ID: 950400023

View in Genome Browser
Species Human (GRCh38)
Location 3:12762785-12762807
Sequence ACTCCTGGAGTTTCTGATTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 381
Summary {0: 2, 1: 3, 2: 11, 3: 69, 4: 296}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950400023_950400028 13 Left 950400023 3:12762785-12762807 CCTGAATCAGAAACTCCAGGAGT 0: 2
1: 3
2: 11
3: 69
4: 296
Right 950400028 3:12762821-12762843 TGTATTTAAATAAGCCCCACTGG 0: 1
1: 0
2: 1
3: 24
4: 237
950400023_950400030 19 Left 950400023 3:12762785-12762807 CCTGAATCAGAAACTCCAGGAGT 0: 2
1: 3
2: 11
3: 69
4: 296
Right 950400030 3:12762827-12762849 TAAATAAGCCCCACTGGACTGGG 0: 1
1: 0
2: 1
3: 4
4: 82
950400023_950400029 18 Left 950400023 3:12762785-12762807 CCTGAATCAGAAACTCCAGGAGT 0: 2
1: 3
2: 11
3: 69
4: 296
Right 950400029 3:12762826-12762848 TTAAATAAGCCCCACTGGACTGG 0: 1
1: 0
2: 0
3: 5
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950400023 Original CRISPR ACTCCTGGAGTTTCTGATTC AGG (reversed) Intronic
903000185 1:20259901-20259923 GCTCCTGGAGCTTCTGCTGCTGG + Intergenic
903676752 1:25069154-25069176 AATCCAGGAGTGGCTGATTCTGG + Intergenic
903959734 1:27049301-27049323 ACTGCTGGAATTTCTGGTTTGGG + Intergenic
904402440 1:30265728-30265750 ACTCCTGGAGTCTCTGACTGTGG - Intergenic
904539196 1:31221400-31221422 ACCCCCAGAGTTTCTGATTTAGG - Intronic
905704870 1:40047829-40047851 ACTCCTGGAGTTTCAGGTAGAGG + Intronic
906590136 1:47017284-47017306 TCTCCTAGAATTTCTGATTGTGG + Intergenic
906908937 1:49925570-49925592 ACTCGTGAGGTCTCTGATTCGGG + Intronic
907153502 1:52310618-52310640 AAACCTGGGCTTTCTGATTCTGG + Intronic
907294508 1:53441074-53441096 ACTCCAGGTGATTCTGATGCAGG - Intergenic
907557205 1:55354456-55354478 ACTTCTGGGATTTCTCATTCTGG + Intergenic
907934608 1:59031227-59031249 ATCCCCTGAGTTTCTGATTCAGG + Intergenic
908673779 1:66578221-66578243 ATCCCTGGAGATTCTGAGTCAGG + Intronic
908793403 1:67805351-67805373 ATTCCTGCAATTTCTGATTCTGG - Intronic
909481058 1:76129321-76129343 ACTCCTTTAGTTTCTCCTTCTGG - Intronic
910126453 1:83848009-83848031 AATCCTGGAGATTCTGGTTTTGG + Intergenic
910408533 1:86915123-86915145 ACTCCTCCAGTTTCTGGATCTGG - Exonic
912144414 1:106774505-106774527 ACTCTTGAATTTTCTGAATCTGG - Intergenic
916125089 1:161562777-161562799 ACCCTCCGAGTTTCTGATTCTGG + Intergenic
916134982 1:161644123-161644145 ACCCTCCGAGTTTCTGATTCTGG + Intronic
916882583 1:169034292-169034314 ACTCCAGCAGTTTCTGTGTCTGG + Intergenic
917283645 1:173402802-173402824 ATACCCAGAGTTTCTGATTCAGG + Intergenic
918094765 1:181325511-181325533 GCCCCTAGAGTTTCTGATCCAGG - Intergenic
919341043 1:196306973-196306995 ACTACTGTAGTTATTGATTCAGG + Intronic
919590085 1:199491003-199491025 ACTCATGCAGCTTCTGCTTCAGG - Intergenic
919831930 1:201547372-201547394 ACTACTGGAAAATCTGATTCTGG - Intergenic
920252533 1:204631081-204631103 ACCCTCAGAGTTTCTGATTCTGG - Intronic
920738801 1:208560509-208560531 ACCCCTTGGGTTTCTGATTTAGG + Intergenic
920749611 1:208661275-208661297 CCTGCTGGAGTTTCTGCTTCAGG - Intergenic
921920060 1:220658405-220658427 ACTCCCAGGGTTTCTGATTCAGG + Intronic
922420172 1:225454808-225454830 ATTCCTGGAGCTCATGATTCAGG - Intergenic
923861714 1:237898350-237898372 AAGGCTGGAGTTTCTGATTCAGG - Intergenic
1062836123 10:636988-637010 CCTCCAGGTGTTTCTGATGCGGG - Intronic
1062901853 10:1152569-1152591 AATCATGGAGTTTCTGGGTCAGG - Intergenic
1065834450 10:29644299-29644321 TCTCCTGGAGTTTTTCTTTCAGG - Intronic
