ID: 950407394

View in Genome Browser
Species Human (GRCh38)
Location 3:12813234-12813256
Sequence CCTGCCCCACAGGTGCCCCA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 460
Summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 415}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950407380_950407394 26 Left 950407380 3:12813185-12813207 CCCTGTCCCCCACTCCTGTCCTG 0: 1
1: 0
2: 7
3: 48
4: 592
Right 950407394 3:12813234-12813256 CCTGCCCCACAGGTGCCCCAAGG 0: 1
1: 0
2: 3
3: 41
4: 415
950407384_950407394 20 Left 950407384 3:12813191-12813213 CCCCCACTCCTGTCCTGGCTGGA 0: 1
1: 1
2: 4
3: 71
4: 527
Right 950407394 3:12813234-12813256 CCTGCCCCACAGGTGCCCCAAGG 0: 1
1: 0
2: 3
3: 41
4: 415
950407385_950407394 19 Left 950407385 3:12813192-12813214 CCCCACTCCTGTCCTGGCTGGAT 0: 1
1: 0
2: 0
3: 32
4: 306
Right 950407394 3:12813234-12813256 CCTGCCCCACAGGTGCCCCAAGG 0: 1
1: 0
2: 3
3: 41
4: 415
950407388_950407394 12 Left 950407388 3:12813199-12813221 CCTGTCCTGGCTGGATCCAGCAA 0: 1
1: 0
2: 3
3: 31
4: 337
Right 950407394 3:12813234-12813256 CCTGCCCCACAGGTGCCCCAAGG 0: 1
1: 0
2: 3
3: 41
4: 415
950407386_950407394 18 Left 950407386 3:12813193-12813215 CCCACTCCTGTCCTGGCTGGATC 0: 1
1: 0
2: 1
3: 22
4: 253
Right 950407394 3:12813234-12813256 CCTGCCCCACAGGTGCCCCAAGG 0: 1
1: 0
2: 3
3: 41
4: 415
950407389_950407394 7 Left 950407389 3:12813204-12813226 CCTGGCTGGATCCAGCAAAGCAT 0: 1
1: 0
2: 1
3: 7
4: 132
Right 950407394 3:12813234-12813256 CCTGCCCCACAGGTGCCCCAAGG 0: 1
1: 0
2: 3
3: 41
4: 415
950407387_950407394 17 Left 950407387 3:12813194-12813216 CCACTCCTGTCCTGGCTGGATCC 0: 1
1: 0
2: 2
3: 41
4: 334
Right 950407394 3:12813234-12813256 CCTGCCCCACAGGTGCCCCAAGG 0: 1
1: 0
2: 3
3: 41
4: 415
950407390_950407394 -4 Left 950407390 3:12813215-12813237 CCAGCAAAGCATTCCTCATCCTG 0: 1
1: 1
2: 2
3: 22
4: 203
Right 950407394 3:12813234-12813256 CCTGCCCCACAGGTGCCCCAAGG 0: 1
1: 0
2: 3
3: 41
4: 415
950407381_950407394 25 Left 950407381 3:12813186-12813208 CCTGTCCCCCACTCCTGTCCTGG 0: 1
1: 0
2: 8
3: 39
4: 527
Right 950407394 3:12813234-12813256 CCTGCCCCACAGGTGCCCCAAGG 0: 1
1: 0
2: 3
3: 41
4: 415

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950407394 Original CRISPR CCTGCCCCACAGGTGCCCCA AGG Exonic