAGGGTGGG - Intergenic
1131074399 15:89486223-89486245 TTCCCTGGGGTGGGTGGGGGCGG + Intronic
1132674717 16:1116937-1116959 GACCCTGAGTTGGGGAGGGTAGG - Intergenic
1132685877 16:1161869-1161891 GTCCGTGGGGTGGGCCTGGTCGG + Intronic
1132691869 16:1185349-1185371 GTCCCTGGTGTAGGCAGGATTGG + Intronic
1132735109 16:1382017-1382039 GTCCCTGGGCTGGGATGGAATGG + Intronic
1132845187 16:1997979-1998001 GTGCCAGGGGAGGGAAGGGCTGG - Exonic
1132937158 16:2486972-2486994 GGCCCTGGAGGAGGAAGGGTTGG - Intronic
1132939299 16:2499050-2499072 GTCCCTGCGGTGGGGAGGTTTGG - Intronic
1132977130 16:2716465-2716487 GGCCCTGGGGTGGGAGGGACAGG - Intronic
1133155690 16:3873957-3873979 GCCCCTGGGGAGGGAAGTGCTGG + Intronic
1133204383 16:4224278-4224300 GTCTGAGGGGTGGGCAGGGTTGG - Intronic
1133801962 16:9091817-9091839 GGCCCGGGGGTGGGAAGGCCTGG + Exonic
1134050814 16:11135974-11135996 CACCCTGGGGTGGGAAGATTTGG - Intronic
1134665827 16:16017900-16017922 GGCCCTGGGGTGGGGAGGTGTGG + Intronic
1136180527 16:28548765-28548787 GGCCCAGGGGTGGGTGGGGTGGG - Intergenic
1138200860 16:55087360-55087382 GGCCCTGGGGTAGGGAGGGTGGG + Intergenic
1138230402 16:55331993-55332015 GTCCCTGGGGAGGTTGGGGTTGG - Intergenic
1138245579 16:55464659-55464681 GTCACTGGGGTGGGACTTGTTGG - Intronic
1138278206 16:55751499-55751521 TTCCCTGCGATGGGAAGGGCTGG + Intergenic
1138338199 16:56269338-56269360 GTCCACGGGGAGGGAAGGCTGGG - Intronic
1138445241 16:57059270-57059292 GGCCATGGGGTGGGAAGGCCAGG + Intronic
1138562397 16:57809615-57809637 TTCCCTGGTGTGGGGAGGGAAGG + Intronic
1139511320 16:67430127-67430149 GACACGGGGGTGGGCAGGGTGGG + Intergenic
1139950435 16:70665671-70665693 GGCCCTGGGGTAGGGGGGGTGGG - Intronic
1140209862 16:72961351-72961373 GTCCCTGGGGAGGGAGGCATCGG + Intronic
1140321117 16:73952434-73952456 AACCCGGGGGTGGGGAGGGTTGG - Intergenic
1141377468 16:83545192-83545214 GACCCTTGGGTGGGAAGGTGTGG + Intronic
1141479224 16:84295120-84295142 GTGCCTGGGATGGGGAGGCTGGG + Intronic
1141564421 16:84891758-84891780 GCCCCTGGGGAGGGCAGGGATGG + Intronic
1141656147 16:85417635-85417657 GTCCCTGGGTATGGAAGGCTGGG + Intergenic
1142598929 17:1043738-1043760 GACCCTGTGGTGGGAGGGGCAGG - Intronic
1143073797 17:4321732-4321754 GGCACTTGGGTGGGCAGGGTTGG - Intronic
1143188397 17:5024034-5024056 GCCGCTGGGCTGGGTAGGGTTGG - Exonic
1143521121 17:7444993-7445015 GTCCCGGGGGCGGGGCGGGTGGG + Intergenic
1143601195 17:7947396-7947418 GTAGCTGGAGAGGGAAGGGTTGG - Intronic
1144800680 17:17924243-17924265 TTGCCTGGGGTTGGAAGGGCTGG + Intronic
1145064393 17:19752327-19752349 TTACCAGGGCTGGGAAGGGTGGG + Intergenic
1145259739 17:21347498-21347520 GTCTGTGGGGTGGGAAGGGCTGG + Intergenic
1145316876 17:21740450-21740472 GTCTGTGGGGTGGGAAGGGCTGG - Intergenic
1145351778 17:22090126-22090148 GTGCCTCGGGGGGCAAGGGTTGG - Intergenic
1145868834 17:28257309-28257331 ATGCCTGGGGAGGGAAGGGGAGG + Intergenic
1145982639 17:29022524-29022546 GTTCCTGGGGAGGAAAGGATGGG - Intronic
1146059382 17:29596492-29596514 TTCCCTGGGGTGGGAACAGGGGG + Intronic
1146128864 17:30252644-30252666 GTCTTGGGGGTGGGAATGGTAGG + Intronic
1146599782 17:34204564-34204586 GGCCCTGGGGTGGGGAGAGGTGG + Intergenic
1146638370 17:34522419-34522441 CAGCCTGGGCTGGGAAGGGTCGG - Intergenic
1146689012 17:34860217-34860239 GTCCGTGGGGCTGGAAAGGTTGG - Intergenic
1146730144 17:35186203-35186225 GTCCCTGGTGTGGCAATGTTAGG - Intronic
1147057735 17:37847071-37847093 GTGCCTGGGGTTGGCAGGGCAGG - Intergenic
1147321933 17:39651890-39651912 GTCCCTTGGGTGAGAAGGAAAGG - Intronic
1147359615 17:39922682-39922704 GTACCTGGGAGGGGAAGGGTGGG + Exonic
1147602461 17:41754871-41754893 CTCCCTGGGGAGTGAGGGGTGGG + Exonic
1148114214 17:45165544-45165566 ATCTCTGTTGTGGGAAGGGTGGG - Intronic
1148178592 17:45587134-45587156 GACCCTGGGCTGGGAGGGGGAGG - Intergenic
1148215842 17:45833695-45833717 CTTCCTGGGGTGGGGCGGGTGGG - Exonic
1148270561 17:46259321-46259343 GACCCTGGGCTGGGAGGGGGAGG + Intergenic
1148444734 17:47730779-47730801 GGCCCTGGGGCTGGAAAGGTGGG - Intergenic
1148789519 17:50165674-50165696 GGGCCTGGGGTTGGAAGGGTAGG + Intronic
1149236472 17:54596268-54596290 GTCAGTGGGCTGGGAAAGGTAGG - Intergenic
1149443251 17:56692732-56692754 GTCCCTCCAGTGGGAAGGGGTGG - Intergenic
1149785131 17:59428239-59428261 TCCCGTGGGGTGGGAAGAGTAGG + Intergenic
1150248325 17:63692168-63692190 GACCCGGGGGTGGGGAGGATGGG + Intronic
1150649370 17:66999960-66999982 GTCCCTGGCATGGGGATGGTGGG + Intronic
1151344462 17:73493122-73493144 GTCCTTGGGGAGGGGAGGGTGGG - Intronic
1151411803 17:73935425-73935447 CTCCCTGCAATGGGAAGGGTTGG - Intergenic
1151677346 17:75605510-75605532 GGCCCTGGGGTCAGAAGGGCAGG + Intergenic
1151682675 17:75630057-75630079 GTCTCTGGGGTGGGCTGGGGAGG + Intronic
1151945767 17:77319209-77319231 GTCCCTGGGGTGGGAATCAGGGG - Intronic
1152638981 17:81441909-81441931 GCCCATGGGGTGGGCAGGGGCGG - Exonic
1152645734 17:81467781-81467803 GTCCCTGGGGTGGTCCAGGTGGG + Intergenic
1152755224 17:82084415-82084437 GCCCCTCGGGAGGGAAGGGCAGG - Intronic
1152809905 17:82376422-82376444 GGCCATGGGGTGGGGAGGGGAGG - Intergenic
1152870979 17:82752710-82752732 GTCCCTGGGCTGGGGAGACTCGG + Intronic
1152945300 17:83194635-83194657 GTCCCTGGTGTCAAAAGGGTTGG - Intergenic
1153377174 18:4393717-4393739 GTCCCTGGTGCCGAAAGGGTTGG - Intronic
1153528306 18:6018222-6018244 GTCCTTGGGGTGGGCAGCCTCGG - Intronic
1154170233 18:12046209-12046231 GTCCGGGGGCTGGGAAGGGGAGG - Intergenic
1154348323 18:13562798-13562820 ATTCCTTGGGTGGGAGGGGTAGG - Intronic
1157186680 18:45546973-45546995 GTCCCTGGGTTGAGAAGGCTGGG - Intronic
1158437202 18:57441965-57441987 GTCCAGGGGGTGGGAAGGGGTGG - Intronic
1158580252 18:58674483-58674505 TTGGCTGGGGTGAGAAGGGTTGG + Intronic
1158624240 18:59057768-59057790 GGCCCCGGGTTGGGGAGGGTGGG - Intergenic
1159130859 18:64278764-64278786 GTCCCTGTGGTGGGACGTGCAGG + Intergenic
1159781965 18:72670132-72670154 GAGGGTGGGGTGGGAAGGGTAGG + Intergenic
1160710088 19:547445-547467 ACCCCTGGGGTGGGCAGGGCAGG - Intronic
1160718369 19:586687-586709 GACCCTGGGGAGGGAATGGCAGG + Intergenic
1160793075 19:931919-931941 CTCCCTGTGGAGGGAAGGGGAGG + Intronic
1160957339 19:1699690-1699712 GCCGCTGGGGAGGGGAGGGTGGG + Intergenic
1161210527 19:3062968-3062990 GGCCCTGGGGTGGGGCGGGGCGG + Exonic
1161301444 19:3544775-3544797 GTGTCTGGGGAGGGAGGGGTGGG + Intronic
1161776333 19:6264243-6264265 CTTCCTGGGGTGGGGAGGGGTGG - Intronic
1161992005 19:7689507-7689529 GAACCTGGGGTGAGAAGGGAGGG - Intronic
1162025256 19:7890181-7890203 GTTCCTGCTGGGGGAAGGGTGGG - Intronic
1162029853 19:7912607-7912629 GACCCCGGGGTGGGAAGGGCGGG - Exonic
1162152075 19:8653809-8653831 GCCCTTGGGGTGGGAAAGGTTGG + Intergenic
1162432148 19:10635522-10635544 GTCCCCGGGGTGGGGAGGGCAGG + Intronic
1162810726 19:13163166-13163188 CTCCCTGGGGCGGGCAGGGCGGG - Intergenic
1162866671 19:13553180-13553202 CTCCCTGGGGGCTGAAGGGTGGG + Intronic
1163015286 19:14450877-14450899 GGGCCTGTGGTGGGAAGTGTGGG - Exonic
1163109100 19:15147615-15147637 GCACCTGGGGTGGGAAGAGAAGG - Intergenic
1163309281 19:16503407-16503429 GTACCTTGGGCAGGAAGGGTGGG + Intronic
1163312543 19:16522818-16522840 CTCCCTGTGGTGGGAGGGATAGG + Intronic
1163419501 19:17206227-17206249 GTCTGTGGGGTGGGTGGGGTGGG - Exonic
1164676446 19:30104736-30104758 GGCCCTGGGGTAGGGAGGGAAGG - Intergenic
1165104558 19:33461407-33461429 GTCCCCAGGTTGGGCAGGGTCGG + Intronic
1165116675 19:33533070-33533092 GACCCTGGGGTGGGAAGCAAGGG - Intergenic
1165120472 19:33555574-33555596 GACACTGGGGTGGGGAGGGGAGG - Intergenic
1165632528 19:37313606-37313628 GTCCCTGGGGTGACAGGGGAGGG - Intronic
1165768529 19:38365139-38365161 GGCCCTGGGAGGGGAAGGTTGGG + Intronic
1165861440 19:38911497-38911519 GACCCTGGGTGGGGTAGGGTAGG + Intronic
1166103993 19:40588793-40588815 GTCAGTGGGGTGGGAAGGCCAGG - Intronic
1166137028 19:40783845-40783867 GTGCCCGGGGTGGGTGGGGTAGG + Intronic
1166375418 19:42324629-42324651 GCGCGCGGGGTGGGAAGGGTCGG - Intronic
1167166638 19:47803467-47803489 GTGACTGGGGCGGGCAGGGTGGG + Intronic
1167299702 19:48671631-48671653 GGCCCTGGGGAGGGGAGGGAAGG + Intronic
1167307703 19:48718901-48718923 TACTCTGGGGTGGGAAGGGAGGG - Intronic
1167425778 19:49429010-49429032 AGCCCTGGGGTGGGAGGGGCTGG + Intergenic
1167468067 19:49660674-49660696 GTCCCTGGGGCTGAAAGGGGTGG - Intronic
1167473798 19:49689104-49689126 GGCCCTGAGGGTGGAAGGGTGGG - Exonic
1167792859 19:51691798-51691820 AGCCCAGGGGTGGGGAGGGTGGG + Intergenic
1168153358 19:54460607-54460629 GCCCCTGAGGTGGGGAGGCTGGG + Intronic
1168291493 19:55359725-55359747 GCCCCTGGGGATGGAAGAGTAGG + Exonic
1168642076 19:58037475-58037497 GGAGCTGGGGTGGGAAGGGGAGG + Intronic
1168686708 19:58353360-58353382 GTCCCTGGGGCGGGAGGGGGCGG - Intronic
