ID: 950407338

View in Genome Browser
Species Human (GRCh38)
Location 3:12813003-12813025
Sequence CCTCCACCAGGGGCACCAGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 370
Summary {0: 1, 1: 1, 2: 3, 3: 36, 4: 329}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950407338_950407347 10 Left 950407338 3:12813003-12813025 CCGCCTGGTGCCCCTGGTGGAGG 0: 1
1: 1
2: 3
3: 36
4: 329
Right 950407347 3:12813036-12813058 CCTGGATGATGATGAGCTCCGGG 0: 1
1: 0
2: 1
3: 24
4: 494
950407338_950407345 9 Left 950407338 3:12813003-12813025 CCGCCTGGTGCCCCTGGTGGAGG 0: 1
1: 1
2: 3
3: 36
4: 329
Right 950407345 3:12813035-12813057 ACCTGGATGATGATGAGCTCCGG 0: 1
1: 0
2: 2
3: 7
4: 160
950407338_950407348 25 Left 950407338 3:12813003-12813025 CCGCCTGGTGCCCCTGGTGGAGG 0: 1
1: 1
2: 3
3: 36
4: 329
Right 950407348 3:12813051-12813073 GCTCCGGGAGTCCTGCCTCCAGG 0: 1
1: 0
2: 0
3: 8
4: 198
950407338_950407344 -8 Left 950407338 3:12813003-12813025 CCGCCTGGTGCCCCTGGTGGAGG 0: 1
1: 1
2: 3
3: 36
4: 329
Right 950407344 3:12813018-12813040 GGTGGAGGATTTCTGCAACCTGG 0: 1
1: 0
2: 0
3: 17
4: 433

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950407338 Original CRISPR CCTCCACCAGGGGCACCAGG CGG (reversed) Exonic
900505351 1:3027609-3027631 TCTCCACCAGGGGCAGGCGGGGG + Intergenic
900694528 1:4001634-4001656 CCTCCACCAGGGCCGCCAGTGGG + Intergenic
900715014 1:4138647-4138669 CCTTCCCCAGGGGCTCCAGCAGG - Intergenic
900998949 1:6137922-6137944 CCCCCACCAGGGGGAGTAGGGGG - Intronic
901266490 1:7914343-7914365 CCGCCACCGTGAGCACCAGGAGG + Intergenic
901416804 1:9122013-9122035 CCTCCACCAGGACCTCCATGGGG - Intronic
901510532 1:9716168-9716190 CCTCCCCCAGTGGCATCAGATGG + Intronic
901691083 1:10973827-10973849 CCTCCCCCAAGAGCACAAGGAGG - Intronic
902242748 1:15099749-15099771 CATCCCCCAGGACCACCAGGGGG - Intronic
902510644 1:16965319-16965341 CCCCGACCAGGAGCACCATGAGG - Intronic
902864785 1:19270747-19270769 CTGCCACCAGCTGCACCAGGAGG - Intergenic
902867004 1:19286184-19286206 CTGCCACCAGCTGCACCAGGAGG - Exonic
903373728 1:22852962-22852984 CTGTCACCAGGGGCTCCAGGAGG + Intronic
904376964 1:30087654-30087676 CCTCCACCAGGGGCAGTAGCTGG - Intergenic
906258415 1:44367993-44368015 CCTCACCCAGGGGCAGCAGGAGG - Intergenic
907306225 1:53514583-53514605 CCTCCTCCAGGGGCAACAAGGGG - Intronic
908028176 1:59972533-59972555 CCCCCAACAGGGGCAGCAGAAGG + Intergenic
908827672 1:68149229-68149251 CCTCCAGGTGGGGCCCCAGGTGG + Intronic
908829195 1:68162970-68162992 CGTCCAGCAGCGCCACCAGGGGG + Intronic
912827969 1:112923729-112923751 CTGCCACCAGCTGCACCAGGAGG + Intronic
912933023 1:113981221-113981243 CCTCCACCAGGTCTTCCAGGAGG - Exonic
916180895 1:162082764-162082786 ACTCTACCAGAGGCACCATGGGG - Intronic
917920365 1:179744730-179744752 CCTCCCCCAGGGCGCCCAGGGGG + Intronic
919917938 1:202150583-202150605 CCTCCAGCAGGGCCCCCAAGGGG - Intronic
920113520 1:203603572-203603594 CCTCCAACAGGAGCAGCTGGAGG + Intergenic
920228801 1:204456773-204456795 CATCTCCCAGGGACACCAGGAGG + Intronic
922540880 1:226418455-226418477 CCTCCACCCTGAGCCCCAGGAGG - Intergenic
923095091 1:230769056-230769078 CCTGCACCTGGGGCAGCAGAAGG + Intronic
923680368 1:236113788-236113810 CCTCCCCCAGGGCCTCCAGAGGG - Intergenic
924442392 1:244096964-244096986 CTTCCAACAGTGGCACAAGGAGG + Intergenic
924822162 1:247503772-247503794 CCTCCACATGGGGCTCCATGAGG + Intergenic
