ID: 950416647

View in Genome Browser
Species Human (GRCh38)
Location 3:12872746-12872768
Sequence GGGCCTTCTGGACCTTCATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 3, 3: 9, 4: 102}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950416647_950416653 -1 Left 950416647 3:12872746-12872768 CCTGATGAAGGTCCAGAAGGCCC 0: 1
1: 0
2: 3
3: 9
4: 102
Right 950416653 3:12872768-12872790 CCGCCCATGTGCATGGCCAGTGG 0: 1
1: 0
2: 0
3: 8
4: 138
950416647_950416656 4 Left 950416647 3:12872746-12872768 CCTGATGAAGGTCCAGAAGGCCC 0: 1
1: 0
2: 3
3: 9
4: 102
Right 950416656 3:12872773-12872795 CATGTGCATGGCCAGTGGCTCGG 0: 1
1: 0
2: 1
3: 19
4: 262
950416647_950416658 27 Left 950416647 3:12872746-12872768 CCTGATGAAGGTCCAGAAGGCCC 0: 1
1: 0
2: 3
3: 9
4: 102
Right 950416658 3:12872796-12872818 TGTGCACAGCCTTGAACATATGG 0: 1
1: 0
2: 2
3: 12
4: 153
950416647_950416649 -8 Left 950416647 3:12872746-12872768 CCTGATGAAGGTCCAGAAGGCCC 0: 1
1: 0
2: 3
3: 9
4: 102
Right 950416649 3:12872761-12872783 GAAGGCCCCGCCCATGTGCATGG 0: 1
1: 0
2: 5
3: 10
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950416647 Original CRISPR GGGCCTTCTGGACCTTCATC AGG (reversed) Intergenic
903256504 1:22105530-22105552 GGGCCTTCTGTTCCTTCAGGAGG + Intergenic
903364289 1:22796347-22796369 GGGCTTTCTGCTCCTTCCTCGGG + Intronic
904594584 1:31635368-31635390 GGGCCTTATGGACCACCAGCTGG - Exonic
909935656 1:81547327-81547349 GGGCCTTCTGCTCCTTCAAGAGG - Intronic
914782747 1:150800399-150800421 GGGCCCTCTGCACCTATATCAGG + Intronic
916501281 1:165389421-165389443 GGGCCCTCTGTACCTGCAGCTGG + Intergenic
919791106 1:201291562-201291584 GGGCCTTCTTGCCCGTCTTCTGG - Intronic
919847832 1:201652540-201652562 GGGCCTTGTGGCCTTTCTTCCGG - Intronic
919860179 1:201734747-201734769 GGGCCTGATGGACCCTCACCTGG - Intronic
920238934 1:204529515-204529537 GGGCCTTATGGACCACCAGCTGG - Intronic
1070427503 10:76303983-76304005 GGGCCTTCAGGGCTGTCATCAGG - Intronic
1071268068 10:83981981-83982003 GGGTCTTCTGAGCCTTCAGCAGG + Intergenic
1071782983 10:88867582-88867604 GGGCCTTATGGATCATCTTCTGG + Intergenic
1072020230 10:91392008-91392030 GGGCCATCTGGGCTTTTATCTGG + Intergenic
1073448523 10:103595442-103595464 GGGCCTACTGTCCCTTCATTAGG - Exonic
1073651173 10:105360128-105360150 GGGACTACTGCACCTTCTTCTGG + Intergenic
1075701100 10:124469952-124469974 GGGCCTCCTGCTCCTTCATCTGG - Intronic
1080814104 11:35737235-35737257 GGGCCTTATAGACCTTCTTAAGG + Intronic
1081926168 11:46830591-46830613 GAGTCTTATGGACCTACATCAGG - Intronic
1089654876 11:119940108-119940130 GGGCATTCTGGAGCTTCTTCAGG - Intergenic
1090737499 11:129622981-129623003 GGAGCTTCTGGAGCTACATCTGG + Intergenic
1091217245 11:133909753-133909775 GGCCCTTCTGGAGATTAATCAGG + Intronic
1095290989 12:40480144-40480166 GGGACAACTGGAACTTCATCTGG + Exonic
1100504796 12:95208876-95208898 TGGCCATCTGGAGCTTCATACGG + Exonic
1100537573 12:95525552-95525574 GGGCAATCAGGACCTTCCTCTGG - Intronic
1113614164 13:111669436-111669458 GGGCCTTCTGGAGCCTCGCCAGG - Intronic
1113619631 13:111754350-111754372 GGGCCTTCTGGAGCCTCGCCAGG - Intergenic