925230975 2:2233506-2233528 GACCCTGGGGTGGGATGGGGCGG + Intronic
925342352 2:3146326-3146348 GTCACTTGGTTGGAAAGGGTGGG + Intergenic
925617253 2:5755326-5755348 CTGGCTGGTGTGGGAAGGGTTGG + Intergenic
926043762 2:9694665-9694687 GGGGCTGGGGTGGGCAGGGTGGG + Intergenic
926165596 2:10520890-10520912 CTCCCTGGGGTGGGAAGGAGTGG + Intergenic
927847550 2:26479381-26479403 GTTCCTGGGGTGGGCAGAGGCGG + Exonic
928971967 2:37038897-37038919 CTCCCTGGGGTGGGGGGGGTGGG + Intronic
929008312 2:37416566-37416588 GTCCCTGGGGCCGAAAAGGTTGG + Intergenic
929142313 2:38677101-38677123 CTCCCTGGGGTGGGAGTGCTTGG + Intronic
929459541 2:42092340-42092362 CTCCCTGTGGAGGAAAGGGTAGG + Intergenic
929594234 2:43166100-43166122 GTCCCTGGAGAGGGAAGGACAGG + Intergenic
929617930 2:43326991-43327013 CTACATGGGGTGGGAAGGGGAGG + Intronic
929967253 2:46544381-46544403 CTCCCTGGGGTGGGGAGGAAGGG + Intronic
930251851 2:49043274-49043296 CTGACTGGGGTGGGCAGGGTAGG + Intronic
931651365 2:64471856-64471878 GGCCTTGGAGTGGGTAGGGTAGG - Intergenic
931831767 2:66059814-66059836 TTCCCTGGGGTGCTAAGGGAGGG - Intergenic
932401389 2:71483128-71483150 GTGCATGGTGTGGGGAGGGTGGG + Intronic
932442089 2:71743984-71744006 GTGGCAGGGGTGGGAGGGGTGGG - Intergenic
933354453 2:81195758-81195780 GCCCCTGTGGTCGTAAGGGTGGG - Intergenic
933834034 2:86231652-86231674 CTCGCTGTGGTGAGAAGGGTGGG - Intronic
934764243 2:96871343-96871365 GACCATGGGGTGGGCAGGGAAGG + Intergenic
935620852 2:105128281-105128303 GGCCCTGGGGTATGAAGGGCAGG + Intergenic
935683866 2:105666336-105666358 GTCCATGGGCTGGGAAAGGCAGG - Intergenic
935785025 2:106541069-106541091 GGCCCTGTGGTGGGCAGGCTTGG + Intergenic
935815988 2:106846052-106846074 GTGCCTGGGCTGGGATGGCTGGG - Intronic
936260660 2:110957514-110957536 GACCCAGGTGTGGGCAGGGTTGG + Intronic
937302056 2:120848584-120848606 GACCCTGGGGAGGGAAGAGTTGG + Intronic
937951261 2:127389464-127389486 GTCCCCGGGGTGGTAAGTGAGGG - Intergenic
938318527 2:130346296-130346318 GTGTCTGGGGTGGGGAGGGGAGG + Intronic
938826642 2:135012307-135012329 CCCCCTAGGGTGGGAGGGGTGGG + Intronic
938919771 2:135985152-135985174 GTCCCCGGGGTGGGGAGGACGGG - Intronic
939056373 2:137369810-137369832 GGTCCTTGGTTGGGAAGGGTGGG - Intronic
940714378 2:157203048-157203070 GTCCCTGGGATGGAGAGAGTGGG + Intergenic
945198217 2:207257048-207257070 GTGCCGAGGGTGGGAAGGGCGGG + Intergenic
946166923 2:217869972-217869994 GTCACTGCGGTGGGGTGGGTGGG - Intronic
946398284 2:219454306-219454328 TTCAGTGGGGTGGAAAGGGTGGG - Intronic
947700773 2:232232220-232232242 GACCATGGGATGGGAGGGGTGGG + Intronic
947859208 2:233347122-233347144 GTCCCTGGAGTGGGAGGGTTGGG + Intergenic
948869848 2:240792379-240792401 GAGCCTGGGGTGGGAGGGGATGG - Intronic
948890697 2:240905694-240905716 GCCCCTGGGGTGGGAAGCCGTGG + Intergenic
948966305 2:241383370-241383392 GTTCCTGTGGTGGGAGGGGCCGG + Intronic
1168763712 20:367589-367611 GACCCTGGGGTGGGCATGGAGGG - Intronic
1169087423 20:2836087-2836109 ATTCATGGGGTGGGAAGGGCTGG + Exonic
1169154849 20:3321058-3321080 GTCCCTGGGGTGGGATGGCATGG - Intronic
1169456323 20:5755501-5755523 GTCCCTGGTGTCAGAAAGGTTGG + Intronic
1169530355 20:6478271-6478293 GTCCCTGGTGTCAGAAAGGTTGG + Intergenic
1169807791 20:9577166-9577188 AACCCTGGGGTTGGGAGGGTGGG - Intronic
1170551478 20:17480951-17480973 GTGCCTGGGGTGGGAAGCAGTGG + Intronic
1170652921 20:18258907-18258929 GATCCTGGGGAGGGGAGGGTTGG + Intergenic
1171187913 20:23136724-23136746 CTCTCTGGGTTGGGTAGGGTGGG + Intergenic
1172135036 20:32681150-32681172 GCTCCTGGGGTGGGCAGTGTTGG - Intergenic
1172698133 20:36836082-36836104 ATCACTGGGTTGGGAGGGGTGGG - Intronic
1172768295 20:37362721-37362743 GTTCCTGGGGTGGGGTGGGGGGG + Intronic
1173162786 20:40664519-40664541 GGCCCTGGGGTTGGGAGGGGGGG + Intergenic
1173224635 20:41155055-41155077 GTCCCTGGGCTGAGAAGGGAGGG + Intronic
1173498502 20:43535781-43535803 GTCCTGGGGGTGGGGAGTGTGGG - Intronic
1173568953 20:44064694-44064716 GGTCCTGGGGTGGGAAGGCATGG - Intronic
1173581385 20:44149189-44149211 GCCACTGGGGTGGGAAGGGAGGG - Intronic
1173860857 20:46282746-46282768 CCCCCGGGGGAGGGAAGGGTGGG + Intronic
1174093333 20:48067369-48067391 GTCCCTGGTGTGAAAAAGGTTGG - Intergenic
1174450004 20:50613951-50613973 GGCCTCGGGGTGGGCAGGGTAGG - Intronic
1175110849 20:56646838-56646860 GTGGCTGGAGTGGGGAGGGTGGG + Intergenic