1063340814 10:5261774-5261796 GATACACCAGGGACACCAGGGGG - Intergenic
1063526630 10:6792888-6792910 ACTCCACATGGGGCAGCAGGAGG - Intergenic
1066166985 10:32798916-32798938 CCTGCACCAGTGGCCCCATGGGG - Intronic
1066277633 10:33884560-33884582 CCTCCAACAGTGGCACCAAGGGG - Intergenic
1067039111 10:42939702-42939724 CCTCCACCACGGCCACCCAGAGG + Intergenic
1067058242 10:43064685-43064707 TCTCCCCCAGGGCCTCCAGGTGG + Intergenic
1067461400 10:46461144-46461166 CCTCCACCAGTGAGACCACGGGG - Exonic
1067625794 10:47923457-47923479 CCTCCACCAGTGAGACCACGGGG + Intergenic
1067684824 10:48459814-48459836 CCACCAGCAGGGGCGCCAGGCGG + Exonic
1068839363 10:61592761-61592783 TCTCCACCAGTGACACCATGTGG + Intergenic
1069557570 10:69407929-69407951 GCTCCATGAGGGGCACCAGATGG + Intronic
1069568039 10:69476883-69476905 CCACCTCCAGGACCACCAGGCGG - Intronic
1069907760 10:71741876-71741898 CCTCCACAGTGGCCACCAGGTGG - Intronic
1070597593 10:77843541-77843563 CCTCCCCCAGCTGCTCCAGGCGG + Exonic
1071496004 10:86168104-86168126 ACTCCACCAGAGGCACTACGGGG + Intronic
1072625044 10:97105888-97105910 CCTCCGCCAAGGGCACCATCAGG + Intronic
1073057642 10:100712600-100712622 CCTCCACCAGGCCCCCCAGAGGG + Intergenic
1073243608 10:102074211-102074233 GCTCCTCCAGGGCCTCCAGGAGG - Intergenic
1074717025 10:116229054-116229076 TCTCCACCAGGGCCTCCAGAAGG + Intronic
1075025435 10:118980248-118980270 GCTCCACCAGGAGGAACAGGTGG + Intergenic
1075025451 10:118980292-118980314 GCTCCACCAGGAGGAACAGGTGG + Intergenic
1075025485 10:118980385-118980407 GCTCCACCAGGAGGAACAGGTGG + Intergenic
1075450742 10:122550391-122550413 TCAGCACCAGGGGAACCAGGAGG - Intergenic
1075778651 10:125003430-125003452 CGTCCAGCAGCGCCACCAGGGGG + Exonic
1075996968 10:126885285-126885307 ATTCCACCAGAGGCACGAGGAGG + Intergenic
1076136627 10:128049591-128049613 CCTCCTCCAGGTGCTCCACGGGG - Exonic
1076445807 10:130513054-130513076 CCTCAACCCTGGGCACCAGCAGG - Intergenic
1076869169 10:133184889-133184911 CCCCCACCAGGAGCGCCAGGTGG + Intronic
1077034902 11:489864-489886 CTTCCTGCAGGGGCAGCAGGGGG - Exonic
1077089333 11:771366-771388 CCTCCACCACGAGCGGCAGGCGG + Exonic
1077201298 11:1309014-1309036 CCTCCACCTGGGGGACCATTAGG + Intronic
1077201342 11:1309136-1309158 CCTCCCTCTGGGGCACCATGGGG + Intronic
1077218079 11:1403389-1403411 GCACCAGCAGGGGCACCAGCAGG - Intronic
1077231383 11:1459526-1459548 CCTGCACCAGTGGGACCAGCGGG - Intronic
1077407981 11:2391162-2391184 GCCCTGCCAGGGGCACCAGGAGG - Intronic
1077414446 11:2418238-2418260 CGGCCACCTTGGGCACCAGGAGG + Exonic
1077443674 11:2580295-2580317 TCTCCGTCAGGGGCACCAAGGGG - Intronic
1077808814 11:5616770-5616792 ACTCCAGCATGGGCAACAGGAGG - Intronic
1077864418 11:6210938-6210960 CCTCCACCAGGAGCCCAGGGTGG + Exonic
1077875897 11:6305335-6305357 CCTCCACCACCGACCCCAGGGGG - Intergenic
1078081398 11:8207146-8207168 CCTCCACCGGGAGCTCGAGGTGG - Intergenic
1081329978 11:41790674-41790696 CATCCACCAGGGGAAGGAGGTGG + Intergenic
1081712664 11:45227331-45227353 CATCCACCTGGGACACCAGCAGG - Intronic
1083160797 11:60852975-60852997 CCGCCACCAGGCGCACGAAGCGG + Exonic
1083363929 11:62130016-62130038 TCTCCACCACAGGCACCAGCTGG - Exonic
1083709507 11:64539372-64539394 CCCCAACCAGAGGCAGCAGGAGG + Intergenic
1083975821 11:66119064-66119086 CCTGAACCAGTGGCACCAGATGG + Intronic
1084101551 11:66952859-66952881 CTTCCACTGAGGGCACCAGGAGG + Intronic
