ID: 950416674

View in Genome Browser
Species Human (GRCh38)
Location 3:12872889-12872911
Sequence CCCGTTCCTGCTCTTTGTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 105}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950416674_950416680 -4 Left 950416674 3:12872889-12872911 CCCCAACAAAGAGCAGGAACGGG 0: 1
1: 0
2: 0
3: 13
4: 105
Right 950416680 3:12872908-12872930 CGGGAAGCAAGAAGCAGGCTGGG 0: 1
1: 0
2: 4
3: 29
4: 309
950416674_950416683 7 Left 950416674 3:12872889-12872911 CCCCAACAAAGAGCAGGAACGGG 0: 1
1: 0
2: 0
3: 13
4: 105
Right 950416683 3:12872919-12872941 AAGCAGGCTGGGGCAAGCATGGG 0: 1
1: 0
2: 2
3: 27
4: 254
950416674_950416684 17 Left 950416674 3:12872889-12872911 CCCCAACAAAGAGCAGGAACGGG 0: 1
1: 0
2: 0
3: 13
4: 105
Right 950416684 3:12872929-12872951 GGGCAAGCATGGGAGTGTTGTGG 0: 1
1: 0
2: 1
3: 22
4: 240
950416674_950416681 -3 Left 950416674 3:12872889-12872911 CCCCAACAAAGAGCAGGAACGGG 0: 1
1: 0
2: 0
3: 13
4: 105
Right 950416681 3:12872909-12872931 GGGAAGCAAGAAGCAGGCTGGGG 0: 1
1: 0
2: 8
3: 69
4: 626
950416674_950416678 -9 Left 950416674 3:12872889-12872911 CCCCAACAAAGAGCAGGAACGGG 0: 1
1: 0
2: 0
3: 13
4: 105
Right 950416678 3:12872903-12872925 AGGAACGGGAAGCAAGAAGCAGG 0: 1
1: 0
2: 2
3: 25
4: 373
950416674_950416682 6 Left 950416674 3:12872889-12872911 CCCCAACAAAGAGCAGGAACGGG 0: 1
1: 0
2: 0
3: 13
4: 105
Right 950416682 3:12872918-12872940 GAAGCAGGCTGGGGCAAGCATGG 0: 1
1: 1
2: 9
3: 44
4: 483
950416674_950416679 -5 Left 950416674 3:12872889-12872911 CCCCAACAAAGAGCAGGAACGGG 0: 1
1: 0
2: 0
3: 13
4: 105
Right 950416679 3:12872907-12872929 ACGGGAAGCAAGAAGCAGGCTGG 0: 1
1: 0
2: 2
3: 29
4: 302

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950416674 Original CRISPR CCCGTTCCTGCTCTTTGTTG GGG (reversed) Intergenic
902063689 1:13666300-13666322 CCCATTCCTGCTCTTCATTATGG - Intergenic
906734397 1:48110687-48110709 CTGGTTCCTTCTCTTTGTTCAGG - Intergenic
909368380 1:74855991-74856013 ATCTTTCCTGCTCTTTCTTGTGG + Intergenic
911670398 1:100601347-100601369 CTCTTTCCTGCTTTTTCTTGTGG + Intergenic
912555421 1:110512655-110512677 CCGGAGCCTGCTCCTTGTTGGGG + Intergenic
912867873 1:113275231-113275253 CCAGTTCCTGCTCATTCTTTGGG - Intergenic
914904610 1:151733583-151733605 CCTGTTCCTGGTCTCTGTTGAGG - Intergenic
916339768 1:163718934-163718956 ACCCTTCCTTCTGTTTGTTGTGG + Intergenic
917406686 1:174714074-174714096 CTTTTTCCTGCTCTTTGTAGTGG + Intronic
918131568 1:181634071-181634093 ACCGATCATGCCCTTTGTTGTGG + Intronic
