ID: 950407695

View in Genome Browser
Species Human (GRCh38)
Location 3:12815002-12815024
Sequence CAGCATTTATAGATACCCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 101}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950407695 Original CRISPR CAGCATTTATAGATACCCTA TGG (reversed) Intronic
902381934 1:16056785-16056807 CAGCATTTTTGGTTCCCCTAAGG - Intronic
906901188 1:49837952-49837974 CACCATTTATAGTAACCCCAGGG + Intronic
909813555 1:79961139-79961161 CAGCATTTAAAGGTACCCCCAGG + Intergenic
910532334 1:88251770-88251792 CAGCATTTATTGAGAACCTATGG - Intergenic
912044207 1:105434431-105434453 CAGCATCTATAGCTACCAGATGG + Intergenic
912177713 1:107180970-107180992 CTGTATTTAGAGATCCCCTAAGG + Intronic
915709389 1:157880292-157880314 CAGCATTGATACATACCTTCAGG + Intronic
915775783 1:158484480-158484502 CAAGATTTATAAATATCCTAAGG - Intergenic
915794499 1:158714659-158714681 CAACATTTATAGTGACCTTAGGG - Intergenic
923288592 1:232521758-232521780 CAGCATTTAAAGACAACCTGAGG - Intronic
924748635 1:246863243-246863265 CAGCATTTATAGTGAAGCTAGGG - Intronic
1065820822 10:29523631-29523653 CAGCATATTTAGATTCCTTATGG + Exonic
1066330306 10:34414484-34414506 CAGCTTTTATAGAAACCTTAGGG - Intronic
1073511565 10:104045833-104045855 CAGCAATTCCAGATACCCTTGGG + Intronic
1073763245 10:106653907-106653929 CAGAATTTACAGCTATCCTAAGG - Intronic
1079369418 11:19837895-19837917 CAGAATTTATAGCTGCACTATGG + Intronic
1080728606 11:34923088-34923110 CAGAATTTTTAGATAGCATATGG - Intronic
1087118387 11:94546467-94546489 CAGTATTTAATGAAACCCTATGG + Exonic
1087911092 11:103754236-103754258 CAACAGTTTTACATACCCTAAGG + Intergenic
1088819404 11:113444632-113444654 CACCATTTATAGATGGCCCATGG - Intronic
1095822319 12:46491749-46491771 CAGCTTTTAAGGATACACTAGGG - Intergenic
1095887806 12:47207089-47207111 CAGCATGTAGAGTTACCCTGTGG + Intronic
1098079748 12:66771511-66771533 CAGCCTTAACATATACCCTATGG - Intronic
1102089870 12:110176987-110177009 TAGCATATATAGTTACTCTAGGG + Intronic
1104815063 12:131640838-131640860 CAGCATTTGCAGATTCCCCAGGG - Intergenic
1108973086 13:56401825-56401847 CAGGATCTATAGATACCATCTGG - Intergenic
1110714650 13:78687245-78687267 CAGCATTTACAAAAACACTACGG - Intergenic
1115879502 14:37899309-37899331 CATCATGTAGAGATCCCCTAAGG + Intronic
1118101021 14:62602395-62602417 CAGCTGTTATAGAAACACTATGG + Intergenic
1120274882 14:82359961-82359983 CAGAATTTATAAATGTCCTATGG - Intergenic
1120275740 14:82370492-82370514 CAGCATTTCTAGATCTCCTAGGG + Intergenic
1125305851 15:38312516-38312538 CACCTTTTATAGATACTGTAGGG - Intronic
1125313825 15:38409677-38409699 CAGCATTTGTACAAACCCCACGG - Intergenic
1125853338 15:42925162-42925184 CAGCATATAAAGATACTCAAAGG + Intergenic
1128222685 15:65980328-65980350 CAGCGTTTAGTGATGCCCTATGG + Intronic
1128680907 15:69650657-69650679 CAGCATGTACAGAAGCCCTAAGG - Intergenic
1128847304 15:70911067-70911089 CAGCAAGAATAAATACCCTAAGG + Intronic
1130075122 15:80682031-80682053 CAGCATTAATAGAAACCATGTGG + Intronic
1141034135 16:80613160-80613182 CAGAATTTCTATATATCCTAAGG + Intronic
1143930147 17:10414094-10414116 GAGAATTTATACATATCCTAAGG + Intronic
1149950545 17:60980234-60980256 CACCATTTATATTTCCCCTATGG + Intronic
1155977323 18:32145012-32145034 CAGCATGTATGGAGACCCTCTGG - Intronic
1159293307 18:66450084-66450106 CAGTACTAAGAGATACCCTAAGG + Intergenic
925255539 2:2483452-2483474 AAGCATTTATAGATTGCCTGAGG - Intergenic
928817507 2:35317205-35317227 CATCATCTATAATTACCCTAAGG - Intergenic
929751300 2:44716489-44716511 CAGGATTTAAAAATACACTATGG - Intronic
930465803 2:51748397-51748419 CAGCTTTTATAGATATTCTTAGG + Intergenic
934739531 2:96709796-96709818 TTGCATTTAGGGATACCCTATGG + Intronic
935896592 2:107745496-107745518 CAGCAGTCATAGATGCACTAAGG - Intergenic
939216522 2:139245901-139245923 AAGCATTTATACATTCCCTTGGG - Intergenic
941782911 2:169464333-169464355 CAGCTTTTATAGATAACTTTAGG - Intergenic
946677527 2:222177718-222177740 CATCATTTTCAGATACCCTAAGG - Intergenic
1170138682 20:13103563-13103585 CTGCATTTAGAGACACCCTTTGG - Intronic