1084330114 11:68425201-68425223 CCACCACCAGGGCCACAGGGCGG - Exonic
1084402795 11:68955082-68955104 CCTGCAACCGGGGCACCAGGTGG - Intergenic
1084556566 11:69879468-69879490 CCTCCCCCTGGGCCAGCAGGAGG - Intergenic
1084599707 11:70137548-70137570 CCTGGAGCTGGGGCACCAGGAGG - Intronic
1084991050 11:72925963-72925985 CCTCCCCCAGGAGCACAGGGAGG - Intronic
1085470490 11:76754277-76754299 CCTGTCCCAAGGGCACCAGGAGG - Intergenic
1086312544 11:85550502-85550524 GCGGCACCAGTGGCACCAGGGGG - Intronic
1087281611 11:96216921-96216943 ATTCCACCAGGGGCAGGAGGAGG + Intronic
1089478492 11:118786151-118786173 CCTCCTCCAGGGCCACCAGTGGG + Exonic
1089610037 11:119664005-119664027 CCTCCATTAGGGGCTCCAGGTGG - Exonic
1090204576 11:124877370-124877392 CCTCCACCTGGGGCGTCAGCGGG - Intronic
1091394004 12:142599-142621 TCTCCACCAGCAGCTCCAGGAGG - Intronic
1091795530 12:3295577-3295599 TCTCCACCCTGGGCAGCAGGAGG + Intergenic
1093053507 12:14532099-14532121 CCTCACCCACGGGCACCAGTGGG + Intronic
1094587865 12:31794428-31794450 ACTACACTAGGGGCACAAGGCGG + Intergenic
1095983017 12:47983404-47983426 CCTTCACCTGGGGGACCAGGAGG + Exonic
1095985608 12:47997610-47997632 CCAAGACCAGGGGGACCAGGGGG + Exonic
1096162339 12:49389266-49389288 CCTCCGCCAGGGGCGCCAAAAGG - Intronic
1096529380 12:52233545-52233567 CCTCCAGCGGGTGCGCCAGGAGG + Exonic
1097028987 12:56078580-56078602 CCTCAACCACTGTCACCAGGTGG + Intergenic
1097161270 12:57048260-57048282 CCTCCACCAAGGGTTCCAGGAGG + Exonic
1098301258 12:69056279-69056301 CCTCCTTCAGGGTCTCCAGGAGG - Intergenic
1100404616 12:94262662-94262684 CCTCCACCAGGTGCTCAAGGGGG + Intronic
1100431378 12:94534418-94534440 CCTCCCCCAGAGCCTCCAGGAGG + Intergenic
1101449221 12:104761188-104761210 CCTCCTCCCTGTGCACCAGGTGG + Exonic
1101603924 12:106233442-106233464 CCCGCACCAGGGGCTGCAGGTGG - Intergenic
1101744868 12:107531954-107531976 CCTACACCATGGGGAACAGGCGG + Intronic
1103637286 12:122317909-122317931 CCTGCAGCAGTGGAACCAGGGGG - Intronic
1112204738 13:97313574-97313596 CCTCCAAGAAGGGCACCAAGAGG - Intronic
1112209434 13:97361194-97361216 CCTTCAGCATGTGCACCAGGTGG + Intronic
1112442464 13:99434229-99434251 CTTCCACCAGGGGCTTCACGTGG - Intergenic
1113711337 13:112467283-112467305 CCTCCCCCAGGAGCCCCAGGTGG + Intergenic
1113787021 13:113007327-113007349 TCTGAGCCAGGGGCACCAGGAGG - Intronic
1116973701 14:51094297-51094319 CCTGGGCCGGGGGCACCAGGCGG + Exonic
1118862494 14:69675398-69675420 CGTCCACCAGGGCCAGGAGGAGG - Intronic
1119743092 14:77026909-77026931 GCTCCCCCAGGGGCTCCTGGGGG - Exonic
1119879429 14:78088704-78088726 CCTCCCCCAGGGCCACCAAAAGG - Intergenic
1120632233 14:86905374-86905396 CCTCCACCTGGGGCCCCAGTGGG - Intergenic
1121265481 14:92599577-92599599 ACTCCATCACAGGCACCAGGGGG - Intronic
1121598933 14:95188107-95188129 TTTCCACTAGGGTCACCAGGTGG - Exonic
1121903560 14:97718297-97718319 CCTCCAACAAGGGAACAAGGGGG - Intergenic
1122324620 14:100874957-100874979 CCTCCACCCTGGGCACAAAGGGG - Intergenic
1122353420 14:101110388-101110410 CCTCCTCCAGAGGCGGCAGGAGG + Intergenic
1122828952 14:104386395-104386417 GCTCCACCAGGCGCACACGGAGG - Intergenic
1122972537 14:105158238-105158260 CCTCCACCAAGTGCACGGGGTGG + Intronic
1122977095 14:105175205-105175227 CCTCCTCCAGGGGGACCAAGGGG + Intronic
1123938216 15:25204166-25204188 CCTCCTCCAGGGCCACCATCTGG - Intergenic
1124371638 15:29107638-29107660 CCTCCACCAGTGGCACCAGAGGG + Intronic