1114266669 14:21076387-21076409 CGTCCTGCTGGACCTTCGTCAGG + Exonic
1118349526 14:64963695-64963717 GGGGCTTCTTGAACTTCAGCTGG + Intronic
1122272226 14:100573420-100573442 GGGCCTCGTGCACCCTCATCAGG + Intronic
1123722836 15:23074801-23074823 GGGCCCTCTGGGCCTTGATGTGG + Intergenic
1126172666 15:45707371-45707393 GGGCTTTCTAGACTTTCACCTGG + Intergenic
1126750620 15:51873167-51873189 GGACCTTCTGGAACGTGATCAGG - Intronic
1128904274 15:71453101-71453123 AACCCTTCTGGACCTTGATCTGG + Intronic
1131060681 15:89402371-89402393 AAGCCTACTGGACCTTCTTCGGG - Intergenic
1132805610 16:1773733-1773755 GGGCCTCCAGGGCCTCCATCAGG - Exonic
1132859640 16:2063726-2063748 GGGCCTCCTGGAAGTTCCTCTGG + Intronic
1133427067 16:5701800-5701822 AGGTCATCTGGACGTTCATCAGG + Intergenic
1135693005 16:24559884-24559906 TTGACTTCTGTACCTTCATCAGG + Intronic
1136568004 16:31081397-31081419 GGGCCTTCTGGTGGTTCAGCAGG - Exonic
1139957187 16:70698639-70698661 GGGTCTTCAGGTCCTTCAGCTGG + Exonic
1141852994 16:86660232-86660254 TGGCCTTCTGGAAGTTCTTCAGG - Intergenic
1144717884 17:17446992-17447014 GGGCCTTCTGTGCCCTCACCTGG + Intergenic
1148850457 17:50552017-50552039 GGGCCTGCTGGACCTGTATGAGG + Exonic
1149231950 17:54544825-54544847 TGGCTTTCTGGTCCTTCCTCTGG - Intergenic
1152153284 17:78616301-78616323 GGGTCCTCTGGACCTTCTTAGGG - Intergenic
1152409100 17:80112981-80113003 GGGCCTTCTACCCCTTCATGCGG + Intergenic
1153223632 18:2881973-2881995 GGGCCTTCTGGAACATCTCCAGG + Intronic
1155382897 18:25244163-25244185 GGGTCCCCTGGACCTGCATCTGG - Intronic
1156128427 18:33937189-33937211 GAGCCTACTGCTCCTTCATCAGG - Intronic
1157088533 18:44607619-44607641 GGGCCTTCTGGTCCTTTGCCTGG - Intergenic
1157599229 18:48883571-48883593 GAGCCTTCTGGAGCTTCAGAAGG + Intergenic
1157602429 18:48902234-48902256 GGGCCTTCTAGGCCTTCATGGGG + Intergenic
1160237259 18:77095748-77095770 GTGGCTTCTGGACCTGCCTCTGG + Intronic
1161156319 19:2733473-2733495 GGACCTTCTGGAGCTGCAGCCGG + Exonic
1162562703 19:11426727-11426749 CGGCCTCCTGCGCCTTCATCTGG + Exonic
1162727107 19:12696329-12696351 GGGCCTTCTGAGCCTTCCCCCGG - Exonic
925176251 2:1785962-1785984 GGGCATGCTGGACTTTCCTCTGG - Intergenic
928538751 2:32264541-32264563 GGGTCTGCTGGGGCTTCATCAGG - Intronic
937117433 2:119418219-119418241 TGGCCTTCTGGCCCTTCTTCGGG + Intergenic
941060734 2:160843594-160843616 CAGCCTTCTGAATCTTCATCTGG - Intergenic
941188518 2:162346477-162346499 GGGCCTGTTTCACCTTCATCTGG + Intronic
943231279 2:185255601-185255623 TGGCCTTCTGCACCCTCAACAGG - Intergenic
947078208 2:226367023-226367045 GACCCTGCTGGACCTTAATCTGG + Intergenic
1170885087 20:20333801-20333823 TGACCTTCTGTGCCTTCATCAGG - Intronic
1172446624 20:34996784-34996806 GGGCCTTCTGAGCCTGCACCTGG + Intronic
1175245663 20:57580545-57580567 GGGCGTTCTAGACCTTGATCTGG - Intergenic
1175463442 20:59172507-59172529 GGGCCTTCTGGGTCTTCTTGAGG + Intergenic
1175639268 20:60613913-60613935 GGTCCTTCTGTCCCTTCACCAGG + Intergenic
1181456047 22:23060808-23060830 GGGGCTTCAGGACCCTCAGCTGG + Intronic
1184629961 22:45769419-45769441 GGGCCTTCTGTGCCCTCATCGGG - Intronic