1066972880 10:42331609-42331631 ACACCTGGAGTTTCTGGTGCTGG + Intergenic
1067832745 10:49619871-49619893 GCTCCAGGAGTTTCTGCTGCAGG - Exonic
1068744859 10:60518515-60518537 GCTCTTAGAGATTCTGATTCAGG - Intronic
1069647271 10:70009826-70009848 ACTCCTGGGGGGTTTGATTCTGG - Intergenic
1070528582 10:77316524-77316546 ACCCTCAGAGTTTCTGATTCAGG + Intronic
1071376267 10:85007850-85007872 TCTCCTGGAGTCTATGCTTCAGG + Intergenic
1071751026 10:88476006-88476028 AATCCAGGGGTTTATGATTCAGG + Intronic
1072641072 10:97211639-97211661 ACCCCTGGAGTCTCTGATGCAGG - Intronic
1073624146 10:105079133-105079155 ACCCTCAGAGTTTCTGATTCTGG - Intronic
1074307124 10:112289373-112289395 ACTCCTGGAGTCTATGATTTTGG - Intronic
1074479714 10:113808223-113808245 ACTCCTAGAGATGCTGATTTCGG + Intergenic
1074906905 10:117872664-117872686 ACCCCTGGAGATTCTCATACAGG + Intergenic
1075919497 10:126198550-126198572 AATCCTGCAGCTTCTGTTTCTGG + Intronic
1077247761 11:1547593-1547615 CCTCCTGGAGTTTCTTGTTACGG + Intergenic
1078550465 11:12276636-12276658 ACTCCAGGTGCTTCTGATGCAGG - Intronic
1078669699 11:13353956-13353978 ACTTCTAGAGTTTCTGGTTCTGG + Intronic
1078687656 11:13548388-13548410 ACTTATGGAGTTGATGATTCAGG + Intergenic
1078890550 11:15552892-15552914 ACTCCAGCAGCTTCTGCTTCAGG + Intergenic
1079530494 11:21446915-21446937 AATTCTGGGGTTTCTGACTCTGG - Intronic
1081388228 11:42498572-42498594 AAAACTGGAATTTCTGATTCAGG - Intergenic
1081456982 11:43233385-43233407 GCTCCTGGACCTTCTGAGTCTGG - Intergenic
1082120111 11:48370904-48370926 ACTCATGGTGTGACTGATTCAGG + Intergenic
1082831955 11:57625036-57625058 ACTCCTTGTGAATCTGATTCAGG + Intergenic
1085320537 11:75571408-75571430 ACTCCCAGAGATTCTGATTCAGG + Intronic
1085412606 11:76300380-76300402 ACCCCTGGAGGTTCTAATTCAGG - Intergenic
1085944851 11:81256550-81256572 ACCCCCAGAGTTTCTGATTCTGG - Intergenic
1088007635 11:104961692-104961714 ACTCTTGGAGTTCCTGTTTAGGG + Intronic
1088252709 11:107875025-107875047 GCTGCTGATGTTTCTGATTCAGG - Intronic
1088590439 11:111398400-111398422 ACCTCCAGAGTTTCTGATTCAGG + Intronic
1089415028 11:118281392-118281414 ACCCTCAGAGTTTCTGATTCTGG + Intergenic
1091415098 12:275978-276000 ACTCCCAGAGTTTCTGTTTCAGG + Intergenic
1091836065 12:3586630-3586652 ACCCCCAGAGTTTCTGATTCAGG - Intronic
1094487427 12:30936092-30936114 ACCACTGGATTTTCTGATCCAGG - Intronic
1095362903 12:41365667-41365689 ACCCCTGGAGAGACTGATTCGGG - Intronic
1096750301 12:53754431-53754453 ACTCCTGCCGTTTCTGTTCCGGG - Intergenic
1097250831 12:57631646-57631668 ACTCCCTGAGGTCCTGATTCAGG - Intronic
1098025016 12:66192050-66192072 ACTCCTAGAGCTGCTGATTCAGG + Intronic
1098364528 12:69688804-69688826 ACTCCTGGAGACTCTGAGGCTGG - Intronic
1098961452 12:76743911-76743933 AGTCTTGGAGATGCTGATTCAGG - Intergenic
1099402966 12:82222572-82222594 ACTCCCCGAGTTTCTGATTCAGG - Intergenic
1099812318 12:87599259-87599281 ACTCCTTTAGTTTCTTATGCAGG - Intergenic
1100370920 12:93967730-93967752 ACTGCAGGACTGTCTGATTCTGG + Intergenic
1100716136 12:97307818-97307840 ACCCCCAGAGTTTCTGATTCAGG - Intergenic
1101832232 12:108267734-108267756 CCTTCTGGAGATTCTAATTCAGG + Intergenic
1102005382 12:109586303-109586325 ACCCCCGGAGATTCTGATTCAGG - Intronic
1102458944 12:113088112-113088134 GGTCCTGGAGTTTCCGAGTCAGG - Intronic
1102585104 12:113917377-113917399 ACACCTGTAGTTTCTAATTCAGG - Intronic
1104692376 12:130836793-130836815 ACTCATGGAGTTTCTCATCTTGG - Intronic
1105420904 13:20251525-20251547 ACCCCCAGAGCTTCTGATTCAGG + Intergenic