1125505785 15:40266773-40266795 CCTAGTCCAGGGGCAGCAGGAGG + Intronic
1125760684 15:42093809-42093831 CCACCACCTGGGGCACCGGGGGG + Intronic
1126850461 15:52793830-52793852 CCTCCACCCAGGGATCCAGGGGG + Intergenic
1128032692 15:64495647-64495669 CCTCCACCTGGAGGCCCAGGTGG - Intronic
1128539620 15:68517572-68517594 ACTCCAGCCGGGCCACCAGGCGG - Intergenic
1128992474 15:72272451-72272473 CCGCCACCACGGGCACAGGGCGG - Exonic
1129273515 15:74431745-74431767 CCACCCCCAGGGCCACCAGCTGG - Intronic
1131118006 15:89806172-89806194 CCTCAGCCAGGGGCACAGGGTGG - Exonic
1131364228 15:91824234-91824256 CATCCACCAGAGGCCCCAGAAGG + Intergenic
1132157350 15:99504922-99504944 CCTCCAGGAGGAGCTCCAGGAGG - Intergenic
1132196566 15:99918305-99918327 CCCCCACCCTGGGCACCAGAAGG + Intergenic
1132497924 16:272642-272664 CCTGCACCCAGGGCAGCAGGTGG + Intronic
1132814904 16:1821050-1821072 CCACCACCAGGGTCCCCAGGAGG + Intronic
1132937165 16:2486981-2487003 CCTCCTCCAGGGCCACCAGGGGG + Intronic
1133317395 16:4893141-4893163 CCTCAAATAGGGGCCCCAGGGGG + Intronic
1133813484 16:9178884-9178906 CCTCCAGGAAGGGCACCTGGAGG - Intergenic
1134685395 16:16154857-16154879 CCTCCACCAGCCTCACCTGGGGG + Exonic
1135773264 16:25233895-25233917 CTTCCAACAGCGGCACCATGTGG - Intergenic
1136545628 16:30953178-30953200 CCTCCACCATGGCCACCTGCAGG - Exonic
1136549140 16:30973039-30973061 CCTCCAGCAGGGGAAGCAGCGGG + Intronic
1136609360 16:31356935-31356957 CCTCCACCTGGGAGACAAGGAGG - Intronic
1138351927 16:56350664-56350686 CCACCTCCAGGAGCACCTGGGGG - Intronic
1138475626 16:57269214-57269236 CCTCCTCCAGGGGCCCCAAAGGG + Intronic
1141347322 16:83259112-83259134 CATCCACCATGAGCAGCAGGAGG - Intronic
1141675910 16:85517227-85517249 CCTCCCACAGAGACACCAGGAGG - Intergenic
1142128298 16:88420985-88421007 TCTCCAGCAGAGGCCCCAGGAGG + Intergenic
1142185062 16:88690956-88690978 CCTGCAGCCTGGGCACCAGGAGG - Intergenic
1142291053 16:89193699-89193721 CCTCCACCAGGGCCACCCGAGGG + Intronic
1142496947 17:310907-310929 CCTACAGCAGGGCCCCCAGGGGG + Intronic
1142817111 17:2435382-2435404 CCCCCACCAGGAGCAAGAGGGGG + Intronic
1143951913 17:10639381-10639403 CCTCCAAGAGGCGCACCAGCAGG - Exonic
1144584908 17:16482138-16482160 CCTGAACCTGGGGCTCCAGGAGG + Intronic
1145886343 17:28384829-28384851 CCTCCCCCAGGAGCAGCAGGTGG + Exonic
1146497420 17:33335657-33335679 CTACCACCAGGGTCACCAAGTGG + Intronic
1147263899 17:39224035-39224057 CCTGCACCAGGGGACCCAGCAGG - Intronic
1147315708 17:39619121-39619143 CCGCCCCCATGGGCACCAGCTGG + Intergenic
1147332495 17:39707060-39707082 CCTCTACCAGGGCTGCCAGGTGG + Exonic
1147374675 17:40016520-40016542 CCTCTACCAGGGGCTCCTGCAGG + Exonic
1147381327 17:40057972-40057994 CCCCCACTATGGGCAGCAGGTGG + Intronic
1147722426 17:42547287-42547309 CCTCCCCCAGCGGCCCCAGCAGG - Intergenic
1148239530 17:45991032-45991054 GCTCCACCAGAGGCCCCTGGGGG - Intronic
1148388703 17:47254548-47254570 CCTCCTCCAGTGTCCCCAGGTGG + Intronic
1148456117 17:47812404-47812426 GCTCCTCCAAGAGCACCAGGTGG - Intronic
1148790537 17:50170274-50170296 CCACCAGCAGGGGCACCAGGAGG - Exonic
1149782214 17:59407118-59407140 CCTACAGCAAGGGCTCCAGGAGG - Intergenic
1150764538 17:67993167-67993189 CCACCAGCAGGGTCACCAGCCGG + Exonic
1151183460 17:72346544-72346566 CCTCCAGAAGGGACACCATGAGG - Intergenic
1152121299 17:78420283-78420305 GCTTCACCAGAGGCACCAGTGGG + Intronic
1152284004 17:79402064-79402086 CCTCCACCCTGGGCTCCTGGTGG - Intronic