1175687738 20:61043911-61043933 GCCCATGGAGTGGGATGGGTTGG + Intergenic
1176136170 20:63522954-63522976 CTCCGTGGGGTGGGAAAGGGTGG + Intergenic
1176148149 20:63574460-63574482 GTCTCTGGTGTGTGAAGGGCTGG - Intergenic
1176215162 20:63944455-63944477 CTCCCTGGGGCGGGATGGGGGGG + Exonic
1176300614 21:5097284-5097306 GTCCATGGGCTGAGAAGGGCAGG - Intergenic
1176311428 21:5152665-5152687 GTCCCTGTGCTGTGAAGGGTGGG - Intronic
1176369270 21:6052701-6052723 GTCCCTGCTATGGGAAGGGCTGG + Intergenic
1178244364 21:30936607-30936629 GGCTCTTGGGTGGGAAGGGGTGG + Intergenic
1178330563 21:31686909-31686931 GTCCCTGGTGCCGGAAAGGTTGG + Intronic
1179064790 21:38014958-38014980 GTCTCTGGGGAGGGCAGAGTGGG + Intronic
1179217630 21:39380913-39380935 ATTCTTGGGGTGGGTAGGGTGGG + Intronic
1179345890 21:40556962-40556984 GTCTCTGGGGTGGCAGAGGTGGG + Intronic
1179754249 21:43485840-43485862 GTCCCTGCTATGGGAAGGGCTGG - Intergenic
1179845622 21:44109370-44109392 GTCCCTGTGCTGTGAAGGGTGGG + Intronic
1179856429 21:44164697-44164719 GTCCATGGGCTGAGAAGGGCAGG + Intergenic
1180040794 21:45278502-45278524 GTGCCTGAGGAGGGGAGGGTGGG + Intronic
1180073470 21:45450176-45450198 GTCCCTGGGGAAGGAGGGGAGGG + Intronic
1181440352 22:22932405-22932427 GGGCCTGGGGTGGGCAGGGCTGG + Intergenic
1181830821 22:25558928-25558950 CTCCCTGGGGAGGGTAGGGGTGG + Intergenic
1181869993 22:25890685-25890707 GTGCATGGGGAGAGAAGGGTTGG + Intronic
1182283521 22:29231439-29231461 AGCCCTGGGGTGGGGGGGGTAGG - Intronic
1182792421 22:32964027-32964049 GGCCCTGAGGTGGGCTGGGTGGG + Intronic
1183014844 22:34977587-34977609 GTCACTGAGGTGGGAAGGGAGGG + Intergenic
1183382927 22:37499493-37499515 GTGGGTGGGGTGGGTAGGGTTGG - Intronic
1183465794 22:37979901-37979923 CTCACTGGGGTGTGAGGGGTGGG - Intronic
1183491150 22:38116271-38116293 GGCCCTGGGGTGTGAATTGTGGG - Intronic
1183812272 22:40266997-40267019 GTCATTGGGGTGGGCAGGTTTGG - Exonic
1184253510 22:43274406-43274428 GTCCCTGTGGAGGGCAGGGCAGG - Intronic
1184292590 22:43506023-43506045 GCCCCTGGGTTGGGGTGGGTGGG + Exonic
1184599746 22:45536253-45536275 GTGCCGGGGCTGGGCAGGGTGGG + Intronic
1184755730 22:46514835-46514857 ATCCCTGGGGTGGGAAGGGGTGG - Intronic
1203273679 22_KI270734v1_random:73838-73860 GTCCCGGGAGTGGGAAGAGGTGG - Intergenic
949353981 3:3158077-3158099 GTCCCTGGTGTCGAAAAGGTTGG - Intronic
950397977 3:12748828-12748850 GTCCCTGGGGTGGGAAGGGTGGG - Intronic
950410113 3:12830619-12830641 CCCCCTGGGGTGAGGAGGGTGGG + Intronic
950507400 3:13403820-13403842 GGCCCTGGGGCCTGAAGGGTGGG - Intronic
950673406 3:14540365-14540387 CTCCCTGGGGAGGGGAGGGAGGG - Exonic
950900589 3:16493698-16493720 GTACATGGGGTGGGAATGGATGG - Intronic
951818097 3:26778156-26778178 GAGCTTGGGGTGGGAAAGGTGGG - Intergenic
952326187 3:32322644-32322666 ATGGCTGGGGTGGGAAGGGGTGG - Intronic
952883098 3:37997692-37997714 ACCCCTGGGGTGGGCAGGGGTGG + Intronic
953691853 3:45126386-45126408 GTGCCTGCTGTGGGAGGGGTGGG + Intronic
953692293 3:45129940-45129962 GAACCTGGGGTGGGGAAGGTGGG + Intronic
953810336 3:46107432-46107454 GGCTCTGGGCTGGGGAGGGTGGG + Intergenic
953931821 3:47009434-47009456 ATCCCTGAGCTGGGCAGGGTGGG - Exonic
954117026 3:48472685-48472707 GTCCCAGGGCGGGGTAGGGTGGG - Intronic
954222194 3:49161700-49161722 GTGCCTGGGGTTGGCAGGGAGGG - Intergenic
954786657 3:53098437-53098459 GGCCATGGGGTGGGATGGGGAGG - Intronic
954880558 3:53833340-53833362 CTCCCTTGTGTGGGGAGGGTGGG - Intronic
955733116 3:62008629-62008651 GTCCCTGGTGTCGAAAAGGTTGG - Intronic
956084487 3:65595802-65595824 CTCTCTGGGGTGGGTAGGGTGGG + Intronic
959261112 3:104081660-104081682 GTCACTGTGGTGGGGGGGGTGGG + Intergenic
960286669 3:115837595-115837617 TGCCCTTGGGTGGGAAGGGATGG + Intronic
960901251 3:122556657-122556679 GGCCTTGGGGTGGGGAGGGCAGG + Intronic
960995025 3:123335093-123335115 GTCCCTGGGGTGGCGAGGGCAGG - Intronic
961006054 3:123406141-123406163 GACCCTGGGGTGATTAGGGTAGG - Intronic
962357908 3:134710578-134710600 GTGCCTGGGGTGGGAAGGAGGGG - Intronic
962431698 3:135326249-135326271 ATCCATGGAGTGGGAAGGTTTGG - Intergenic
962464881 3:135648976-135648998 GGCACTGGTGTGGGCAGGGTTGG + Intergenic
963878841 3:150504946-150504968 GACCCTGGGGTGGTAAGGCTTGG - Intergenic
964858415 3:161172430-161172452 AAACCTGGGGTGGGAGGGGTGGG - Intronic
964967358 3:162512795-162512817 GTCACTGGGGTTGAGAGGGTTGG + Intergenic