1105547587 13:21362091-21362113 GCTCCAAGAGTTTCTGATCCTGG + Intergenic
1105897275 13:24726958-24726980 AGCCCTGGAGGTTCTGATTCAGG - Intergenic
1108092397 13:46862555-46862577 ATTTCTGGAGTTTCTTATGCGGG - Intronic
1109726577 13:66349066-66349088 ACCACTGCAGTTTCTGATTGAGG - Intronic
1109728452 13:66377315-66377337 CCGCCCTGAGTTTCTGATTCAGG + Intronic
1110236854 13:73226025-73226047 TCCCCAGTAGTTTCTGATTCTGG + Intergenic
1111623824 13:90757619-90757641 ATTCCAAGAGTTTCTGATTTAGG + Intergenic
1112342612 13:98565249-98565271 TGCCCTGGAGTTTCTGATTCTGG - Intronic
1112627254 13:101119782-101119804 AATCCTGGATTTTATAATTCAGG + Intronic
1112948064 13:104956181-104956203 TCTGCTGCAGTTTCTTATTCTGG - Intergenic
1113556467 13:111239606-111239628 ACTCCTGAAGTCTCTGCTTGGGG + Intronic
1113780128 13:112972007-112972029 ACCCTCAGAGTTTCTGATTCAGG + Intronic
1114012809 14:18390531-18390553 ACAACTGGAGTTTCTGGTGCTGG + Intergenic
1114814618 14:25942802-25942824 ATTGCTGGAGTTGCTGGTTCAGG + Intergenic
1116521398 14:45851754-45851776 ACTCATGGTGATTCTGATGCAGG + Intergenic
1118038992 14:61897619-61897641 AGTCCTGGAATATGTGATTCAGG + Intergenic
1118228203 14:63922805-63922827 ACTCCCAGAGATTCTGATTCAGG - Intronic
1118579713 14:67283102-67283124 ACTCCTGGAATTTGTGATTAGGG + Intronic
1119893478 14:78200489-78200511 ACCCCTAGAGTGTCAGATTCAGG - Intergenic
1120076487 14:80164902-80164924 ACTCATTGAGTTTCTGTTTTTGG - Intergenic
1120895916 14:89532076-89532098 ACCACCGGACTTTCTGATTCAGG - Intronic
1121739497 14:96241462-96241484 AGTCCTGCAGTTTGTGAATCTGG - Exonic
1121843209 14:97151676-97151698 ACTCAGTGATTTTCTGATTCTGG - Intergenic
1122298232 14:100717424-100717446 ACTCCCGCGGTTTCTGGTTCAGG + Intergenic
1123871216 15:24575715-24575737 TCACCTGGAGTTTTTGACTCCGG - Intergenic
1124168167 15:27347816-27347838 ACTCCTGCAGCTTCTGCTCCAGG + Intronic
1124879949 15:33632890-33632912 TCTCCATGAGTTTCTCATTCCGG - Intronic
1126417595 15:48433939-48433961 ACTCTCGGAGTTTCTGATTTAGG + Intronic
1126712051 15:51470015-51470037 ACTCCCAGAGTTTCTGATTGAGG + Intronic
1126790558 15:52217662-52217684 ACTCCTGGAATTTCTCTTTTTGG + Intronic
1127383923 15:58452235-58452257 ATACCCAGAGTTTCTGATTCAGG - Intronic
1127646966 15:60968363-60968385 ACCCTCAGAGTTTCTGATTCAGG + Intronic
1127683009 15:61315841-61315863 CCTCCCGGAGTTTCTGGCTCAGG + Intergenic
1128107084 15:65052985-65053007 ACTTCTGGAGTTTCTTTTTCTGG - Exonic
1128440346 15:67701717-67701739 ACCCCTAGAGATTCTTATTCTGG + Intronic
1128553452 15:68614111-68614133 ACTCCCAGAGATTCTGATTCGGG - Intronic
1128617008 15:69118102-69118124 CCTCCTCCAGATTCTGATTCAGG - Intergenic
1128649604 15:69400934-69400956 ACTCCTGGCGTTTCTGGTTCAGG - Intronic
1128874317 15:71189835-71189857 ACCCCTTGAGTGTCTGATGCAGG + Intronic
1130644143 15:85708905-85708927 ACTCCCAGAGTCTCAGATTCTGG + Intronic
1130837397 15:87664194-87664216 ACTCCTGGAGTTCTTGGTTAGGG + Intergenic
1132556869 16:576398-576420 GCCCCTGGAGTTCCTGCTTCTGG - Intronic
1133463744 16:6009881-6009903 CATGCTGGAGATTCTGATTCAGG - Intergenic
1133638092 16:7689533-7689555 TCTCCTGGAAATTCTGATTCAGG + Intronic
1134012130 16:10862179-10862201 TTTCCTCGAGTTTCTGATCCTGG - Intergenic
1134292635 16:12914818-12914840 ACCCCTGTAGTTTCTGACTCAGG + Intronic
1135273498 16:21089128-21089150 ATTCCCAGAGTTTCTGAGTCAGG + Intronic
1135649396 16:24192790-24192812 ACACCTAGAGTGTCTGATTCAGG - Intronic
1137707807 16:50547875-50547897 ACTCCTCTAGTTTCTTATTTGGG - Intergenic