921465679 1:215484223-215484245 TCCTGTCCTGCTCTTTGTTCTGG - Intergenic
922098785 1:222465257-222465279 CCCTTGCCTGCTTTTTGTTGGGG - Intergenic
923979447 1:239304612-239304634 CCCCTTTCTGCTCTTCCTTGGGG - Intergenic
1064191361 10:13208691-13208713 CCCCTTCCTCCTCTTTTTTTTGG - Intronic
1068886872 10:62106808-62106830 CTCGTTTCTTCTCTTAGTTGAGG - Intergenic
1069768470 10:70881848-70881870 CCCTTTCCTGGCCTTTGCTGGGG + Intergenic
1069915671 10:71785205-71785227 CCCGTTCCTGCACTGGGATGAGG + Intronic
1070410380 10:76134021-76134043 TCTGTTCCTGGACTTTGTTGGGG - Intronic
1074470632 10:113723414-113723436 CCAGCTCCTGCTGTTTCTTGGGG + Intronic
1078668583 11:13345810-13345832 CCTGTTCCTGCTCTTGGATCAGG + Intronic
1079296325 11:19237904-19237926 CCCTTTTCTGATCTCTGTTGCGG + Exonic
1085287325 11:75372106-75372128 CCCCTTCCTTCTCTTTATTGGGG + Intergenic
1085694444 11:78692042-78692064 CAGGTCCCTGCTCTTTGTTGTGG - Intronic
1093476997 12:19567101-19567123 ATCGTTCCTGCTTTCTGTTGTGG - Intronic
1097053164 12:56235637-56235659 CCTCTTCCTGCTCTTTGTGCTGG + Exonic
1103629780 12:122250916-122250938 CCCGTTCCTCCTCCCTTTTGGGG + Intronic
1108078772 13:46710722-46710744 CCTGTTCCTATTCATTGTTGAGG - Intronic
1113830775 13:113293984-113294006 CCCATTACTGATCTTTGCTGTGG + Intergenic
1116780157 14:49228097-49228119 CCCATTCCTGCAGTTTGATGAGG - Intergenic
1118668667 14:68099154-68099176 TCACTTCCTACTCTTTGTTGTGG + Intronic
1121537396 14:94700168-94700190 CGCGTTCTTGCTCTTTGTTTTGG - Intergenic
1123059636 14:105588692-105588714 CCAGTTCCTGCTCTGGGTGGGGG + Intergenic
1127773073 15:62245871-62245893 CCTCTTCCTGCTCTTGGTTCAGG + Intergenic
1127773118 15:62246170-62246192 CCTCTTCCTGCTCTTCGTTCAGG + Intergenic
1127773170 15:62246488-62246510 CCTCTTCCTGCTCTTGGTTCAGG + Intergenic
1128610249 15:69067345-69067367 TCCCTTCCTGGTCTTTGGTGGGG - Intergenic
1130435841 15:83898596-83898618 CCCATTTCTGCTCTTTCATGTGG - Intronic
1132920129 16:2384686-2384708 CTTGTTCCTGATCTTTGTGGGGG + Intergenic
1142308096 16:89296864-89296886 CCCATTCCTGCCCTCTGGTGGGG - Intronic
1144802566 17:17940576-17940598 CTTATTCCTGCTCTTTGTTCAGG - Intronic
1147749226 17:42718379-42718401 CCATTTCCTTCTCTTTGTTCTGG - Intronic
1152278399 17:79371413-79371435 CCCTTTCCTGCTCCCTGTGGGGG + Intronic
1152322390 17:79615098-79615120 CTCGTTCCTGCTCTTTTTTATGG - Intergenic
1155558571 18:27049968-27049990 CCGGAGCCTGCACTTTGTTGAGG - Intronic
1155679882 18:28475836-28475858 GCAGTTCCTGCTTTTTGCTGTGG - Intergenic
1157443812 18:47729930-47729952 GCCTTTCCTGCTCTCTGTCGGGG + Intergenic