1152750525 17:82060506-82060528 CCTCCACCAAGGACACCGAGGGG + Intronic
1152792420 17:82288677-82288699 TCCCCACCAAGGGCACCATGTGG + Intergenic
1154223529 18:12478859-12478881 TCTCCACAAGGGGCAGTAGGTGG + Intronic
1156269669 18:35519229-35519251 ACTACACCAGGGGAACCATGGGG + Intergenic
1156829077 18:41468751-41468773 CCTCCACCTGGAGCCCCAGGAGG - Intergenic
1156862786 18:41857542-41857564 CCTCAACCAGAGGCAAGAGGAGG - Intergenic
1158589716 18:58768990-58769012 CCTGCCCCAGGGGCCCCAGATGG - Intergenic
1160339824 18:78080187-78080209 CCCCAGCCAGGGGGACCAGGTGG + Intergenic
1160568675 18:79801952-79801974 CCTTCGCCAGGGGTCCCAGGTGG + Intergenic
1160754581 19:750905-750927 CCACCCCCAGGGCCTCCAGGTGG - Intergenic
1160837495 19:1131722-1131744 CCTACCCCAGGGGCAGAAGGAGG + Intronic
1161459617 19:4389058-4389080 CCACCACCAGGGACACCACAGGG + Intronic
1161520831 19:4722865-4722887 TCTTCCCCAGGGGCCCCAGGAGG - Intronic
1161947124 19:7444379-7444401 CCTCCTCCAGGGACTCCTGGCGG - Exonic
1162424147 19:10583882-10583904 CCACCTCCAGGGACACCACGTGG + Intronic
1162456622 19:10788848-10788870 CTTCCCACAGGGACACCAGGAGG + Intronic
1162489936 19:10986044-10986066 AGTCAACCAGGGGCACCTGGAGG - Intronic
1162633058 19:11944039-11944061 CTTCCACCATGGGCACAAGGGGG + Intronic
1162845510 19:13389313-13389335 TCTCCAGGAGGGACACCAGGTGG + Intronic
1165742313 19:38211464-38211486 TATCCACCGTGGGCACCAGGAGG + Intronic
1166856653 19:45785713-45785735 GCTCCAGCAGGGGCACCTCGTGG + Exonic
1167002786 19:46755867-46755889 CCTCCACCATGCGCTCCAGCAGG - Exonic
1167341522 19:48919211-48919233 ACTCCTCCAGGGTCACGAGGCGG - Exonic
1167603151 19:50466127-50466149 CCTCCTCCTGGGGCTTCAGGAGG + Intronic
925481280 2:4277026-4277048 CCTCTCCCAAGGGCACCAAGTGG + Intergenic
927872573 2:26632975-26632997 CCCCCACCACGGGCACCACCGGG + Intronic
930755587 2:54968849-54968871 CCTCTCCCAGGGGCATGAGGAGG + Intronic
933428983 2:82150793-82150815 CCTCCAGCATGGGCAGCAGAGGG - Intergenic
933759437 2:85663793-85663815 CCGCCACCAGAGGTACCACGCGG + Exonic
937100367 2:119263868-119263890 CCTCCACCTGGGGCAGCAGCAGG + Exonic
937302609 2:120852416-120852438 CCCCCACCAGGGGTGCCAGGGGG + Intronic
938110739 2:128563258-128563280 CCTACACCAGGGGCCCGGGGAGG + Intergenic
941237722 2:162996021-162996043 CCTGCCCCAGAGGCACCGGGTGG - Intergenic
942486598 2:176446279-176446301 CCACCAGCTGGGCCACCAGGCGG + Intergenic
943051747 2:182921535-182921557 CCTGCACCAAGAGCACCAAGAGG + Intronic
943525319 2:189008963-189008985 CAAGGACCAGGGGCACCAGGAGG - Exonic
944461546 2:199955434-199955456 CCTCCAGCCGGGGTACCGGGAGG + Exonic
945433549 2:209793710-209793732 CCTCCAAAAGGGACTCCAGGTGG + Exonic
946249611 2:218404558-218404580 CCCCCACCAGCCCCACCAGGCGG + Exonic
946622910 2:221577671-221577693 CCACCACCAGGGGCCCAAGAAGG + Intergenic
946687082 2:222281165-222281187 AGTCCACCGGGGGCACCATGAGG + Intronic
947156230 2:227164774-227164796 CCGCCGCCAGGAGCACCAGCAGG - Exonic
947714693 2:232333654-232333676 GCTGCACAAGGGGCCCCAGGGGG - Intronic
948008021 2:234626760-234626782 TTTCCACCAGGTGCACCATGAGG + Intergenic
948983721 2:241508054-241508076 CCTCCGCCAGCAGCCCCAGGAGG + Exonic
1169358724 20:4929373-4929395 GCTCCAGCAGGGGAACAAGGTGG + Intronic
1169850723 20:10047572-10047594 GCTCCAGCAGGGGGACGAGGGGG - Intronic
1169900515 20:10547884-10547906 CCTCCACAAAGGCCACCTGGTGG + Intronic