1137872578 16:51964665-51964687 ACTCCCAAAGTTTCTGATTCAGG + Intergenic
1140045340 16:71436918-71436940 ACTCCCAGAAATTCTGATTCAGG + Intergenic
1140820616 16:78659435-78659457 ACTCCCAGAGTTTCTGGTTCAGG - Intronic
1143314447 17:6021774-6021796 AAACCCGGAGTTTCTGATTCAGG + Intronic
1143428131 17:6856546-6856568 ACTCCTGGACTTTCTCAGACTGG - Intergenic
1143490257 17:7281863-7281885 GATCCTGGAGTCTCTGACTCCGG - Exonic
1148894229 17:50830845-50830867 AGTCCTGGAGTCTCTGTGTCAGG - Intergenic
1150305289 17:64079531-64079553 ACCCCTGGGGATTCTGATTCAGG - Intronic
1150375012 17:64673853-64673875 TCTCCTGGTGATTCTGATGCAGG - Intergenic
1153811636 18:8757207-8757229 ACTCCTGGAAATTCTGAACCTGG - Intronic
1154287891 18:13077287-13077309 ACTCAAAAAGTTTCTGATTCTGG - Intronic
1154383647 18:13874052-13874074 ATTAATGGATTTTCTGATTCAGG + Intergenic
1154524936 18:15276647-15276669 ACAACTGGAGTTTCTGGTGCTGG - Intergenic
1156178177 18:34572197-34572219 AGCCCTAGAGATTCTGATTCAGG + Intronic
1157241681 18:46015596-46015618 ATCCCCAGAGTTTCTGATTCAGG - Intronic
1157527048 18:48391719-48391741 ACCCCTAGAGTTTCTGATTCAGG + Intronic
1159739894 18:72154457-72154479 ACTTTTGGAGTTTGAGATTCAGG - Intergenic
1159883030 18:73877772-73877794 TCTTCTGGGGTTTCTCATTCTGG + Intergenic
1160502403 18:79408561-79408583 CCTCATGGAGATTCTGATACTGG - Intronic
1161743910 19:6043061-6043083 ACCCCTGGAACTTGTGATTCTGG - Intronic
1162849330 19:13418510-13418532 ATTCCTGGATTTTCTGAGTGGGG + Intronic
1164003131 19:21124060-21124082 CCACCTGGAGTTTCTGGTACTGG - Intronic
1164599098 19:29549054-29549076 AGTCCTGGGGTTGCTGATTCTGG + Intronic
1165717748 19:38057517-38057539 ACTCCTGGTGTTGCTCATTGAGG + Intronic
1165749897 19:38253286-38253308 AGTCCTGGAATGTCAGATTCTGG + Intronic
1165949459 19:39465946-39465968 ACTCTTGGATTTTCAGATTTGGG - Intronic
1167237315 19:48322665-48322687 ACTCCTAGAGATCCTGAATCAGG + Intronic
1168722019 19:58559388-58559410 GTTCCTGGAGATTCTGATTGAGG + Intergenic
925010218 2:479319-479341 CCCTCTGGAGTTTCTGACTCGGG - Intergenic
925162712 2:1697095-1697117 ACTCCCAGAGTTTCTGATTCTGG - Intronic
925270315 2:2601436-2601458 ACCCCAAGAGCTTCTGATTCAGG + Intergenic
926395500 2:12438296-12438318 GTTCCTGGAGATTCTGATTCAGG + Intergenic
926822927 2:16872920-16872942 GTTGCTGGAGTTTCTGACTCTGG + Intergenic
926856227 2:17259107-17259129 ACTCTGGAAGTTTCTGATTGGGG + Intergenic
928941773 2:36734095-36734117 ACCCCTGTAGTTTTTGACTCAGG - Intronic
929140745 2:38664770-38664792 ACCTCTGGAATTTCTAATTCTGG - Intergenic
929410433 2:41693075-41693097 TCCCCTGGAGCTTCTGTTTCAGG + Intergenic
929855146 2:45631234-45631256 AATCCTGAAGTTTCCTATTCTGG + Intergenic
930105526 2:47636180-47636202 ACCTCTGGAGTTTCTCATTCAGG + Intergenic
930739765 2:54819273-54819295 ACTCCAGGAGATTCTGATGGAGG - Intronic
930979689 2:57508537-57508559 CCTCCAGGAGATTCTGATGCAGG + Intergenic
932040953 2:68299248-68299270 ACTCATGTAATTTCTCATTCAGG - Intronic
932556202 2:72826718-72826740 ACATCTGGAGATTCTGATCCAGG + Intergenic
933803083 2:85978426-85978448 CCTCCTGGAGTTTTTGCATCTGG + Intergenic
933864744 2:86505886-86505908 GCTCCTGGAGGTTCTGGCTCTGG + Exonic
935460908 2:103332527-103332549 ACTCCTGGAGCTTCAGTCTCAGG - Intergenic
936002908 2:108851694-108851716 TTTCCTGGACTTTCTGATTGTGG - Intronic
936419263 2:112347849-112347871 TTTCCTGGAATTTCTGATACTGG + Intergenic
938524121 2:132108764-132108786 ACAACTGGAGTTTCTGGTGCTGG - Intergenic
939164546 2:138626504-138626526 ATGCCTAGAGTTTTTGATTCAGG - Intergenic