1157630223 18:49087941-49087963 CCTGTGCCTGCTTTTTGATGGGG + Intronic
1159296775 18:66500504-66500526 CCCGTTCCTGCTATTTCAGGTGG + Intergenic
1162532842 19:11245763-11245785 CCCCTTCCTTCTCCTTGTTGGGG - Intronic
1164567658 19:29339469-29339491 CCTCTTCCTTCTCTTGGTTGAGG - Intergenic
1165007929 19:32821839-32821861 CCAGCTCCTCCTCTTTGCTGAGG - Intronic
1166679854 19:44759537-44759559 CGCCTTCCTGCCCTTTGCTGGGG + Exonic
1167023735 19:46898940-46898962 CCTGTTACTGCTCTGTCTTGGGG - Intergenic
1168331796 19:55574576-55574598 CCCTTTCTTGCTGTTTCTTGTGG + Intergenic
926731450 2:16038793-16038815 CCCGTTCCAGCTGTTTCTGGCGG + Intergenic
927922503 2:26983943-26983965 CCCGTCCCTTCCCCTTGTTGGGG + Intronic
932209227 2:69914195-69914217 CCGATTCCAGCTCTTTCTTGAGG + Intronic
935112494 2:100105402-100105424 CCCGGACCTGCTCTCCGTTGCGG + Intronic
936069095 2:109353505-109353527 CCCCTTGCTGCCCTATGTTGGGG - Intronic
945626561 2:212214610-212214632 CCAGTTCTTGCTCTATGTTCTGG - Intronic
1171482666 20:25465643-25465665 GCCGTCCCTGCTCTGTGATGTGG - Intronic
1172172487 20:32947692-32947714 CCCGTTACTACTGTTTTTTGTGG - Intronic
1173554090 20:43953367-43953389 CCCCTTCCTCCTGTCTGTTGTGG + Intronic
1175764034 20:61580904-61580926 TCGGGTCCTGCTGTTTGTTGGGG - Intronic
1176946523 21:14989067-14989089 CCTGTACCTGAGCTTTGTTGAGG + Intronic
1179547818 21:42124351-42124373 CCCGTGCCGGCTCTGGGTTGGGG + Intronic
1183860956 22:40669550-40669572 CCTGTACCTGGACTTTGTTGGGG + Intergenic
1185384918 22:50527182-50527204 CCCGGGCCTGCTCCTGGTTGGGG + Exonic
950053282 3:10007918-10007940 CCTGGTCCTGTTCTTTATTGGGG - Intronic
950187800 3:10956145-10956167 GCCATTCCTGCACTTTGTTGAGG + Intergenic
950416674 3:12872889-12872911 CCCGTTCCTGCTCTTTGTTGGGG - Intergenic
951609466 3:24476038-24476060 CCAGCTGCTGCTCTTTGGTGGGG + Intronic
956426417 3:69140274-69140296 CTCTTTCCTTCTTTTTGTTGGGG + Intergenic
959777194 3:110180818-110180840 CCGGTCTCTGCTCTTTGCTGAGG + Intergenic
961861389 3:129919199-129919221 CCTGGTCCTGCTCTTTATTGGGG - Intergenic
962476714 3:135761345-135761367 CCCTTTCCTGCTCATAGTTTAGG - Intergenic
962928107 3:140013400-140013422 CTTGTTCCGGCTCTTTGTTTTGG + Intronic
966411731 3:179652734-179652756 CCCAATCCTGCTCTTTGTGTTGG + Exonic
966963302 3:184963338-184963360 GCCTTTTCTGCTCTTTGGTGAGG + Intronic
967493633 3:190120387-190120409 CCCTTTTCCGCTCCTTGTTGGGG - Exonic
967520762 3:190429644-190429666 CCTGTTCCTGCTCCATGTTTTGG - Exonic
975413577 4:74083064-74083086 CACGTTCCTCCTCTTTCTTTTGG + Intergenic
975661849 4:76696471-76696493 CCAGTACCTTCTCTTTGTCGTGG + Intronic
976289315 4:83400914-83400936 CTCTTTCCTGCTCTCTCTTGTGG - Intergenic
980612291 4:135174567-135174589 CACGTTCCTCCTCTTTCTTTTGG - Intergenic
983303115 4:165952864-165952886 CCCATTCTTGCTCTTTAGTGGGG - Intronic
985997044 5:3602826-3602848 CCCGTTCCTGGTCCCTGTAGAGG + Intergenic
986103267 5:4633440-4633462 CCCATTCCAGCTCTTGGTGGAGG + Intergenic
986681294 5:10235179-10235201 CACTTTCCTGCTCTCTGTTTGGG - Intronic
991042283 5:62188323-62188345 CCCCTTCCTGCTCTGTGCTCAGG - Intergenic
993277214 5:85875783-85875805 CTAGTTCCTACTCTTTGTTTGGG - Intergenic
997956879 5:138285745-138285767 CCCCTTCCTGCACTTTGCTCTGG + Exonic
999561322 5:152806596-152806618 ACTGTGGCTGCTCTTTGTTGTGG - Intergenic
1000480711 5:161770005-161770027 CCCCTTCCTGCTATTTCCTGTGG - Intergenic
1002493798 5:179598508-179598530 CTGGTTCCTGCTCTTTCTTGTGG + Intronic
1003522361 6:6868914-6868936 CCCCTTCCTGCTCTTTCTTTGGG - Intergenic
1008236810 6:49060668-49060690 ACCTTTCCTGCTTTCTGTTGTGG - Intergenic
1015384863 6:132610486-132610508 CCAGTTTTTGCTCTTTCTTGGGG - Intergenic
1016249471 6:142022386-142022408 CCAGTTCCTGCAGTTAGTTGAGG + Intergenic
1018832757 6:167457654-167457676 CCGGTTCCTCCTCTTTGCTATGG - Intergenic
1020028202 7:4914523-4914545 CCAGCTCCCTCTCTTTGTTGGGG - Intronic
1020935709 7:14461133-14461155 ACCTTTCCTGCTCTTTCCTGTGG - Intronic
1028157672 7:87449966-87449988 ACCTTTCCAGCTCTTTGTTCTGG + Exonic
1033009652 7:137607106-137607128 CCTTTTCCTGCTCTTTACTGTGG - Intronic
1034495254 7:151417037-151417059 CCCGTTCCTGCTCTGTGGTCTGG - Intergenic
1034737031 7:153439057-153439079 CCCCTTCCCTCTCTTTGCTGTGG + Intergenic
1035630730 8:1104838-1104860 CCACTTCCTGCTCTCTGGTGAGG - Intergenic
1047344751 8:124016203-124016225 CCCATTCCTGCCTTTTCTTGTGG - Intronic
1047476763 8:125239950-125239972 CCCCTTCTTGCTCATTGCTGAGG + Intronic
1049305237 8:141899377-141899399 CTCGTTCCTCCTCTTTGATGTGG + Intergenic
1049400117 8:142422309-142422331 CCCTTTCTTGAACTTTGTTGAGG - Intergenic
1051164529 9:14247820-14247842 CCTGTTCCTGCTTTTAGTTTAGG - Intronic
1057801904 9:98195915-98195937 CCCTTCCCTGCTCTTTCTGGAGG - Intergenic
1060517952 9:124277500-124277522 CCCTTTCCTGCTGGGTGTTGGGG + Intronic
1062725050 9:138068136-138068158 CCTGTCCCTGGCCTTTGTTGTGG - Intronic
1191845860 X:65547517-65547539 CCCTTTCAGGCCCTTTGTTGAGG + Intergenic
1196367529 X:114940356-114940378 ACCTTTCCTGCTTTCTGTTGTGG + Intergenic
1199563884 X:149193926-149193948 ACCGTTCCTGCTTTCTCTTGTGG - Intergenic
1202034477 Y:20617954-20617976 GCCTTTCCTGCTTTCTGTTGTGG + Intergenic