965355781 3:167671444-167671466 GGGCATGGGGTGGGGAGGGTGGG - Intergenic
966489968 3:180516824-180516846 GTCACTGGTGTGGGAAGGGCTGG - Intergenic
966878010 3:184334662-184334684 TTCCCTGGGGTGGGCTGGGGTGG + Intronic
967126555 3:186429650-186429672 GTCGGTGGGGTGGGGGGGGTCGG - Intergenic
967186203 3:186946803-186946825 GTTCCTGGGGAGTGAAGAGTGGG + Intronic
967889232 3:194353290-194353312 GCCCCCGGGCTGGCAAGGGTGGG + Intergenic
968039576 3:195577883-195577905 TTGCCTGGGGCTGGAAGGGTTGG + Intronic
968131769 3:196196480-196196502 GCCCCTGGGGTTGGGGGGGTCGG - Intergenic
968528877 4:1079486-1079508 GTCCCGTGGGTGAGAGGGGTGGG - Intronic
968568723 4:1328371-1328393 GTCCCTGGCCTGGGCAGTGTCGG + Intronic
968873330 4:3252426-3252448 GGCCCTGGGGTGGGCCGGATGGG - Intronic
969327739 4:6453479-6453501 GCCCCTGGGGTGGGGTGGGGTGG - Intronic
969506488 4:7591339-7591361 GTCCCAGGGCTGGGAGGGGCTGG + Intronic
969527763 4:7712714-7712736 GACCCTGGGGTGGGAAGAGGAGG - Exonic
969530366 4:7727012-7727034 GGCCCTGGGGTGGGGAGGGAGGG + Intronic
970529659 4:16968759-16968781 GTCCCTGGGATGGTAAGTGAAGG + Intergenic
970771587 4:19619323-19619345 ATCCCTGGGGGGGGTGGGGTGGG - Intergenic
971740374 4:30511945-30511967 GTCCCTGGGATGGGAATTGTTGG + Intergenic
972151684 4:36099045-36099067 GTCCATGGGGAGGGGAGGGTAGG - Intronic
972208020 4:36801039-36801061 GTCAGTGGGCTGGGAAAGGTAGG - Intergenic
974637471 4:64583404-64583426 GGCCCTGGGGTGATGAGGGTAGG - Intergenic
974758273 4:66241874-66241896 GTCCCTGTAGTTGGAAGTGTAGG - Intergenic
978061439 4:104344887-104344909 GTTCCTGGGTGGGGAAGGGGAGG + Intergenic
979201580 4:117985431-117985453 GTCCCTGGTGTTGTAAAGGTTGG + Intergenic
979852481 4:125591122-125591144 GTCCCTGGTGTCAGAAAGGTGGG - Intergenic
980248067 4:130273532-130273554 ATCCCTGGGGTGGGGAGAGAGGG - Intergenic
981617549 4:146657274-146657296 GGTCCAGGGGAGGGAAGGGTGGG + Intergenic
982747367 4:159118533-159118555 GTCCCTGGTGCCAGAAGGGTTGG + Intronic
982781119 4:159492582-159492604 GGACCTGGGATGGGAAGGGCAGG - Intergenic
983123055 4:163912436-163912458 CTCCGTGGGATGGGAAGGGAGGG + Intronic
984617600 4:181916082-181916104 ACCCCTGGGGTGGGAGGGCTGGG - Intergenic
984867495 4:184294595-184294617 GTCCCTGGGGTGATTAGGGCAGG - Intergenic
985729723 5:1540384-1540406 GGCCCTGGGGTGGGCAGGGCAGG + Intergenic
986233553 5:5887159-5887181 GTGCCAGGGGTGGGAAGGGGTGG + Intergenic
987708150 5:21481489-21481511 GTCCCCGGAGTGGGAAGAGGTGG + Intergenic
987708328 5:21482305-21482327 GTCCCGGGAGTGGGAAGAGGTGG + Intergenic
987708504 5:21483112-21483134 GTCCCGGGAGTGGGAAGAGGTGG + Intergenic
988092884 5:26566078-26566100 ATCAGTGGGGTGGCAAGGGTGGG + Intergenic
988751107 5:34191033-34191055 GTCCCGGGAGTGGGAAGAGGTGG - Intergenic
988751285 5:34191843-34191865 GTCCCGGGAGTGGGAAGAGGTGG - Intergenic
988751629 5:34193466-34193488 GTCCCCGGAGTGGGAAGAGGTGG - Intergenic
990733504 5:58834790-58834812 ATCCATGGGCTGGGAAGGGAAGG + Intronic
991736251 5:69632957-69632979 GTCCCGGGAGTGGGAAGAGTTGG - Intergenic
991736421 5:69633764-69633786 GTCCCGGGAGTGGGAAGAGGTGG - Intergenic
991736596 5:69634577-69634599 GTCCCGGGAGTGGGAAGAGGTGG - Intergenic
991736945 5:69636212-69636234 GTCCCCGGAGTGGGAAGAGGTGG - Intergenic
991739380 5:69654245-69654267 GTCCCCGGAGTGGGAAGAGGTGG - Intergenic
991758120 5:69898934-69898956 GTCCCCGGAGTGGGAAGAGGTGG + Intergenic
991758295 5:69899750-69899772 GTCCCGGGAGTGGGAAGAGGTGG + Intergenic
991758469 5:69900566-69900588 GTCCCGGGAGTGGGAAGAGGTGG + Intergenic
991758816 5:69902186-69902208 GTCCCGGGAGTGGGAAGAGTTGG + Intergenic
991788518 5:70215936-70215958 GTCCCCGGAGTGGGAAGAGGTGG - Intergenic
991790955 5:70233986-70234008 GTCCCCGGAGTGGGAAGAGGTGG - Intergenic
991812747 5:70488596-70488618 GTCCCGGGAGTGGGAAGAGTTGG - Intergenic
991812919 5:70489403-70489425 GTCCCGGGAGTGGGAAGAGGTGG - Intergenic
991813270 5:70491041-70491063 GTCCCCGGAGTGGGAAGAGGTGG - Intergenic
991815706 5:70509073-70509095 GTCCCGGGAGTGGGAAGAGTTGG - Intergenic
991815877 5:70509880-70509902 GTCCCGGGAGTGGGAAGAGGTGG - Intergenic
991816050 5:70510693-70510715 GTCCCGGGAGTGGGAAGAGGTGG - Intergenic
991816225 5:70511503-70511525 GTCCCGGGAGTGGGAAGAGGTGG - Intergenic
991816402 5:70512322-70512344 GTCCCCGGAGTGGGAAGAGGTGG - Intergenic
991818842 5:70530362-70530384 GTCCCCGGAGTGGGAAGAGGTGG - Intergenic