941018998 2:160388393-160388415 ACCCCAAGAGTTTCTGATGCAGG + Intronic
942480883 2:176386934-176386956 TCTCTTGGAGATTCTGATTCAGG + Intergenic
943041759 2:182812671-182812693 ACTCCTAGAGTTTCTGATTCGGG - Intergenic
943165851 2:184324790-184324812 ACTTCCAGAGTTTCTGATTCAGG - Intergenic
943208139 2:184927623-184927645 ACTTCTAAAGTTTTTGATTCTGG - Intronic
943399817 2:187393784-187393806 ACTCCAAAAATTTCTGATTCAGG + Intronic
944922279 2:204428070-204428092 AATTCTGGAGTTTGTGATGCAGG + Intergenic
945994036 2:216420970-216420992 ACTACTGGAGTTTCTGATTCTGG + Intronic
946432776 2:219634478-219634500 ACTCCTGGAGTCTGTGCTTGAGG + Exonic
946698968 2:222391696-222391718 AATTTTGGAGTTTCAGATTCGGG - Intergenic
946705833 2:222457965-222457987 TATCCTGGACTTTCTGATTTAGG - Intronic
946821879 2:223638361-223638383 CCTCCAGGAGATTCTGATGCAGG - Intergenic
947125010 2:226859655-226859677 AATCCTGGAGCTACTGATTTGGG + Intronic
947849013 2:233269411-233269433 ACTCAAGAAGTTTCAGATTCTGG - Intronic
948278192 2:236726040-236726062 ACTCATGGAGTTTATGTTTTGGG + Intergenic
1170681321 20:18528184-18528206 ATTCCCGGGGTTTCCGATTCAGG - Intronic
1171153326 20:22847099-22847121 ACTCCAGCAGCTTCTGCTTCGGG - Intergenic
1171177396 20:23062785-23062807 ATCCCCAGAGTTTCTGATTCAGG - Intergenic
1171788863 20:29499557-29499579 ACACCTGCTGATTCTGATTCAGG + Intergenic
1174373117 20:50107253-50107275 AACCTTGGAGTTTCAGATTCAGG - Intronic
1174568895 20:51487093-51487115 TCTCCCGGAGTTTCTCACTCAGG + Intronic
1176772500 21:13091835-13091857 ACAACTGGAGTTTCTGGTGCTGG + Intergenic
1178088407 21:29136046-29136068 ACTCCTATATATTCTGATTCAGG + Intronic
1178575826 21:33789296-33789318 ACACCTGAAATTTCTGATGCTGG + Intronic
1179260909 21:39757526-39757548 ACACCAGGGGTTTCTGTTTCAGG + Intronic
1179596494 21:42446197-42446219 ACTCCTGGACTTTCTTATGCTGG + Intronic
1180437304 22:15321346-15321368 ACAACTGGAGTTTCTGGTGCTGG + Intergenic
1180520154 22:16191612-16191634 ACAACTGGAGTTTCTGGTGCTGG + Intergenic
1180632644 22:17240422-17240444 CGCCCTGGAGTTTCTGAGTCGGG - Intergenic
1181754748 22:25015807-25015829 ACATCTGGTGTTTCTGACTCTGG - Intronic
1184166896 22:42734882-42734904 ATCCCTGGGGCTTCTGATTCAGG + Intergenic
1184582343 22:45426148-45426170 TCTCCTGGATTTGCTGCTTCTGG - Exonic
949200669 3:1375152-1375174 ACACCTGAAGATTCTGATCCAGG - Intronic
949325447 3:2858258-2858280 ACTCTTGGAATTTCTTATTCTGG - Intronic
949578374 3:5361061-5361083 ACCCCTGGAGTTTCTGATTCAGG - Intergenic
950400023 3:12762785-12762807 ACTCCTGGAGTTTCTGATTCAGG - Intronic
950761330 3:15231268-15231290 ACGCCCAGAGTTTCTGATTCTGG + Intronic
950836126 3:15920674-15920696 CCTCCAGGAGATTCTGATGCAGG + Intergenic
951033235 3:17905738-17905760 ACCCTCAGAGTTTCTGATTCGGG + Intronic
955203439 3:56873814-56873836 CCTCCTGAAGTTTGTAATTCTGG + Intronic
956647188 3:71467792-71467814 CCTCTTTGAGTTTCTGATTCAGG + Intronic
957447683 3:80336630-80336652 ACTCCTGTTGTTTATGATTGTGG + Intergenic
957726472 3:84073134-84073156 ACTCTTGGAGTTTTTGGTTAGGG - Intergenic
957774490 3:84738357-84738379 GTTCCTGGAGTTTCACATTCAGG - Intergenic
957833479 3:85553669-85553691 ACTACCAGAGATTCTGATTCAGG + Intronic
958449984 3:94260633-94260655 ACCCCCGGAGTTTCTGATATGGG - Intergenic
959087183 3:101863896-101863918 AATCCTGGAGATTCTGATTCAGG - Intergenic
959571800 3:107892791-107892813 TCCCCCAGAGTTTCTGATTCAGG + Intergenic
959774583 3:110141646-110141668 ACTCCTAGAGTTTCTGATCCGGG + Intergenic
961365043 3:126394433-126394455 CCACCCCGAGTTTCTGATTCTGG + Intergenic