1171400935 20:24872694-24872716 CCCCCACCATGGGGACCAGGAGG + Intergenic
1171408918 20:24933303-24933325 CCTCCACCAAGGGCACCAGGGGG - Intergenic
1173559521 20:43993003-43993025 CCTCCACCAGTGGCTCGAGATGG + Intronic
1175315731 20:58045316-58045338 CCTCCTCCCAGGGCAGCAGGAGG + Intergenic
1175890781 20:62314992-62315014 CCTCCATCAGGGGCACCGCGAGG + Intronic
1175972841 20:62695633-62695655 CGTCCTCCAGGGCCCCCAGGAGG + Intergenic
1176387814 21:6147867-6147889 CCTCCTCCAGGGTCACTGGGGGG - Intergenic
1178535035 21:33403790-33403812 CCCCCACCTGGGGCACCCGCAGG - Intronic
1178923287 21:36754326-36754348 CTTCCTCCAGGTTCACCAGGAGG - Exonic
1179310968 21:40196112-40196134 CCTTTACCTGGGACACCAGGAGG - Intronic
1179735658 21:43390381-43390403 CCTCCTCCAGGGTCACTGGGGGG + Intergenic
1180165354 21:46022895-46022917 CCGCCACCAGCGGGCCCAGGTGG - Intergenic
1180500192 22:15923315-15923337 CCTCCTCCAGGGCCACAGGGTGG - Intergenic
1181684736 22:24520503-24520525 TCCCCACCAGAGCCACCAGGTGG - Intronic
1182299482 22:29329720-29329742 CCTGCACCACGGGAACCAGCAGG + Exonic
1182299609 22:29330302-29330324 CCTCCACCAGGGCCACCCCCTGG + Intronic
1182908182 22:33956755-33956777 TCTGCACAAGGGTCACCAGGAGG + Intergenic
1183306642 22:37086382-37086404 CCTCCACCACGGGCTCCTGGCGG + Exonic
1183309807 22:37103270-37103292 GCACAAACAGGGGCACCAGGCGG + Exonic
1183508825 22:38223426-38223448 CTTCCAACTGGGCCACCAGGTGG + Intronic
1183828429 22:40405660-40405682 CCTCCTCCAGGAACAGCAGGAGG - Exonic
1184515031 22:44956645-44956667 CCTCCACAAGCGACCCCAGGAGG + Intronic
1184667796 22:45997721-45997743 CCTCCACCACTGGAACCTGGGGG + Intergenic
1185011079 22:48315060-48315082 AGTCCACTAGGGACACCAGGAGG + Intergenic
1185376161 22:50483515-50483537 CCTCCTACAGGGGATCCAGGTGG - Exonic
950020885 3:9787005-9787027 CCTCCACCAGGGCCTGCAGGAGG + Exonic
950033860 3:9870133-9870155 CCCCCATCAGGTGCAACAGGTGG + Intronic
950228906 3:11259112-11259134 CCACCACCAGGGGCATCAGCTGG - Exonic
950407338 3:12813003-12813025 CCTCCACCAGGGGCACCAGGCGG - Exonic
955303670 3:57809041-57809063 CCTCCACCAAGAGCACAGGGAGG - Intronic
960939146 3:122922279-122922301 CCTGCACCAGGTCCACCACGAGG + Exonic
961329503 3:126130362-126130384 TCTCCACCAGGGTCTCCAGGAGG + Intronic
961501715 3:127340931-127340953 CTTCCGTTAGGGGCACCAGGTGG + Intergenic
961655384 3:128438884-128438906 CCTCCAGCAGGGGCAGCGGCAGG + Intergenic
962386298 3:134935209-134935231 CCTTCACCAAGGTCACCAGTGGG - Intronic
964368998 3:155979905-155979927 CCTCCAGCAGGGACTTCAGGAGG - Intergenic
965834739 3:172838791-172838813 CCTCCAGCAGTGGCTCCAGTAGG + Intergenic
967036399 3:185651496-185651518 CCTCAGCCAGGGGCAGCAGGTGG - Intronic
968353170 3:198080139-198080161 TCTCCACCAAGTGCTCCAGGCGG + Intergenic
968903982 4:3443402-3443424 CCGCCTCCAGGGGGCCCAGGTGG + Exonic
969301259 4:6298839-6298861 TCTCCACCAGGCCCACCAGAAGG - Intronic
969484164 4:7462547-7462569 TCGCCTCCAGGTGCACCAGGAGG - Intronic
969598453 4:8161904-8161926 CTCCAGCCAGGGGCACCAGGAGG - Intergenic
969704197 4:8783148-8783170 CCATCACCATGGACACCAGGTGG - Intergenic
969845986 4:9920468-9920490 GCTCCAGCACGGACACCAGGCGG + Exonic
970333159 4:15004266-15004288 GCTCCAGCAGCAGCACCAGGCGG + Exonic
970954551 4:21794844-21794866 ACTCCAGCAGGGGCAACAGAGGG + Intronic
972158935 4:36198888-36198910 CCTCCACCAAGAGCACAGGGAGG + Intronic
974489888 4:62551137-62551159 CCTCCACCAGGTGAACAAGTTGG - Intergenic