991837523 5:70774816-70774838 GTCCCCGGAGTGGGAAGAGGTGG + Intergenic
991837698 5:70775632-70775654 GTCCCGGGAGTGGGAAGAGGTGG + Intergenic
991838045 5:70777252-70777274 GTCCCGGGAGTGGGAAGAGTTGG + Intergenic
991880966 5:71216300-71216322 GTCCCCGGAGTGGGAAGAGGTGG - Intergenic
991883403 5:71234321-71234343 GTCCCCGGAGTGGGAAGAGGTGG - Intergenic
991973183 5:72160749-72160771 GTCCCTGAGGTGGAGAGGGTGGG - Intronic
994338407 5:98597193-98597215 CTCACTGGTGTGGGAAGGGATGG - Intergenic
994420398 5:99523319-99523341 GTCCCGGGAGTGGGAAGAGGTGG + Intergenic
994486977 5:100392633-100392655 GTCCCGGGAGTGGGAAGAGGTGG - Intergenic
996571400 5:124935983-124936005 GCCTCTGGGGAGGGAAGGGGGGG - Intergenic
996678881 5:126208468-126208490 GTCCATGGTATGGGGAGGGTGGG - Intergenic
997554361 5:134782617-134782639 GAGCCTGGGGTGGGAACGGGGGG - Intronic
997653097 5:135536311-135536333 CTCGCTGGGGTGGGACGGGGAGG + Intergenic
997712264 5:136015631-136015653 TTCCTTTGGGTGGGAAGGGCTGG + Intergenic
998201392 5:140125909-140125931 TGCCATGGGGTGGGGAGGGTGGG + Intergenic
998352826 5:141512334-141512356 GTCCCTGGGTTGGGGAGGCAGGG + Exonic
998392069 5:141793588-141793610 GTCCTTAGGAGGGGAAGGGTGGG - Intergenic
999113629 5:149142472-149142494 GTCCCAGAGGTGGGAAGAGCAGG + Intronic
1000073823 5:157766129-157766151 GGGCCTGGGGTGGGGAGGGGAGG - Intergenic
1000903789 5:166938177-166938199 GGCCCTGGGGTGATTAGGGTGGG + Intergenic
1001415559 5:171542844-171542866 GCCCCTGGCCTGGGAAGGGCTGG + Intergenic
1001726670 5:173908423-173908445 CCCCCAGGGGTGGGAAGGTTAGG - Intronic
1002088596 5:176791486-176791508 TTCCCTGGGCTGGGAAGGACTGG - Intergenic
1002132421 5:177089718-177089740 GTGGCAGGGGTGGGAAGAGTGGG + Intronic
1002419370 5:179137705-179137727 GGCCCTAGGGTGGGCAGGGTGGG - Intronic
1002471668 5:179439300-179439322 GGCTCTTGGGAGGGAAGGGTTGG - Intergenic
1002640892 5:180630172-180630194 TTCCCAGGGGTGGGATGGGAGGG + Intronic
1002721185 5:181262080-181262102 CTCCCTGGGGAGGGAGGGCTGGG + Intergenic
1002848651 6:971603-971625 GACCCAGGTGTGGGCAGGGTTGG + Intergenic
1003452410 6:6247555-6247577 CTCCCATGAGTGGGAAGGGTGGG - Intronic
1004209748 6:13627265-13627287 TTCCATGGGTTGGGAAGTGTGGG - Intronic
1004271085 6:14196139-14196161 TCCCCTGGGGTGGGAAGGGTGGG - Intergenic
1005111611 6:22288205-22288227 GTCCCTGGGCTGGGAGGTGCCGG + Intronic
1005281297 6:24277343-24277365 GACGCTGGGGTGGGAATGGCTGG - Intronic
1005549257 6:26897662-26897684 GTCCCGGGAGTGGGAAGAGGTGG - Intergenic
1005549434 6:26898479-26898501 GTCCCGGGAGTGGGAAGAGGTGG - Intergenic
1005549610 6:26899299-26899321 GTCCCGGGAGTGGGAAGAGGTGG - Intergenic
1005549784 6:26900116-26900138 GTCCCGGGAGTGGGAAGAGGTGG - Intergenic
1006797478 6:36741053-36741075 GCCCCTGCTGTGGGAAAGGTGGG - Exonic
1007078882 6:39084958-39084980 CACTCTGGTGTGGGAAGGGTGGG + Intronic
1007079942 6:39092810-39092832 GTCCCCAAGGTGGGAAGGGTAGG + Intergenic
1007736131 6:43983343-43983365 GGCCTGGGGGTGGGAAGGGCTGG + Intergenic
1007747401 6:44051483-44051505 GGGCCTGGGGTGGGAGGGGACGG + Intergenic
1007781019 6:44254815-44254837 GTCACTGTGGTGGGAGGGCTGGG - Exonic
1009016945 6:57916317-57916339 GTACCCGGGGTGGGTGGGGTGGG + Intergenic
1009019999 6:57938772-57938794 GTCCCGGGAGTGGGAAGAGGTGG - Intergenic
1010000113 6:70940436-70940458 TTTCCTGGGCTGGGAAGGTTAGG - Intronic
1010388123 6:75305815-75305837 GACTTTGGGGTGGGAAGGGTGGG - Intronic
1012260157 6:97079323-97079345 TTCACTGGCTTGGGAAGGGTGGG + Intronic
1012872439 6:104688039-104688061 GACTCTGGGGTGGGAGGGGCAGG - Intergenic
1012876045 6:104727926-104727948 GTGCCTGTGGTTGGAAGGCTAGG - Intergenic
1016896986 6:149063116-149063138 GTCCCTGGGGAGGGAGTGGCAGG - Intronic
1017001474 6:150000330-150000352 GTTCCTGGGTTGGGAAGGGAGGG + Intergenic
1017140303 6:151183984-151184006 AGCCCTGGGGTGGTAAGGGCAGG - Intergenic
1018970607 6:168526108-168526130 GGCCCAGGGGCGGGAAGGGCAGG - Intronic
1019322223 7:420940-420962 GTCACTGAGGTTGGAGGGGTGGG - Intergenic
1019433641 7:1010991-1011013 CTCCCTGGGGTGGGATGCGTAGG - Intronic
1019473052 7:1231426-1231448 GTGCCTGGGCCGGGGAGGGTGGG - Intergenic
1019483260 7:1275858-1275880 GAGCCCGGGGTGGGAAGGGAAGG + Intergenic
1019485270 7:1286299-1286321 GGCCCTGAGGTGGGAGGGGCCGG + Intergenic
1019565681 7:1677884-1677906 GTCCTTGGGGTAGGCAGGGAGGG + Intergenic
1019598260 7:1868474-1868496 ATCCGTGGGGTGGGGTGGGTGGG - Intronic