963034071 3:141010008-141010030 GCCCCTGGAGTTTCAGATTTGGG + Intergenic
963360537 3:144267306-144267328 ACCTCTAGAGTTTCTGATGCAGG - Intergenic
964423504 3:156529582-156529604 ACCCGCTGAGTTTCTGATTCAGG - Intronic
964543650 3:157807937-157807959 ATCTCTGGAGTTTCTGATTCAGG - Intergenic
964570448 3:158104015-158104037 AAACCCGGAGTCTCTGATTCGGG - Intronic
964600542 3:158496335-158496357 ACTCCCAGAGTTTCTGATTCAGG + Intronic
964798480 3:160526584-160526606 ACCCATAGAGTTTCTGCTTCAGG - Intronic
964956593 3:162366257-162366279 ACTGCTGGAGTTTCAGTTTTAGG - Intergenic
965767629 3:172147654-172147676 ACCCCCAGGGTTTCTGATTCAGG + Intronic
965925413 3:173972866-173972888 ACCCCTAGAGTTTCTGATTCAGG - Intronic
965980020 3:174678212-174678234 ATTCCTGGAGATACTGATTTAGG + Intronic
966890539 3:184404632-184404654 ATTCCTGGAGATTCTGGTTTAGG - Intronic
966960515 3:184933055-184933077 ACCCCCAGAGTTTCTGATTCAGG - Intronic
967032102 3:185617458-185617480 ACTTCTGAACTTTCTAATTCAGG + Exonic
967518163 3:190396139-190396161 AATCCTGGGATTTCTTATTCTGG - Intronic
969948669 4:10811238-10811260 ACCCCCAGAGTATCTGATTCAGG + Intergenic
970796858 4:19923178-19923200 TGTGCTGGAGTCTCTGATTCTGG - Intergenic
973075666 4:45922667-45922689 ACTTCTAGAGATTCTGATTCAGG - Intergenic
974086574 4:57267361-57267383 GGTCCTGGACATTCTGATTCAGG - Intergenic
975372776 4:73607685-73607707 ATCCCCAGAGTTTCTGATTCAGG - Intronic
975697349 4:77026437-77026459 AGTCCTGGAGAGGCTGATTCAGG - Intronic
977583208 4:98747144-98747166 ATTCCTGGACTTTATGACTCAGG + Intergenic
977646511 4:99418729-99418751 ACTACTGGTGTCTCTCATTCAGG + Intronic
977791766 4:101113248-101113270 ATCTCTGGAGATTCTGATTCAGG - Intronic
983340787 4:166458237-166458259 ACTTTTGGTGTTTCTGATTATGG - Intergenic
984357950 4:178689342-178689364 ATTCATGGAGTTTCAGATTCTGG - Intergenic
984806868 4:183758902-183758924 ACTCTCGGAGTTTCTCATTCTGG - Intergenic
985279633 4:188272492-188272514 ACTACTTCAGTTTCTGATTATGG - Intergenic
985436808 4:189938654-189938676 TCACCTGGTGATTCTGATTCAGG - Intergenic
985526118 5:402752-402774 GCTACTGGTGTCTCTGATTCTGG - Intronic
985631316 5:1015546-1015568 ACCCAGGGAGTTTCTGATGCAGG - Intronic
986199537 5:5569048-5569070 CCTCCTGGAGTGTCTGGCTCTGG + Intergenic
987575233 5:19718980-19719002 ACTGCTGTAGTTTGTGATTTGGG - Intronic
988446107 5:31287752-31287774 ATCCCCTGAGTTTCTGATTCTGG + Intronic
988651691 5:33158905-33158927 AGTTGTGGAGATTCTGATTCAGG - Intergenic
989131165 5:38107632-38107654 ACCTCAGGAGATTCTGATTCTGG + Intergenic
990935638 5:61145937-61145959 ACTCCATGAGGTTCTGCTTCAGG + Intronic
991675884 5:69089555-69089577 TTTCCTGGAATTTCTGATACTGG + Intergenic
995068292 5:107887791-107887813 ACCCCTGGAGAATCTGATTCCGG + Intronic
995728193 5:115204282-115204304 ACCCCCAGAGTTTCTAATTCAGG + Intergenic
997059857 5:130488231-130488253 ACTCTTGGGGTTTTTTATTCCGG + Intergenic
997069322 5:130601386-130601408 AAACCCAGAGTTTCTGATTCAGG + Intergenic
997463855 5:134073376-134073398 ACCCCTGGAATTTCTGATTCAGG - Intergenic
998745339 5:145252062-145252084 CCTCTAGGCGTTTCTGATTCTGG - Intergenic
998785988 5:145709375-145709397 ACTTGTGGAGTTTCTGACTTTGG + Intronic
999142729 5:149373215-149373237 ACATCTAGAGGTTCTGATTCAGG - Intronic
999329704 5:150664108-150664130 ACTCCTGAGGATTCTGACTCAGG + Intronic
999976436 5:156916421-156916443 ACCCCCAGAGTTTCTGATTCTGG + Intergenic
1001240841 5:170068803-170068825 ACCCCCAGAGTTTCTGATTCAGG + Intronic