974704227 4:65490622-65490644 CTTCCACCAGTGTCAGCAGGCGG + Exonic
980002675 4:127508584-127508606 CCTCCCCCAGTGTCATCAGGTGG - Intergenic
982504408 4:156198806-156198828 CATCCACCGGTGGCACGAGGTGG + Intergenic
983534120 4:168839321-168839343 CCCCCAACAGGGGCACCATCTGG - Intronic
985561210 5:587034-587056 CATCCACCAGGAGGGCCAGGGGG - Intergenic
985960901 5:3302592-3302614 CATCCCCCAGGGGGACCTGGAGG - Intergenic
985971278 5:3380642-3380664 CTCCCTCCAGGGGCTCCAGGGGG - Intergenic
986858814 5:11903737-11903759 CCCCCACCAGCGGCAAGAGGAGG + Intronic
988161292 5:27520853-27520875 TCTCCCCCAGGGCCTCCAGGAGG + Intergenic
996766604 5:127040562-127040584 ACTCCCCCAGGGCCATCAGGGGG - Intergenic
997989523 5:138532523-138532545 CCTCCACCAGTAGTACCAGTTGG + Intronic
998155981 5:139787591-139787613 ACTGCACCCGCGGCACCAGGCGG - Intergenic
999149158 5:149415304-149415326 CATCTACCAGGGGCGCCAGAGGG - Intergenic
999593912 5:153181271-153181293 CTTCTACCAGGGGTACAAGGAGG + Intergenic
1001807020 5:174595579-174595601 CCTCCAGCATGGGCAACAGAGGG - Intergenic
1002055336 5:176595384-176595406 CCTGGACCAGAGGCCCCAGGAGG + Intronic
1004171597 6:13299679-13299701 CCTCCACCTGGGTCAACTGGGGG - Intronic
1006163071 6:32049297-32049319 CCTCCACGAGGGGCAGCGCGTGG - Intronic
1006163711 6:32052697-32052719 CCTCCACGAGGGGCAGCGCGTGG - Intronic
1006168335 6:32079060-32079082 CCTCCACGAGGGGCAGCGCGTGG - Intronic
1006457655 6:34141205-34141227 CCACCAGCATGGGAACCAGGAGG - Intronic
1007291549 6:40791042-40791064 ACACCACCAGGGGCACCAAGTGG + Intergenic
1007387993 6:41532232-41532254 ACTCCAGCGGGGGCACCAGGTGG - Intergenic
1007716704 6:43860326-43860348 CCCTCACAAGGGGCAGCAGGTGG + Intergenic
1009402623 6:63274929-63274951 CCCGCACCAGGGGCTGCAGGTGG + Intergenic
1011559429 6:88599783-88599805 CCTCCACCAGAGGCACTGGGAGG + Intergenic
1012924678 6:105255304-105255326 CCTCCAGCATGGGCAACAGAGGG - Intergenic
1013366947 6:109443860-109443882 CCTACTCCTGGGGCAGCAGGAGG + Exonic
1016840500 6:148519944-148519966 ACTCCTCCAGGGACACCAGAAGG - Intronic
1017793617 6:157823018-157823040 CCTCGACCAAGGGCGCCCGGGGG + Intronic
1017918324 6:158850319-158850341 TCTCCACCAGGAGCACCGGATGG - Intergenic
1018777788 6:167034273-167034295 CTTCCACCTATGGCACCAGGTGG - Intronic
1018894634 6:168005241-168005263 GCTCCACCAGGGACCCTAGGAGG - Intronic
1019302169 7:311313-311335 CCCAGACCAGGGGCACCAGATGG + Intergenic
1019587653 7:1813922-1813944 TCTGCCCCAGGGGCAGCAGGGGG - Intergenic
1019761613 7:2816977-2816999 CCTCCTCCAGGGGTAGGAGGTGG - Intronic
1020117055 7:5481828-5481850 TCTCATCCAGGTGCACCAGGGGG + Exonic
1020133889 7:5575154-5575176 CATGCCCCAGGGTCACCAGGAGG + Intergenic
1020271655 7:6600208-6600230 CCTCTACCAGCGGGACCATGTGG - Exonic
1020276420 7:6627382-6627404 CCTCCCCACGGGGCACCTGGTGG + Intergenic
1022963692 7:35454159-35454181 CCCCTACCAGGGTCCCCAGGAGG + Intergenic
1023045826 7:36209396-36209418 CCTCCTCACAGGGCACCAGGTGG - Intronic
1024532707 7:50406661-50406683 CCTCAGCCAGGAGCACAAGGTGG + Intergenic
1024672201 7:51606631-51606653 CAGCCAACAGGGGCACCGGGGGG - Intergenic
1024713116 7:52040243-52040265 ACTCCACCAGGGGAATGAGGAGG - Intergenic
1029201437 7:98841879-98841901 CCTCTGCCAGGTGCACCGGGGGG - Intergenic
1029492970 7:100882282-100882304 GCTCCACCAGCGGGGCCAGGGGG - Intronic
1029732297 7:102446506-102446528 CCTCCACCATGGCCACCTGCGGG - Exonic
1030890421 7:114992933-114992955 CCTCTACTAGAGGCACAAGGAGG - Intronic