949829791 3:8201609-8201631 GGGCCTTATGGACCCACTTCAGG + Intergenic
950304908 3:11910092-11910114 GTGCCTTCTGGACCTTCCTCAGG - Intergenic
950416647 3:12872746-12872768 GGGCCTTCTGGACCTTCATCAGG - Intergenic
950466064 3:13154308-13154330 GGGCCTTCTGGATCTTCCTCAGG + Intergenic
950787786 3:15450328-15450350 GGGCCTGGTGGACCATCACCTGG - Exonic
953022571 3:39125124-39125146 GGGACTTCTGCACCTCCTTCAGG - Exonic
953679846 3:45030894-45030916 GGGCCTGCTGCTCCTTCAGCAGG - Exonic
954914030 3:54134204-54134226 GGGCCTTCTGTGCCTTCGGCAGG + Intronic
961786133 3:129347942-129347964 AGGCCTTCTGGACCTTCCTCAGG - Intergenic
962468090 3:135679053-135679075 GGGGCTTTTGGACAATCATCAGG - Intergenic
964518622 3:157540377-157540399 GGGCCCTCTGGATCTCCATTTGG - Intergenic
967891186 3:194365692-194365714 GGACCTGCTGGACCTCCAGCAGG + Intronic
968132411 3:196199226-196199248 GGGCACTCTTGACCTTGATCAGG + Intronic
970459575 4:16259589-16259611 GGGCCCTTAGGACCCTCATCAGG - Intergenic
970896537 4:21110004-21110026 AAGCCTTCTGAACCCTCATCAGG + Intronic
983937255 4:173510552-173510574 GGGGCTTCTGGATCTCCATAGGG - Intergenic
984666582 4:182435623-182435645 GCTCCTTCTGGGCCTTTATCTGG - Intronic
989097638 5:37795927-37795949 GAGACTTCTGGCCTTTCATCAGG + Intergenic
989401696 5:41014618-41014640 GGGCCTTCTGGGCCTTTTTAAGG - Intronic
992409696 5:76493249-76493271 GGGCCCTGTGGATCTTCATGAGG - Intronic
998539886 5:142970666-142970688 GAGCCATCTGGACTGTCATCTGG + Intronic
999137136 5:149329412-149329434 GGGCATTTTTGACCTTCAGCTGG - Intronic
1014720578 6:124912743-124912765 GGTCGTTCTGGACCTTGTTCTGG - Intergenic
1015485415 6:133764428-133764450 TTGCCTTCTGGAATTTCATCAGG - Intergenic
1018068813 6:160142920-160142942 GGGCTTTCTGGGCCTTCAGGTGG + Intronic
1022053198 7:26700674-26700696 TGGCCTTCTTCACTTTCATCCGG + Intronic
1025191925 7:56902107-56902129 GGGCCTTCTGGCCCTGTTTCAGG - Intergenic
1025680025 7:63674824-63674846 GGGCCTTCTGGCCCTGTTTCAGG + Intergenic
1026441756 7:70450979-70451001 GGGCTTTCAGGACCTTCAGCTGG + Intronic
1036673119 8:10806255-10806277 GGGCTTTCTCAACCTTCTTCAGG + Intronic
1037900402 8:22684840-22684862 GGGCCTTCTTCCCCTTCCTCTGG + Intergenic
1048920516 8:139225780-139225802 GAGCCTGCTGGACCTTCCCCCGG + Intergenic
1050666012 9:7937321-7937343 GGGCCTTCAGGACCTTTCTCAGG + Intergenic
1051444967 9:17130167-17130189 TGGCATTCTGGATCTTCAACAGG + Intergenic
1054866792 9:70010858-70010880 GTGTCTTCTTGACCTTCATGGGG + Intergenic
1062527460 9:136983764-136983786 GGTCCCTCTGGACCTTCATGTGG - Intronic
1187366467 X:18669714-18669736 GGGCCTTATGCATCTCCATCTGG + Intronic
1192174388 X:68876790-68876812 GGGCCTTGTGGAGCTACAGCAGG - Intergenic
1192996880 X:76521195-76521217 GGGGCCTCTGGAACCTCATCAGG - Intergenic
1197262710 X:124334406-124334428 GGCCTCTCTGGACCTTCTTCTGG - Intronic
1197262759 X:124334592-124334614 GGCCTCTCTGGACCTTCTTCTGG - Intronic
1197262806 X:124334778-124334800 GGCCTCTCTGGACCTTCTTCTGG - Intronic
1200169688 X:154063609-154063631 GGGACTTCTGGCCCTTCCTTGGG + Intronic
1200235775 X:154467090-154467112 GGGGCTCCTGGACCGTCAGCAGG - Exonic