1001374458 5:171242714-171242736 ACTCCTGGAATGTCTCACTCAGG + Exonic
1001639961 5:173237073-173237095 ACGCCTCGAGTTTCTGAGCCAGG + Intergenic
1003404087 6:5814591-5814613 GCTCCAGGAGTTTCTGATCCTGG - Intergenic
1003562618 6:7195436-7195458 ACTACTAGAGTCTCAGATTCTGG - Intronic
1003923229 6:10853245-10853267 ACTTCTTGAATTTCTGGTTCTGG - Intronic
1004009795 6:11672923-11672945 ACTCCTCTAACTTCTGATTCTGG + Intergenic
1004748046 6:18532289-18532311 ACTTCCAGAGTTTCTGATTCAGG + Intergenic
1005008534 6:21313701-21313723 ACTCCCAGGGTTTCTGATTCAGG + Intergenic
1006155503 6:32010982-32011004 CCACCTGGAGTTTCTGGGTCCGG + Intergenic
1006161835 6:32043836-32043858 GCCCCTGGAGTTTCTGGGTCCGG + Exonic
1006942474 6:37762197-37762219 ACACCCAGAGTGTCTGATTCAGG + Intergenic
1007150907 6:39689871-39689893 ACACCTGAAGTTTTTAATTCCGG - Intronic
1007286284 6:40749848-40749870 ACTCCGTGGGTTTCTGATCCTGG - Intergenic
1008496422 6:52138528-52138550 ACCCCCAGAGTTTCTGATTCAGG - Intergenic
1011384694 6:86782331-86782353 ACTCCCAGAGTTTTTGATTTAGG + Intergenic
1011446985 6:87451717-87451739 ACTCCTATAGTTCCTGATTCTGG + Intronic
1011606159 6:89107785-89107807 TCTCTTGGAGGTTCTGATTCAGG + Intronic
1011624379 6:89271408-89271430 ACTCCCAGAGATTCTGAATCAGG + Intronic
1012501494 6:99893060-99893082 ATTCCAGTAGCTTCTGATTCAGG + Intergenic
1014546604 6:122743228-122743250 TTTCCTGGAGTTTCTGGTACTGG + Intergenic
1016900183 6:149093233-149093255 CCTCCAGGAGATTCTGATACTGG + Intergenic
1017696285 6:157019645-157019667 ACTCCTGAAGGTTCTGTTTTAGG + Intronic
1017934377 6:158991744-158991766 ACCCCTGGAGGTTCTAATGCAGG + Intronic
1018392127 6:163348673-163348695 CCTCCTGGAGTTTGTGTTTGTGG + Intergenic
1020334708 7:7053875-7053897 ATTCCCAGAGTTTCTGATTCAGG - Intergenic
1022336287 7:29424925-29424947 CATCCTGGAGCTTGTGATTCTGG + Intronic
1022504711 7:30902945-30902967 ACTCCAGGTGTTTGTGAGTCTGG + Intergenic
1023652955 7:42390041-42390063 ACTCCCAGAGCTTCTGATTCAGG + Intergenic
1023776185 7:43609979-43610001 AACCCTAAAGTTTCTGATTCAGG + Intronic
1026175057 7:67989494-67989516 GCCCCTGGAATTTCTCATTCAGG - Intergenic
1026566750 7:71495832-71495854 ACTCCAGGAGTATCTGATTTTGG + Intronic
1027904835 7:84166147-84166169 ACTCCTGTAGTCTCAGATTCTGG + Intronic
1027956928 7:84891441-84891463 ACTCAAAGAGTTTCAGATTCTGG - Intergenic
1028519840 7:91717545-91717567 CCCCCTGGAGATTCTGATTCAGG - Intronic
1029209829 7:98897899-98897921 GCTCCTGTAGTTTCGGATACTGG + Intronic
1031145096 7:117988863-117988885 ACTCCAGGTAATTCTGATTCAGG + Intergenic
1031308905 7:120168855-120168877 ACCCCTAGAGATTCTGTTTCAGG + Intergenic
1032761452 7:134947335-134947357 GCTCCTGGACTCTGTGATTCCGG + Intronic
1034891669 7:154845017-154845039 AGTCCTGGTTTTTCTAATTCAGG - Intronic
1036005997 8:4663977-4663999 GCTCCTGTTGTTTCTGGTTCGGG + Intronic
1036499384 8:9299249-9299271 ACCCCAGGAGGTTCTGATGCAGG + Intergenic
1037434041 8:18844177-18844199 ACTCTTGGAGTTTTTAATCCTGG - Intronic
1037853204 8:22349814-22349836 ACTCCTGGGGTTTCAGAAGCAGG + Intronic
1038586806 8:28797102-28797124 CCTCCCAGAGTTTCAGATTCAGG + Intronic
1039483760 8:37895782-37895804 ACTCCTTGAGTTTCAGCTTCTGG + Intronic
1040888059 8:52286868-52286890 AGCCCCAGAGTTTCTGATTCAGG - Intronic
1041550790 8:59098587-59098609 AATCCTAGCCTTTCTGATTCAGG - Intronic
1042661530 8:71159919-71159941 CATCCTGCAATTTCTGATTCAGG - Intergenic
1043526570 8:81104128-81104150 ACTCCTAGAGTTTCCGGTTCTGG - Intronic
1046419187 8:113957326-113957348 ATGTATGGAGTTTCTGATTCAGG + Intergenic