1019620261 7:1988354-1988376 GTCCCTGTGGTGGGGATGGCTGG - Intronic
1019702643 7:2481417-2481439 GGCCCTGGAGTGAGAAGAGTTGG + Intergenic
1019811592 7:3169103-3169125 GGCCCTGGGGTGGTCAGGGCAGG - Intronic
1020376695 7:7495536-7495558 TTCCCTGAGGTGGGAAGGGCTGG - Intronic
1021798716 7:24283996-24284018 GTGCCTGGGGCGGGAGGGTTGGG + Intergenic
1022291024 7:29003691-29003713 GTCCCTGGTGTCAGAAAGGTTGG - Intronic
1022507971 7:30918540-30918562 GGCACTGGGGTGGGCAGGGCAGG + Intronic
1023762423 7:43479012-43479034 GTCCCTGGTGTCAGAAAGGTTGG - Intronic
1023857387 7:44193065-44193087 CTCCCTGGGGTGGGGTGGATGGG + Intronic
1023940433 7:44765731-44765753 GTCCCTGAGATGGGAGGGGCTGG - Intronic
1024457979 7:49630616-49630638 GACCCGGGGGTGGGCAGTGTTGG + Intergenic
1024986055 7:55194120-55194142 GTGCCTGGAGTGGGAGGGGCGGG - Intronic
1025017291 7:55449558-55449580 GCGCCTGGGGAGGGAAGGCTGGG - Intronic
1026009902 7:66628743-66628765 GTCCCTGGGTTGGGGGGGGGGGG - Intergenic
1026740648 7:72976409-72976431 GTCCCCGGGAAGGGAAGGGAAGG + Intergenic
1026797949 7:73377899-73377921 GTCCCCGGGAAGGGAAGGGAAGG + Intergenic
1026863833 7:73810739-73810761 CTCCCTGGGGTGGGAGGGCCTGG + Intronic
1026949747 7:74339082-74339104 CCCCCTGGGCTGGGCAGGGTGGG + Intronic
1027103084 7:75388662-75388684 GTCCCCGGGAAGGGAAGGGAAGG - Intergenic
1028871172 7:95772828-95772850 GACACCGGGGTGGGGAGGGTTGG - Intronic
1029707053 7:102281739-102281761 GGCCCTAGGGTGGCAAGGGGAGG - Intronic
1029971686 7:104795984-104796006 GGCACTGGGGTGGGCAGGGGTGG - Intronic
1032097680 7:128947616-128947638 CTCCCTTGGGTGGGAAAAGTGGG + Intronic
1033266986 7:139895202-139895224 GCCCTTGAGGTGGGAATGGTTGG + Intronic
1033601357 7:142891283-142891305 ATCCCTGGGGTGGGAGGTGTAGG - Intergenic
1033979411 7:147145562-147145584 GTCCGTGGAGTGGGGTGGGTGGG - Intronic
1034459639 7:151191346-151191368 GACTCGGGGGTGGGAAAGGTGGG + Intronic
1034575425 7:151992900-151992922 GTGCGTGGGGTGAGAAGGGGCGG - Intronic
1034815766 7:154170695-154170717 GCCCCTGGTATGGGAAGGGAAGG + Intronic
1034825676 7:154260157-154260179 GTCTGTGGGGTGGGAGCGGTAGG + Intronic
1035555123 8:562278-562300 GGGGCTGGGGTGGGAAGGGAAGG + Intergenic
1035943252 8:3928774-3928796 GGCCCGGGGGTGGGCGGGGTGGG - Intronic
1036210947 8:6841053-6841075 GCCCGTGGGGTGGGCAGGGCAGG + Intergenic
1037470106 8:19200152-19200174 GTGCCTTGGGTGGGAAGGGGTGG - Intergenic
1037802100 8:22041418-22041440 GCCCCCAGGGTGGGAAGGGAAGG - Intergenic
1037934499 8:22906138-22906160 GTCCCTGGAGAGTGAGGGGTGGG - Intronic
1038199059 8:25394924-25394946 GGACCTGGGGTGGGAAGGTGGGG + Intronic
1038321214 8:26528926-26528948 GACCCTGGGGTGATTAGGGTAGG + Intronic
1038425289 8:27460657-27460679 GTTCCTGGGGAGGGAAGGAGGGG + Exonic
1038620577 8:29139023-29139045 GTGCCTGGGGTGCTAAGGGAGGG + Intronic
1038914873 8:32009906-32009928 GTGAGTGGGGTGGGGAGGGTAGG - Intronic
1038927710 8:32158699-32158721 GTCCCTGGGGAGGGAAGCAGAGG - Intronic
1039314978 8:36361088-36361110 GTCCAGGGGGTGGGATGGGGTGG + Intergenic
1039473218 8:37826524-37826546 GTCCCTGGAGAAGGAAGGGAAGG - Intronic
1039842862 8:41306509-41306531 GTCCCTGTGGAGGGGAGGGTGGG - Intronic
1041380484 8:57249420-57249442 GTCATTGAGGTAGGAAGGGTAGG + Intergenic
1041559346 8:59197135-59197157 GGCCCTGGAGTGGGAAGGAAAGG - Intergenic
1041860557 8:62508264-62508286 GTCCCTCTGTTGTGAAGGGTTGG - Intronic
1042040346 8:64582124-64582146 GTCTTTGGGGTGGGGAGGGAGGG + Exonic
1044025095 8:87159496-87159518 GTGCCTGGGGTGGGATAGGATGG + Intronic
1044848569 8:96406015-96406037 GTCCCTGGTGCGGAAAAGGTTGG - Intergenic
1045555786 8:103213412-103213434 GTCTCAGGGGTTGGCAGGGTGGG + Intronic
1045582785 8:103499359-103499381 GTCCCTGGGGTGTCAGGGATGGG - Intergenic
1046226996 8:111295212-111295234 GTCTCAGGGGTGGGCAGGGATGG + Intergenic
1046240129 8:111478912-111478934 GGGCCTAGGGTGGGCAGGGTCGG + Intergenic
1046725030 8:117664976-117664998 TTCCCTGGAGAGGGAAGAGTAGG + Intergenic
1047208042 8:122819191-122819213 GTGCCTGCAGTGGGAAGGCTGGG + Intronic
1047368008 8:124230061-124230083 GACACTGGAGTGGGAAGGGTGGG - Intergenic
1048319191 8:133385361-133385383 GTCCCTGGGCCTGCAAGGGTGGG - Intergenic
1048365041 8:133731066-133731088 GTCCCTGGGGTGAGTAGGTCAGG + Intergenic
1048443488 8:134476933-134476955 CCCCCTGGGGTGGGCAGTGTGGG - Intergenic
1049361672 8:142214986-142215008 GCCCCTGAGGTGGGAAGCGCTGG - Intronic
1049645774 8:143734981-143735003 GTCCTTGGGGTGGGAGTGGCAGG - Intergenic
1049785405 8:144448393-144448415 GTCTCTGGGGTGGGGAAGGTGGG - Intergenic
1050592449 9:7174320-7174342 GTCCCTGGGGTTGGAGGGTGGGG + Intergenic
1051889056 9:21924724-21924746 GGCCCTGGGTAGGGAAGGGAAGG - Intronic
1052139870 9:24967410-24967432 GGACTTGGAGTGGGAAGGGTGGG + Intergenic
1052459260 9:28741724-28741746 GTGCCTGGGGTTGCAAGGGCTGG + Intergenic
1052827648 9:33188520-33188542 ATCCCTGACTTGGGAAGGGTAGG - Intergenic
1052982498 9:34459157-34459179 GTCACGGGGGTGAGAAGGCTGGG - Intronic
1053121610 9:35551415-35551437 GTCCTTGGGGTGGGCATGGGAGG + Intronic
1054741681 9:68812049-68812071 GTGCGTGGGGTGGGAATGGATGG + Intronic
1055035803 9:71817184-71817206 GTCACTGGAGCGGCAAGGGTGGG + Intergenic
1055847778 9:80588044-80588066 TTCCCTGGGGTAAGAAGAGTTGG - Intergenic
1056262509 9:84862900-84862922 GGCCCTGGGGTGGGGAGGGCAGG + Intronic
1056639817 9:88360934-88360956 GTCTCTGGGGTGGTTAGGGCAGG - Intergenic
1056754375 9:89372859-89372881 GTCCCTGGGGCAGGATGGGACGG - Intronic
1056767859 9:89455682-89455704 CTGCCTGGAGTGGTAAGGGTCGG - Intronic
1056835419 9:89951269-89951291 CTCCCAGGAGTGGGGAGGGTGGG + Intergenic
1057189333 9:93077755-93077777 GTCTCAGGGGTGGTACGGGTAGG - Intronic
1059311036 9:113389307-113389329 GTTCCTGGGCAGGGAAGGGGAGG + Intronic
1059870532 9:118568893-118568915 ATTTCTGGGGTTGGAAGGGTTGG - Intergenic
1060208092 9:121694215-121694237 GCCCCTGGGATGGGCAGCGTGGG - Intronic
1060996156 9:127875809-127875831 GAGCCTGGGGAGGGGAGGGTTGG - Intronic
1061203886 9:129152167-129152189 GGCCCTGGGCTGGGAAGCGGAGG + Intergenic
1061372238 9:130203879-130203901 GGCCCAGGTGTGGGAAGGGGAGG - Intronic
1061383729 9:130276101-130276123 GTCCCTGGAGGGGCAGGGGTGGG + Intergenic
1061480990 9:130897676-130897698 GTCCCTGGAGTCAGAAGGTTTGG - Intergenic
1062024037 9:134332301-134332323 GTCCCAGGGCAGGGCAGGGTAGG + Intronic
1062043617 9:134415297-134415319 GGCCCGGGGGTGTGAAGGGAGGG + Intronic
1062046510 9:134426887-134426909 GGGCCTGGTGTGGGAAGGGAGGG + Intronic
1062084391 9:134641466-134641488 GCACCTGGGGTGGGAACAGTGGG + Intergenic
1062273775 9:135721287-135721309 GTCCCTGGGGGTGGTGGGGTAGG + Intronic
1062349043 9:136130191-136130213 GTCCCGGGGCTGGGAGGGGACGG - Intergenic
1062383984 9:136301407-136301429 GTCCCGGGGCTGGGAGGGGACGG + Intronic
1062389166 9:136327322-136327344 TTCCCTGGGGTGGGGTGGGCTGG + Intergenic
1062431503 9:136528641-136528663 CTCCCTGGGAAGGGAAGGGGAGG + Intronic
1062488257 9:136791692-136791714 GTCCCTGGGGTGGCAGAGGCGGG - Exonic
1062532277 9:137007200-137007222 GTGTGTGGGTTGGGAAGGGTGGG - Intergenic
1062601708 9:137321297-137321319 GTGCCTGGGCTGGGCAGGGAGGG - Intronic
1203456544 Un_GL000219v1:173309-173331 GTCCCTGGGGTCCGAATGTTTGG - Intergenic
1185457328 X:317714-317736 GTCCGTGGGGTGGGGTGGGGTGG - Intronic
1185476004 X:416041-416063 TTCCCTGGGGTGGGCAGGGGTGG - Intergenic
1185504266 X:619942-619964 TTCCTTGGAGTGGGAGGGGTCGG + Intergenic
1187633421 X:21200564-21200586 GTCAGTGGGCTGGGAAAGGTAGG + Intergenic
1189389323 X:40562918-40562940 GTGCCTGGGCTGGGAAGACTCGG + Intergenic
1189491666 X:41475137-41475159 GGCCCTCGGGTGGGAAGACTAGG + Exonic
1190827537 X:54031401-54031423 GTGCCTGGAGTTGGAGGGGTGGG - Intronic
1192213601 X:69142949-69142971 GATCCAGGGGTGGGAAGGTTGGG - Intergenic
1192759261 X:74078285-74078307 TTCCCTTGGCTGGGAAGGGGAGG + Intergenic
1193252007 X:79301953-79301975 ATTCCTGGTGTGTGAAGGGTAGG + Intergenic
1194454119 X:94080999-94081021 GTCCCTGGGGCTGAAAAGGTTGG - Intergenic
1194498654 X:94652547-94652569 TTCCATAGGCTGGGAAGGGTAGG - Intergenic
1195406559 X:104520833-104520855 TTACCAGAGGTGGGAAGGGTAGG - Intergenic
1195677581 X:107519053-107519075 TTCCATGGGTTGGGAAGGGAGGG + Intergenic
1196709504 X:118748158-118748180 GTCCCTTGGTTGGGTAGGGCTGG + Intronic
1196794455 X:119490959-119490981 GTCCCTGGGGTGGGGAGTTTGGG - Intergenic
1197725120 X:129771103-129771125 GTCCCAGGGGAGGGAAGAGCTGG - Intergenic
1199620677 X:149697605-149697627 TTCCTAGGGGTGGGAAGGCTAGG + Intronic
1200045846 X:153400806-153400828 CTCCCTGGGGTGGGAGGGCAAGG - Intergenic
1200072084 X:153534184-153534206 GGTCCTGGGGTGGGGAGGGGAGG + Intronic
1200114880 X:153765612-153765634 GTTCCTGGGAGGGGCAGGGTAGG + Intronic
1200117605 X:153776228-153776250 GTCCCTGGGGTGGGTGGGCAGGG - Intronic