1170526892 20:17247735-17247757 GAGCATCTACAGATTCCCTAAGG + Intronic
1174437198 20:50517632-50517654 AAGGTTTTATGGATACCCTATGG + Intronic
1174530566 20:51209706-51209728 CGTCATTTAAAGAAACCCTATGG + Intergenic
1175632201 20:60550692-60550714 CAGGATTTCTAGATACTCTCTGG - Intergenic
950407695 3:12815002-12815024 CAGCATTTATAGATACCCTATGG - Intronic
953304217 3:41811644-41811666 CAACATTTATTAATACCCCATGG - Intronic
957117661 3:76047070-76047092 CAGCATCGATAGAGATCCTATGG - Intronic
957222481 3:77401921-77401943 CAGCATCTGTATATACCCAAAGG + Intronic
957508259 3:81154639-81154661 AAGGATTTACAGAAACCCTATGG + Intergenic
959529737 3:107420192-107420214 CTACATTTATAGACACCTTAGGG - Intergenic
960607477 3:119521975-119521997 CAGCCTTTATAGAAACAGTATGG + Intronic
963714583 3:148788368-148788390 CAGCATTTACAAAGGCCCTAGGG - Intergenic
964322825 3:155515979-155516001 AAGCAATTATAAATGCCCTAAGG + Intronic
964594643 3:158410706-158410728 CAGCATTTATAATTGCCCTTAGG + Intronic
978359561 4:107915545-107915567 CATCATTTCTAGATAATCTAAGG - Intergenic
979050175 4:115920799-115920821 CAGCATCTATGCAGACCCTAGGG + Intergenic
979962194 4:127034456-127034478 CAGCATTTAGAGAGTCCCTAAGG + Intergenic
983809161 4:172036886-172036908 CAGCACTGAAAGTTACCCTAGGG + Intronic
984181850 4:176493131-176493153 CAGCCTTTATAAACACTCTATGG - Intergenic
987611258 5:20206749-20206771 CAGCATCTATTGATATCATATGG - Intronic
988162227 5:27533397-27533419 CAGCAATTAGAGAAACTCTAGGG - Intergenic
988948023 5:36226401-36226423 CATTATTTCCAGATACCCTAGGG - Intronic
994202431 5:96993008-96993030 CAGCATATATAGAAACCTAAAGG - Exonic
994876505 5:105429446-105429468 CAACATTTATAGAAAACCTAAGG - Intergenic
999708489 5:154295291-154295313 CAGCATTTATTGAACACCTATGG + Intronic
1000450164 5:161375776-161375798 CAGCATTTAAAAATACTCAATGG + Intronic
1000853362 5:166368230-166368252 CAGCATTTGGAGGTACCTTAGGG - Intergenic
1007144630 6:39615959-39615981 CAGTAATTATATAAACCCTATGG - Intronic
1010761411 6:79727609-79727631 AAGCATTTATAGAGCCTCTAAGG - Intergenic
1011422067 6:87183698-87183720 AAGCATAAATAGATACACTAAGG + Intronic
1012609949 6:101204921-101204943 TAGTATTTATATATAACCTATGG + Intergenic
1013769168 6:113608112-113608134 CAGAATTTATTGATACTGTAAGG + Intergenic
1018185845 6:161264833-161264855 CAGCAGTTATGGAACCCCTAGGG + Intronic
1019188914 6:170238688-170238710 CAGCATGTACAGAGACCCCAAGG - Intergenic
1019573960 7:1727279-1727301 CATCATTTCTAGCTACCCCAGGG - Intronic
1023234160 7:38066407-38066429 CTGCATTCATAGTTATCCTATGG - Intergenic
1028601931 7:92610666-92610688 CAGCATTTCTAATTACTCTAAGG + Exonic
1028613426 7:92737721-92737743 CAGCATTAATGGATAACATAAGG - Intronic
1028823931 7:95246715-95246737 GAGTATTTATTGATCCCCTAAGG + Intronic
1029726248 7:102407342-102407364 CAGGTTTTAGAGATACCATAAGG + Intronic
1030891009 7:114999163-114999185 TACCATTTATAGAAACCCAATGG + Intronic
1031657804 7:124379956-124379978 CAACATTTCTAGATACACCATGG + Intergenic
1031746561 7:125505941-125505963 CAACATTTCTAGATACACCATGG - Intergenic
1045608263 8:103803589-103803611 CAGGTTTTATACATACCCAAGGG - Intronic
1049126801 8:140796705-140796727 CAGCATTTAAGAAAACCCTAAGG + Intronic
1052048239 9:23820014-23820036 CACCATTTATATATACCCAAAGG + Intronic
1055690003 9:78819777-78819799 CAGCATTTATAGATGCCTCAGGG + Intergenic
1060678262 9:125536984-125537006 CAGCATTTAAAGGAACCCTGTGG - Intronic
1061565085 9:131433374-131433396 CAGTACTTACAGAAACCCTAGGG + Intronic
1186691755 X:11985275-11985297 CAACATTTCTAGATACACTCTGG + Intergenic
1189640720 X:43067972-43067994 CAACATTTCTAGATACACCATGG + Intergenic
1192311939 X:70023952-70023974 GAGCACTTGTAGATGCCCTAGGG - Intronic
1193531635 X:82661321-82661343 CAGTTTGTATAAATACCCTAAGG - Intergenic
1193931759 X:87561873-87561895 CAGCATTTCTAGATCCACTCTGG + Intronic
1197118137 X:122857639-122857661 CAGCATATACAAATACCCTATGG - Intergenic
1197276639 X:124487339-124487361 CGGCATTTAGAGAGACTCTATGG + Intronic
1197282663 X:124555241-124555263 CAGCATGTATATATGCCCTGAGG - Intronic
1197535949 X:127689606-127689628 CAACATTTCTAGACACCCTCTGG - Intergenic