1033078111 7:138268302-138268324 CCTCCACAAATGGCACCAGCAGG + Intergenic
1033221152 7:139526797-139526819 CCCCCAGCAGGGGCTGCAGGAGG - Intronic
1033253075 7:139777475-139777497 CCCCCACCCGGGGCCCGAGGGGG - Intronic
1033609278 7:142950413-142950435 TCTCAACCAGAGCCACCAGGAGG + Intronic
1035564878 8:634938-634960 CCTTCCCCAGAGGCACCAAGAGG - Intronic
1035663472 8:1363991-1364013 CCTCTGTCAGGTGCACCAGGTGG + Intergenic
1036454212 8:8893450-8893472 CCTCCCCCAGGAGCTCGAGGAGG - Exonic
1036649565 8:10633659-10633681 CATCCACCCAGAGCACCAGGAGG + Intronic
1036926380 8:12909736-12909758 CCTCCTCCAGGGCCTCCTGGGGG + Intergenic
1037897478 8:22667685-22667707 CCTCCACCATTTGCTCCAGGAGG - Intronic
1045494744 8:102698897-102698919 CCTCCTCCAGGGGCTGCAGTGGG - Intergenic
1047588587 8:126302060-126302082 ACTCCACCCTGGGCACCAAGAGG + Intergenic
1049241403 8:141539203-141539225 CCTCCACGTGGTGCTCCAGGGGG + Intergenic
1049255947 8:141613955-141613977 CCTCCACCACTGGAACCAGCAGG - Intergenic
1049322779 8:142005892-142005914 CCTCGGCCAGTGGCCCCAGGTGG - Intergenic
1051894702 9:21975099-21975121 TCTCCCCCGGGGGCACCAGCCGG + Intronic
1053443949 9:38137072-38137094 CATCCACCTGGGGCAACAAGAGG - Intergenic
1054769516 9:69070440-69070462 GGGCCACCAGGGCCACCAGGAGG + Intronic
1055000618 9:71445853-71445875 CCTTCCCCAGGAGCAACAGGAGG + Intronic
1055620417 9:78119655-78119677 CCTCTCCCAGGGCCTCCAGGAGG + Intergenic
1056531094 9:87488487-87488509 CCTCCAGCCTGGGCAACAGGAGG + Intergenic
1056751765 9:89357027-89357049 CCTCGACCAGGGGTACAATGTGG + Intronic
1056924169 9:90818822-90818844 CCTAAATCAGGGGCACCAGAGGG - Intronic
1057740886 9:97710375-97710397 CCTCCAGAAGGGGCGCTAGGAGG - Intergenic
1059049089 9:110902838-110902860 CCTCCATCAGAGGCATCATGAGG + Intronic
1059318255 9:113445709-113445731 CCTCCAGCCTGGGCAACAGGGGG - Intronic
1060262454 9:122088347-122088369 CCTACACCAGGAGCTCCTGGAGG + Intronic
1060404887 9:123368270-123368292 CCTCCACCAGGGGAAAGAGATGG + Intronic
1060729339 9:126027371-126027393 CCTCCACTGGGGGCACGAGTGGG + Intergenic
1060932143 9:127495981-127496003 CCTCCAGGAGGGCCACCAGCTGG - Exonic
1061367730 9:130181343-130181365 CCACCACCAGGAGCAAAAGGAGG - Intronic
1061940547 9:133881500-133881522 CCTCCAGCAGAGGCAGCAGGTGG + Intronic
1062360671 9:136186507-136186529 CCTCCGCCAGGGACATCAGCTGG + Intergenic
1062392967 9:136341279-136341301 CCTGCACCGAGGGCTCCAGGGGG - Intronic
1062506987 9:136882610-136882632 CCTCCAGCAGGGGCAGGGGGAGG - Intronic
1062723822 9:138059756-138059778 CCTCCTTCAGGGTCCCCAGGTGG + Intronic
1185802308 X:3024097-3024119 CCCCGTCCAGGGGCTCCAGGTGG - Exonic
1189976154 X:46462858-46462880 CCTCACCCACGGACACCAGGTGG - Exonic
1189982916 X:46528777-46528799 CCTCACCCACGGACACCAGGTGG + Exonic
1190023841 X:46904005-46904027 CCTCACCCAGTGGCACCAGACGG + Intergenic
1190745069 X:53317653-53317675 CCTCCACCAGGGGGAGCCTGGGG + Intronic
1193919448 X:87407224-87407246 CCTCCCCCAAGAGCACAAGGAGG + Intergenic
1195310501 X:103628033-103628055 CCTCAACCAGAAGCACCAAGAGG + Intronic
1199847106 X:151699483-151699505 CATCCACCTGTGCCACCAGGTGG - Intronic
1200125707 X:153813424-153813446 CCACCACCAGGAGGACCAGGAGG + Intronic
1200143052 X:153911159-153911181 CCACCACCAGGGGCACAGGCTGG + Exonic
1200149658 X:153944906-153944928 CCTACACCAGGGGCCCCGGCAGG + Intergenic
1200531698 Y:4347694-4347716 CCTCCACCAGATGCAGCAGCAGG - Intergenic