ID: 950403755

View in Genome Browser
Species Human (GRCh38)
Location 3:12791437-12791459
Sequence TTGGAGATACAGATGGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950403755_950403766 24 Left 950403755 3:12791437-12791459 CCTTCCCCCATCTGTATCTCCAA No data
Right 950403766 3:12791484-12791506 GATGTATTCAGTTGTCAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950403755 Original CRISPR TTGGAGATACAGATGGGGGA AGG (reversed) Intergenic
No off target data available for this crispr