1046501628 8:115085172-115085194 TCTCCTGGAGTCTCTGAGTGGGG - Intergenic
1046729041 8:117705429-117705451 ACTCAAGGTGTTTCTGAATCAGG - Intergenic
1047174612 8:122528688-122528710 CCTCCTTGAGTTTGAGATTCTGG + Intergenic
1048749123 8:137650856-137650878 ACTCCAGAAGTTCCTGCTTCAGG - Intergenic
1048861257 8:138725871-138725893 ACCCCTGGTGATTCTGATCCTGG - Intronic
1050247276 9:3703802-3703824 ACTCTCTGGGTTTCTGATTCAGG - Intergenic
1050480144 9:6080283-6080305 ACTCCTCCAGTTCCTGTTTCAGG + Intergenic
1050624075 9:7485166-7485188 ACCCTCAGAGTTTCTGATTCAGG - Intergenic
1053724939 9:40990131-40990153 TCTCCTGCTGATTCTGATTCAGG - Intergenic
1054341029 9:63861870-63861892 TCTCCTGCTGATTCTGATTCAGG + Intergenic
1054412927 9:64839832-64839854 ACAACTGGAGTTTCTGGTGCTGG - Intergenic
1054870884 9:70046182-70046204 ACTTCCTGAGTGTCTGATTCAGG + Intronic
1055071522 9:72171399-72171421 ACTCCTTGAGATTCTAAATCTGG + Intronic
1055355702 9:75435116-75435138 ACCCCCAGAGTTTCTGAGTCAGG + Intergenic
1055480086 9:76701119-76701141 ACCCCCAGAGTTCCTGATTCCGG + Intronic
1055781209 9:79823535-79823557 ACCCCTAAAGTTTCTGAATCAGG - Intergenic
1055792774 9:79941041-79941063 ACTATTGGAGTTTGAGATTCAGG + Intergenic
1056407135 9:86285103-86285125 AGTCCTCAATTTTCTGATTCAGG + Intergenic
1057644450 9:96859814-96859836 ACTGTTGGAGTCCCTGATTCAGG + Intronic
1057686857 9:97242329-97242351 ACACCCAGGGTTTCTGATTCTGG - Intergenic
1058324019 9:103672581-103672603 ACTCCTGGAGTTTCTGATTCAGG + Intergenic
1058884867 9:109315286-109315308 ACTCCAGGTGATTCTGATGCAGG - Intronic
1059343923 9:113615654-113615676 TCTCCTGGCCTTTCTGATTCTGG - Intergenic
1060155038 9:121313715-121313737 TCTCCTGGAGTTTCTGAGTCAGG + Intronic
1060216256 9:121740225-121740247 CAGCCTGGAGATTCTGATTCAGG + Intronic
1060222298 9:121771107-121771129 ACTTCTGGAGATTCTGACTCAGG - Intronic
1060258065 9:122050079-122050101 ACTGCTGGAGTCTCTGAGTGGGG - Intronic
1060322096 9:122571978-122572000 AGCCTTGCAGTTTCTGATTCTGG + Intergenic
1060693987 9:125690270-125690292 ACTTCTGAAGTTTCTGATCAGGG - Intronic
1186938319 X:14475461-14475483 ACTCCAGGTGATCCTGATTCAGG - Intergenic
1187038534 X:15568010-15568032 ACCCCTAGAGCGTCTGATTCAGG + Intronic
1187067973 X:15859443-15859465 ATTCCCATAGTTTCTGATTCAGG + Intergenic
1187442930 X:19336173-19336195 ACTCCCAGAGTTTCTTATTCAGG + Intergenic
1187510519 X:19913571-19913593 ACCCCCAGGGTTTCTGATTCAGG + Exonic
1187726006 X:22202929-22202951 AATCCCAGAGTCTCTGATTCAGG - Intronic
1187813689 X:23208330-23208352 ACTCCTGGATTATCTCATACCGG + Intergenic
1188359190 X:29231676-29231698 ACCCCAGGTGATTCTGATTCGGG + Intronic
1188460552 X:30421948-30421970 ACTACTGGATTTTCTTATACAGG - Intergenic
1188649511 X:32614407-32614429 ACTCTTTCAGTTTCTGATTCTGG + Exonic
1189052018 X:37655666-37655688 ACTTCTGGATTTCCTTATTCAGG + Exonic
1189967677 X:46391396-46391418 ACCCCTAGAGTTTCTGATTCTGG - Intergenic
1196679489 X:118456081-118456103 GCTCCCAGAGATTCTGATTCTGG - Intergenic
1197077293 X:122367298-122367320 TCTCCTGGAGTTTCTGTTTTTGG - Intergenic
1198090790 X:133327451-133327473 AATCTTGGAGTTCCTCATTCAGG + Intronic
1198836251 X:140807580-140807602 ACTCCTGTTGTTTCTCACTCTGG + Intergenic
1199156149 X:144551214-144551236 ACACCTGGGGTCCCTGATTCAGG + Intergenic
1199378371 X:147138637-147138659 ACTTCAGCAGTTTCTGCTTCGGG + Intergenic
1199927032 X:152478577-152478599 CCTCCTGGAGTTTCAAATTCTGG - Intergenic
1201259863 Y:12148408-12148430 TTTCCTGGAATTTCTGATACTGG + Intergenic