ID: 950399702

View in Genome Browser
Species Human (GRCh38)
Location 3:12760457-12760479
Sequence CAGGGCAAAGGCCCTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2250
Summary {0: 1, 1: 6, 2: 124, 3: 558, 4: 1561}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950399702_950399708 -5 Left 950399702 3:12760457-12760479 CCCTCCTCAGGGCCTTTGCCCTG 0: 1
1: 6
2: 124
3: 558
4: 1561
Right 950399708 3:12760475-12760497 CCCTGGCTGTTCCCTCTGCCTGG 0: 6
1: 48
2: 203
3: 712
4: 1959
950399702_950399713 23 Left 950399702 3:12760457-12760479 CCCTCCTCAGGGCCTTTGCCCTG 0: 1
1: 6
2: 124
3: 558
4: 1561
Right 950399713 3:12760503-12760525 TCTCCCCCTAGAAAGCCACCTGG 0: 1
1: 0
2: 0
3: 21
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950399702 Original CRISPR CAGGGCAAAGGCCCTGAGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr