ID: 950416678

View in Genome Browser
Species Human (GRCh38)
Location 3:12872903-12872925
Sequence AGGAACGGGAAGCAAGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 401
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 373}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950416669_950416678 25 Left 950416669 3:12872855-12872877 CCTGGAGTTCAACCAGTCATATA 0: 1
1: 0
2: 0
3: 8
4: 127
Right 950416678 3:12872903-12872925 AGGAACGGGAAGCAAGAAGCAGG 0: 1
1: 0
2: 2
3: 25
4: 373
950416672_950416678 -5 Left 950416672 3:12872885-12872907 CCTTCCCCAACAAAGAGCAGGAA 0: 1
1: 0
2: 3
3: 35
4: 303
Right 950416678 3:12872903-12872925 AGGAACGGGAAGCAAGAAGCAGG 0: 1
1: 0
2: 2
3: 25
4: 373
950416676_950416678 -10 Left 950416676 3:12872890-12872912 CCCAACAAAGAGCAGGAACGGGA 0: 1
1: 0
2: 0
3: 14
4: 130
Right 950416678 3:12872903-12872925 AGGAACGGGAAGCAAGAAGCAGG 0: 1
1: 0
2: 2
3: 25
4: 373
950416670_950416678 13 Left 950416670 3:12872867-12872889 CCAGTCATATAAGATTCTCCTTC 0: 1
1: 1
2: 2
3: 9
4: 130
Right 950416678 3:12872903-12872925 AGGAACGGGAAGCAAGAAGCAGG 0: 1
1: 0
2: 2
3: 25
4: 373
950416674_950416678 -9 Left 950416674 3:12872889-12872911 CCCCAACAAAGAGCAGGAACGGG 0: 1
1: 0
2: 0
3: 13
4: 105
Right 950416678 3:12872903-12872925 AGGAACGGGAAGCAAGAAGCAGG 0: 1
1: 0
2: 2
3: 25
4: 373

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950416678 Original CRISPR AGGAACGGGAAGCAAGAAGC AGG Intergenic
900502748 1:3014506-3014528 GGGAAGGGGAAGGAGGAAGCTGG + Intergenic
901090864 1:6640208-6640230 TGGAACGGGAGGCCAGAAGGTGG - Intronic
901464745 1:9413865-9413887 TGGAAAGGGAGGCAAGAAGCAGG + Intergenic
901501865 1:9657511-9657533 GGGAACGGAAAGCAGGAAGGAGG - Intronic
901852916 1:12027486-12027508 AGAACCGGGAAGCAAGTGGCTGG - Intronic
902797656 1:18809898-18809920 AGGAAAGGGAAGAAAGAAGAAGG + Intergenic
903533711 1:24052544-24052566 GGGCACAGAAAGCAAGAAGCTGG - Intergenic
903662149 1:24984771-24984793 GGGAACAGGAGGCAACAAGCAGG - Intergenic
904751630 1:32744060-32744082 AGGAACGGGAAGCCTGCAGAAGG + Intronic
904848833 1:33441542-33441564 AGGAAGGAGAAGGAAGAAGGAGG - Intergenic
904880182 1:33690402-33690424 AGGAAGGGGAATGAAAAAGCAGG - Intronic
905649692 1:39647914-39647936 AGGCAAGGGAAGCCAGTAGCAGG + Intergenic
905970394 1:42137589-42137611 AGGAACAGGCCCCAAGAAGCGGG - Intergenic
906089339 1:43165016-43165038 AGGAAAATAAAGCAAGAAGCAGG + Intronic
906376344 1:45299681-45299703 ATGAATGGGAAGCAAGAGGCAGG - Intronic
907767576 1:57425223-57425245 AGAAAAGGAAAGCAAGAGGCAGG + Intronic
909995660 1:82276184-82276206 AAGAACAGGAAGCAACAAACAGG - Intergenic
910364183 1:86446418-86446440 AGGCAAGGGGAGCAAGAAGTAGG - Intronic
911623124 1:100090165-100090187 AGAAAAGGGAGGCAAGAAACAGG + Intronic
912858917 1:113195741-113195763 AGAAAATGGAAGCAGGAAGCCGG - Intergenic
915047331 1:153029307-153029329 AGGACCGAGAAGCAGGAAGCAGG + Intergenic
915137983 1:153747133-153747155 AGGAACGGGAAAGAGGAATCAGG + Intronic
915289389 1:154872830-154872852 AAGAACTGGAGGCAAGAGGCTGG - Intergenic
915484486 1:156210717-156210739 TGGAAGGGGAAGCCAGAAGAAGG - Exonic
916385127 1:164258491-164258513 AAGAACTGTAAGAAAGAAGCAGG - Intergenic
916696991 1:167248457-167248479 GGGAAAGGGAGGCAAGGAGCAGG + Intronic
918363675 1:183784433-183784455 CAGAATGGAAAGCAAGAAGCTGG + Intronic
919082557 1:192883719-192883741 AGGAACAGGAAGAGAGAAGAAGG - Intergenic
919412633 1:197265294-197265316 AAGAAAGGAAAGAAAGAAGCAGG - Intergenic
919434832 1:197544977-197544999 AGGAAGGGGAAGAAGGAAGAAGG + Intronic
919739632 1:200973963-200973985 AGGAAGGGAAAGGAAGAAGAAGG + Exonic
919850489 1:201668867-201668889 AGGAAAAGGAAGCAAGCTGCAGG - Intronic
919944469 1:202309338-202309360 AGGAAGGGGAGGCATGAACCAGG - Intronic
920624956 1:207587858-207587880 AGGAACTACAAGCAAGAAGAAGG - Intronic
922010154 1:221575365-221575387 AGGAAGAGGAAGAAAGAAGGTGG + Intergenic
923252677 1:232191856-232191878 TGGAAGGGGAAGCCAGAAGGGGG - Intergenic
924066959 1:240233790-240233812 AAGAACTAGAAGCAAGAGGCAGG + Intronic
1063034156 10:2268706-2268728 AGGAATGTGAAGCAAATAGCTGG - Intergenic
1063230378 10:4060414-4060436 AAGAAGGGGAACCAAGAAGATGG + Intergenic
1063302917 10:4868173-4868195 AGCAACAGGAACCCAGAAGCTGG - Intergenic
1064033518 10:11898304-11898326 ATGAAAGGGAGGGAAGAAGCTGG + Intergenic
1064937477 10:20694275-20694297 AAGAACTGGAAGGAAGAAACAGG - Intergenic
1065933447 10:30499821-30499843 AGGAAAGGAAAGAAAGAAGGAGG + Intergenic
1066682722 10:37949591-37949613 AGGAAGGGGAAGTAAGACGCTGG + Exonic
1066682781 10:37950520-37950542 AGGCACTGGCAGCAAGAAGGTGG + Exonic
1067220239 10:44338725-44338747 AGGGAGGGGAAGTGAGAAGCAGG + Intergenic
1067703369 10:48589336-48589358 AGGAAGTTGAAGCCAGAAGCAGG - Intronic
1067800145 10:49353165-49353187 AGAAATGGGAACCAAGAAGCAGG + Intergenic
1068214490 10:53966412-53966434 AGGAAGGGAAAGCAAAAAGAAGG - Intronic
1069529845 10:69208996-69209018 AGGGACGAGAAGAAAGAAGAAGG + Exonic
1069895344 10:71677066-71677088 AGGAATGGGCAGAAAGCAGCTGG - Intronic
1070991199 10:80733528-80733550 GGAAAAGGGATGCAAGAAGCTGG + Intergenic
1071188283 10:83069637-83069659 AGGAACTAGAACCAAGAAGTGGG - Intergenic
1071718442 10:88120003-88120025 AGGAGGGGGAAGCAGGAAGGAGG + Intergenic
1071718510 10:88120210-88120232 AGGAAAGGGAAGCAGGAAGGCGG + Intergenic
1071729369 10:88232573-88232595 AAGAAGTGGAAGTAAGAAGCTGG - Intergenic
1071996971 10:91159018-91159040 AGAAGCAGGAAGCAGGAAGCAGG + Intergenic
1073724233 10:106211090-106211112 AGGAAAGTGAAGAAGGAAGCAGG + Intergenic
1073933212 10:108600062-108600084 AGGCACTTGAAGCAAGATGCTGG - Intergenic
1074965473 10:118487423-118487445 ATGAACGGGAAGCCTGAAGTGGG + Intergenic
1075429637 10:122369647-122369669 AGGAAAGGAAAGTAAGAAGCTGG - Intergenic
1075974834 10:126686052-126686074 AGGAACCAGGAGCATGAAGCTGG - Intergenic
1077254951 11:1576739-1576761 AGCTACGGGAAGCCTGAAGCAGG - Intergenic
1077477093 11:2795649-2795671 GGCAACGGAAAGCCAGAAGCTGG - Intronic
1078348151 11:10569914-10569936 AGGAAGGGGAAGAATGAATCAGG + Intronic
1078400315 11:11020537-11020559 AGGAAGGGGAAGGGAGAAGGGGG - Intergenic
1078513571 11:12004855-12004877 GGGAATGGGTAGCTAGAAGCAGG + Intronic
1079281081 11:19087856-19087878 AGGAACAGGAGGCAAGGAACAGG - Intergenic
1080432161 11:32209264-32209286 AGGAGGGGGAAGAAAGAAGAGGG - Intergenic
1080595576 11:33771832-33771854 AGGGACAGGAATCAAGAAGAGGG - Intronic
1080766946 11:35305855-35305877 GGGACAGGGCAGCAAGAAGCTGG - Intronic
1082159930 11:48880017-48880039 AGGACGCAGAAGCAAGAAGCAGG + Intergenic
1083754701 11:64785208-64785230 GGGGATGGGAGGCAAGAAGCAGG + Intergenic
1084475866 11:69389017-69389039 AGGGACTGGAAGCAAGCAGATGG + Intergenic
1084717931 11:70885318-70885340 AGGACCGGGGAGCAAAGAGCTGG + Intronic
1084771246 11:71344117-71344139 AGGGACGGGCAGGAGGAAGCGGG - Intergenic
1085227801 11:74938221-74938243 AGGAACTGCATCCAAGAAGCAGG - Intronic
1086079585 11:82889456-82889478 AGGAAGAGGAAGCGAGAAGAAGG + Intronic
1086101718 11:83107296-83107318 AGGAAGAGGAAGAAATAAGCTGG - Intergenic
1086763620 11:90666075-90666097 AGGATTTTGAAGCAAGAAGCTGG - Intergenic
1087593662 11:100225500-100225522 AGGAAAGGAAAGAAAGAGGCAGG - Intronic
1087986827 11:104692556-104692578 GGGGACAGGAAGAAAGAAGCGGG - Intergenic
1089394438 11:118126710-118126732 AGGAACAAGTACCAAGAAGCTGG + Intergenic
1089883981 11:121801610-121801632 AGGAAGAGGAAGGAAGAAGAAGG + Intergenic
1090259282 11:125306970-125306992 AGAAACGGGGAGGAAGAGGCTGG - Intronic
1090407396 11:126485213-126485235 AGGAACAAGGAGCAAGACGCAGG + Intronic
1091793493 12:3284540-3284562 AGCCACGGGAAGAAAGCAGCCGG + Exonic
1092153726 12:6268665-6268687 AGGAACGCGCAGCAGGGAGCCGG + Intergenic
1092493444 12:8967972-8967994 AGGAAAGGGAAGGAAGGAGGAGG + Intronic
1093683539 12:22030503-22030525 AAGTATGGGAAGCCAGAAGCAGG - Intergenic
1093767759 12:22984183-22984205 AGGCACGGGAAGTATGAAGTTGG + Intergenic
1094465046 12:30744172-30744194 AGGAACTTGAATCAAGTAGCTGG - Intronic
1096580573 12:52582236-52582258 ACGAATTGGAAGCAAGAAGGAGG + Intergenic
1096648061 12:53048840-53048862 AGGAGCAGGAAGCAAGTAGAAGG + Intronic
1096868017 12:54576684-54576706 AGGAACGGGCAGCAAGTGGTGGG + Exonic
1097028090 12:56073079-56073101 AGGAAAAGAAAGGAAGAAGCAGG - Intergenic
1097210001 12:57360495-57360517 AGGCATGGAAACCAAGAAGCAGG + Intronic
1098164563 12:67680657-67680679 AGGGAAGGGAAGGAAGTAGCTGG + Intergenic
1100398181 12:94203022-94203044 AGGAACAGGAAGTGGGAAGCGGG + Intronic
1100505433 12:95216085-95216107 AGGAAAAGAAAGCAAGAAGTGGG - Intronic
1100538103 12:95530545-95530567 AAGAAAGAGAAGCAAAAAGCTGG + Intronic
1100605814 12:96151144-96151166 AGGAAAAGGCACCAAGAAGCTGG + Intergenic
1100701759 12:97155880-97155902 GGGAAAGGAGAGCAAGAAGCAGG - Intergenic
1101758023 12:107636410-107636432 AGGAAAGGGAAACAGGAAGTAGG - Intronic
1102894187 12:116585417-116585439 AGGAAAGGTAAGCAGAAAGCAGG - Intergenic
1103307150 12:119974013-119974035 AGGAAGGGAAAGAAAGAAGGGGG + Intergenic
1105592814 13:21810370-21810392 GGGATCTGGAAGAAAGAAGCAGG - Intergenic
1106081137 13:26501084-26501106 AAGAACGGCAGGCAGGAAGCTGG - Intergenic
1106097347 13:26659801-26659823 AGCAACGGGAAGAATGGAGCTGG + Intronic
1106125277 13:26895906-26895928 TGGAAAGGGAGGAAAGAAGCAGG - Intergenic
1107891939 13:44921623-44921645 AGGAACGGGAAGGACAGAGCAGG - Intergenic
1108677632 13:52750976-52750998 AGAAAGGGGAGGCAGGAAGCTGG - Intergenic
1108808682 13:54192408-54192430 ACGAAAGGGGAGGAAGAAGCTGG + Intergenic
1110127770 13:71968315-71968337 ATGAACCAGAAGCAAGAAGAAGG - Intergenic
1110869311 13:80432044-80432066 GGGAAAGGGATGCAAGATGCCGG - Intergenic
1111731264 13:92079829-92079851 AGGAAAGGCAAGCGAGAGGCAGG - Intronic
1112223654 13:97515952-97515974 AGAAACAGGGAGCAAGATGCAGG + Intergenic
1112493417 13:99886823-99886845 GGGAGAGGGAAGGAAGAAGCAGG - Intronic
1112689055 13:101868853-101868875 ATGAATGGGCAGGAAGAAGCAGG + Intronic
1113303879 13:109054978-109055000 AGGAAAGGAAAGGAAGAAGGAGG - Intronic
1113588318 13:111480784-111480806 AGGAATGGGGAGCCAGAAGAAGG - Intergenic
1113704933 13:112424056-112424078 AGGCAGGAGAAGCAAGATGCAGG + Intronic
1114669163 14:24399627-24399649 AGGAACCAGAGGGAAGAAGCGGG - Intronic
1115535926 14:34373369-34373391 AGGAGGAGGAAGCAAGAAGGTGG - Intronic
1116091293 14:40310112-40310134 AGAAACGGGAAGAAGAAAGCAGG + Intergenic
1116680815 14:47967705-47967727 AAGAAAGGGAATCTAGAAGCTGG + Intergenic
1116825359 14:49668281-49668303 AGGAAAGGGAAGGAGGAAGGGGG + Intronic
1117558621 14:56912074-56912096 AGGAACAGGAAGGAGGAAGGAGG - Intergenic
1117800694 14:59441887-59441909 AGGAGAGGGAAGGAAGAAGAGGG - Intronic
1119997652 14:79271386-79271408 GGGAAGGGGAAGGAAGAAGGAGG - Intronic
1120077343 14:80173578-80173600 AGTGAAGGGAAGCAAGAAGAGGG - Intergenic
1120382127 14:83793788-83793810 AGGATTGGGAAGAGAGAAGCAGG + Intergenic
1120925517 14:89793642-89793664 AGGACCTGGAAGTGAGAAGCTGG + Intergenic
1121139780 14:91531273-91531295 AGAAATAGGAAGCAGGAAGCAGG + Intergenic
1121209831 14:92199912-92199934 AGGAGAGGGAAGAAAGATGCAGG + Intergenic
1121577591 14:95001089-95001111 AGGAAGAGAAAGCAAGAGGCAGG + Intergenic
1122353802 14:101111948-101111970 AGGAAGGGGAAGGAAGGAGGCGG - Intergenic
1124187293 15:27541858-27541880 GGGGACGGGACGCACGAAGCGGG - Exonic
1126779263 15:52124671-52124693 AGAAACAGGAAGCAAGGAACTGG - Intronic
1128372196 15:67048696-67048718 AGGACAGGGAAGCTGGAAGCTGG - Intergenic
1128846433 15:70901164-70901186 AGGAAGGAGAAGCAAAAAACTGG - Intronic
1129263571 15:74382256-74382278 AGGAACGGGAATGAAGAGGCAGG + Intergenic
1130363006 15:83207887-83207909 GGGAGCGGGAAGCGGGAAGCGGG - Exonic
1130577247 15:85103652-85103674 TGGAAAAGGAAGCAAGAACCTGG + Intronic
1130719781 15:86375313-86375335 AGGAAAGAGAAGCATGAAGGAGG + Intronic
1131449290 15:92525876-92525898 AGGAAAGGGAGGAAAGAAGGGGG - Intergenic
1132185336 15:99798345-99798367 AGGAAAGGGGAGGAAGAAGGAGG + Intergenic
1132875518 16:2135383-2135405 CGGGACGGGAAGCAGGACGCGGG - Intronic
1133468609 16:6052200-6052222 AGGAAATGGAAGGAAGAAGCAGG - Intronic
1133918151 16:10127721-10127743 AGGCACTGGAAGCAAGAAAAGGG + Intronic
1133964328 16:10519615-10519637 AGGAAGGGGAAGGAAGAGGAAGG - Intergenic
1134519469 16:14911977-14911999 CGGGACGGGAAGCAGGACGCGGG + Intronic
1134554467 16:15154258-15154280 CGGGACGGGAAGCAGGACGCGGG - Intergenic
1134707139 16:16310632-16310654 CGGGACGGGAAGCAGGACGCGGG + Intergenic
1134960401 16:18401492-18401514 CGGGACGGGAAGCAGGACGCGGG - Intergenic
1135931358 16:26740309-26740331 AGGAAAGGGAAGCAAGAGAGAGG + Intergenic
1136491884 16:30613936-30613958 AGGAAGGAGAAGAAAGAAGAAGG + Intronic
1139341337 16:66270006-66270028 AAGAACGGAAAGCAGGAAGGAGG + Intergenic
1139707438 16:68751072-68751094 AGGAAGGGGAAGGAATAAGTGGG - Intronic
1140814179 16:78605262-78605284 AGGAAGAGGAAGCAGGAGGCTGG - Intronic
1140877607 16:79167462-79167484 AGGAATGGGAGGTAAGGAGCTGG + Intronic
1141384486 16:83606881-83606903 AGTAACAGGAAGTAAGAAGCAGG + Intronic
1142714029 17:1738238-1738260 CGGGACGGGAAGGAAGAAGGAGG + Exonic
1143106733 17:4533971-4533993 AGGAACGTGAACCCAGAGGCAGG + Intronic
1143164509 17:4891282-4891304 AGACACAGGCAGCAAGAAGCAGG - Intronic
1143360924 17:6370534-6370556 AGGATTGGGCAGAAAGAAGCTGG + Intergenic
1143728719 17:8867706-8867728 AGGAAGGGGAAGGAAGAGGAGGG - Intergenic
1144291666 17:13832580-13832602 AGAAATGGGAAGGAAGAAGGAGG + Intergenic
1144564469 17:16348620-16348642 AGGAGCTTGAAGCGAGAAGCTGG + Exonic
1145107202 17:20128460-20128482 GGGAGCAGGAAGCAGGAAGCAGG + Intronic
1147183693 17:38702504-38702526 AGGTGCGGGAAGCGGGAAGCAGG + Intergenic
1147323137 17:39657931-39657953 AGGAAGGGGAAGGCAGAGGCTGG - Intronic
1148694034 17:49548495-49548517 AGGAAGGGGGAGCATGAGGCTGG - Intergenic
1148986991 17:51631492-51631514 AGGAGAGAGAAGCAAGAAGGGGG + Exonic
1148989863 17:51656342-51656364 AGGAACTGTAAGAAAGGAGCTGG + Intronic
1149389164 17:56172474-56172496 AGGACCAGGAAGCAGCAAGCAGG + Intronic
1149925383 17:60697233-60697255 AGGAAGGAAAAGAAAGAAGCAGG + Intronic
1150601031 17:66651113-66651135 AGGACAGGGAAGGAAGAAGAGGG + Intronic
1151158381 17:72143554-72143576 AGGACCAGAAAGCAAGGAGCTGG + Intergenic
1151665348 17:75542481-75542503 AGCTACTGGAAGCCAGAAGCTGG + Intronic
1151788378 17:76287848-76287870 GGGGAAGGGAATCAAGAAGCAGG - Exonic
1152243815 17:79175036-79175058 AGGAAGAGGAAGGAAGAGGCAGG - Intronic
1152524872 17:80882671-80882693 AGGAGGGGAAAGCAAGATGCAGG + Intronic
1153728350 18:7980781-7980803 AGAAACGGGAAGCAGGCAACGGG - Intronic
1153872619 18:9334720-9334742 AGGGGCGGGGAGCAAGGAGCCGG + Intergenic
1154012364 18:10586562-10586584 AGAAACAGGAAACAGGAAGCAGG - Intergenic
1155108450 18:22689907-22689929 GGGAGCAGGAAGCAGGAAGCAGG + Intergenic
1155499503 18:26472751-26472773 AGGAAGAGGAATCAGGAAGCTGG - Intronic
1156646134 18:39164261-39164283 AGGAAGGGGAAGAAATAAGTTGG - Intergenic
1157085196 18:44573400-44573422 AGGAAGGGGAAGAAGGAAGACGG + Intergenic
1157340121 18:46770948-46770970 AGGAGGAGGAAGCAAGAAGAAGG + Intergenic
1158340965 18:56465789-56465811 AGGAACGGGAAGAAAACAGGAGG - Intergenic
1158856103 18:61544507-61544529 ATGGATGGGAAGCCAGAAGCGGG + Intronic
1159122733 18:64189826-64189848 AGAAACAGGGAACAAGAAGCAGG - Intergenic
1159480155 18:68980110-68980132 ACAACCGGGAAGCAAGAACCAGG - Intronic
1159826018 18:73211360-73211382 AAGAATGGAAAGCAAGAGGCTGG + Intronic
1159914118 18:74173541-74173563 AGGAAAAGGAGGCAGGAAGCCGG - Intergenic
1160420837 18:78742760-78742782 AGGAAGGGACTGCAAGAAGCTGG - Intergenic
1161569135 19:5020657-5020679 AGGCACGGGAAGCAGGCAGGAGG - Intronic
1161970588 19:7577574-7577596 AGGAAGGGGAAGGAAGGAGAAGG + Intergenic
1162124037 19:8489889-8489911 AGAAAAGGGTGGCAAGAAGCTGG - Intergenic
1162832133 19:13291913-13291935 AGGAACAGGAAGAGAGATGCTGG - Intronic
1163202603 19:15779632-15779654 AGGAAGGGGGATCAAGGAGCTGG - Intergenic
1164574697 19:29398916-29398938 AGGAAAGGAAAGGAAGAAGGTGG + Intergenic
1164664992 19:30023606-30023628 AGGAAAGGCAATCAACAAGCAGG - Intergenic
1164815384 19:31196141-31196163 AGGGACGGGAAGGAAGAATTAGG + Intergenic
1165115664 19:33527015-33527037 AGCCACGGGAAGGAAGAGGCTGG - Intergenic
1165301831 19:34974845-34974867 AGGAAAGAGAAGTCAGAAGCTGG - Intergenic
1165373749 19:35426868-35426890 TGAAAGGGAAAGCAAGAAGCAGG - Intergenic
1165416054 19:35694176-35694198 AGGAAGGAGAAGGAAGAAGGAGG - Intergenic
1165705181 19:37970905-37970927 AGGAACAGGGAGCAACAAGACGG - Intronic
1166174403 19:41055834-41055856 AGGAACAGCAAGGCAGAAGCTGG + Intergenic
1166956799 19:46470434-46470456 AGGAAGGTGAAGAAAGAACCGGG - Exonic
1167649859 19:50723376-50723398 AGGAACAGGAAGAGAGAAGCTGG + Exonic
1167767916 19:51496635-51496657 GGGAAGGGGAGGCAAGAGGCAGG + Intronic
1168276040 19:55279372-55279394 AGGATGGGGACCCAAGAAGCTGG - Intronic
1168433860 19:56302528-56302550 AGGAACGGGGAGGAAGAAGAGGG - Intronic
925538472 2:4941098-4941120 AGGAATGGGAAACAGGAGGCAGG + Intergenic
925995566 2:9289969-9289991 AGGAAGTGGCAGGAAGAAGCCGG + Intronic
927060674 2:19416424-19416446 AGGAAGGGGAAGGAAGGAGAAGG - Intergenic
929424728 2:41832437-41832459 AGGGAAGAGAAACAAGAAGCTGG + Intergenic
929689308 2:44061382-44061404 AGCAACGGGGAGGAAGACGCAGG - Intergenic
929766140 2:44845412-44845434 GGGAAAGGGAAGAAAGAAGGAGG - Intergenic
930084068 2:47480237-47480259 AGGAAAGGGAAGGAGGAAGGGGG - Intronic
930464018 2:51721618-51721640 AGGAAAGGGAATAAAGAAGGAGG + Intergenic
934734876 2:96685109-96685131 AGAAACAGGTGGCAAGAAGCCGG - Intergenic
937369420 2:121287040-121287062 AGGAACTGGAAGGAAGCAGGAGG - Intergenic
938558223 2:132445977-132445999 AGAAATGGCAAGCCAGAAGCGGG + Intronic
940398431 2:153220563-153220585 AGGAAAGGGGTGCAAGATGCTGG + Intergenic
940469686 2:154080318-154080340 AGGAAAGAGAAGAAAGAAGAAGG + Intronic
940897345 2:159093561-159093583 ATGAACAGGAAGCACAAAGCTGG - Intronic
942986941 2:182154606-182154628 AGGCAAGAGAGGCAAGAAGCAGG - Intronic
945244932 2:207709568-207709590 AGCAAAGGGAAGCAAGTAGGAGG - Intergenic
946013444 2:216584901-216584923 AGGAAGGGTCAGCAAGGAGCAGG + Intergenic
948570877 2:238916468-238916490 AGGAAGGGAAAGAAAGAAGGAGG + Intergenic
1168963952 20:1887580-1887602 AGGAGCAGGAAGCAGGAAACAGG - Intergenic
1169473708 20:5911429-5911451 AGGAGCGGGCAGCCAGGAGCGGG - Exonic
1169764702 20:9136441-9136463 AGGAAAGGCAGGCAAGGAGCTGG + Intronic
1170398328 20:15952427-15952449 AGAAGCTGGAAGCCAGAAGCAGG - Intronic
1170398329 20:15952441-15952463 AGCTGCAGGAAGCAAGAAGCTGG - Intronic
1172099147 20:32475119-32475141 AGGACCCGGCGGCAAGAAGCGGG + Intronic
1172758776 20:37307430-37307452 AGGAAAGGCGAGCAAGAAGTTGG + Intronic
1173080465 20:39862455-39862477 AGGAAGGAGAGGGAAGAAGCAGG - Intergenic
1173897632 20:46562938-46562960 AGGAGCGGGAAGGGAGGAGCTGG + Intronic
1174101458 20:48129354-48129376 AGGAGTGGGAAGCTTGAAGCAGG - Intergenic
1174239305 20:49120080-49120102 AGGAACGGGCACCAACAAGAAGG - Exonic
1175198717 20:57264212-57264234 AGGAGGGGGAAGCATGAAGGCGG + Intronic
1176098783 20:63355810-63355832 AGGCCCAGGAAGGAAGAAGCAGG - Intronic
1177134614 21:17296175-17296197 AGGAACGTGAGGACAGAAGCTGG - Intergenic
1180043266 21:45291455-45291477 GGGCACGGAAAGCCAGAAGCTGG + Intergenic
1182102971 22:27670696-27670718 GGGAAGGGGCAGAAAGAAGCAGG - Intergenic
1182261938 22:29079413-29079435 TGGCAAGGGAAGCTAGAAGCTGG - Intronic
1182534716 22:30992185-30992207 AGCAAAGGACAGCAAGAAGCTGG + Intergenic
1183153092 22:36053524-36053546 AGGGATGGGAAGGGAGAAGCAGG - Intergenic
1183718937 22:39550965-39550987 AGGCAAGGGAAACAGGAAGCAGG + Intergenic
1183834240 22:40439064-40439086 AGGAAAGGCAAGCAAATAGCAGG + Intronic
1184205749 22:43001504-43001526 TGGGAGGGGAAGCAGGAAGCTGG + Intronic
1184793668 22:46718343-46718365 AGGAAAGGGAAGGAGAAAGCAGG + Intronic
1184931210 22:47682527-47682549 AGAGAAGGGAAGCAAGAACCAGG - Intergenic
1184933428 22:47698975-47698997 AGGAAAGGGATGCAAGATGCCGG - Intergenic
949977911 3:9477545-9477567 AAGAAGGGGATGCAAGAGGCTGG - Exonic
950045203 3:9944926-9944948 AGGAACTGGCAGCATGCAGCTGG - Exonic
950053286 3:10007932-10007954 AGGACCAGGAAGCAAGAAGCAGG + Intronic
950304928 3:11910217-11910239 AGGACCAGGAAGCAAGAAGCAGG + Intergenic
950414329 3:12860039-12860061 AGAACCAGGAAGCAGGAAGCAGG + Intronic
950414608 3:12861776-12861798 AGAACCAGGAAGCAGGAAGCAGG + Intronic
950414936 3:12863765-12863787 AGGACCAGGAAGTAAGAAGTGGG + Intronic
950416678 3:12872903-12872925 AGGAACGGGAAGCAAGAAGCAGG + Intergenic
950466034 3:13154148-13154170 AGGACCAGGAAGCAAGAAGTGGG - Intergenic
952172140 3:30818905-30818927 AGGGGCATGAAGCAAGAAGCAGG - Intronic
952281726 3:31929892-31929914 AGGACAGTGAAGCAAGAAGATGG + Intronic
952929078 3:38346124-38346146 AGGGACGGGAAGGATGTAGCTGG + Intergenic
953274596 3:41482376-41482398 AGGACAGGGGAGCCAGAAGCTGG + Intronic
954373799 3:50183885-50183907 AGGAACAGGAGGCAAAGAGCTGG + Intronic
954663338 3:52237640-52237662 ACAAAGGGGAAGGAAGAAGCTGG + Intronic
954673943 3:52305377-52305399 AGGAATGGGGAGCAATGAGCAGG + Intergenic
954715840 3:52526367-52526389 AGGAGGGGGAAGCCAGCAGCTGG - Intronic
955153408 3:56391506-56391528 AGGAATGGGAGGCAGGAAGAAGG + Intronic
955567193 3:60259920-60259942 AGGGAGGGAAAGCAAGAGGCTGG + Intronic
956070613 3:65446313-65446335 AGGAAAGGGAAGCTAAAAGAAGG + Intronic
956080194 3:65549270-65549292 AGGAAAGGGAAGGAAGGAGAAGG - Intronic
957515143 3:81240656-81240678 AAGGATGGGAAGAAAGAAGCAGG + Intergenic
960993649 3:123327531-123327553 AGGAAAGAGAAGGAAGCAGCAGG + Intronic
961201287 3:125047803-125047825 AGGAAGGAGTAGCAAGAGGCAGG - Intronic
961340203 3:126212581-126212603 AGGGAGGGAAAGCAAGAAGGCGG + Intergenic
961669609 3:128519317-128519339 AGGGAGGAGAAGCAGGAAGCAGG - Intergenic
961713643 3:128844987-128845009 AGGACTAGGAAGCCAGAAGCGGG - Intergenic
961786165 3:129348098-129348120 AGGACCAGGAAGCAAGAGGCGGG + Intergenic
962376934 3:134866456-134866478 AGGAAGGGGCAGCAGGCAGCAGG - Intronic
962432295 3:135330440-135330462 GGGAAGGGGAAGGAAAAAGCTGG + Intergenic
964218641 3:154319274-154319296 AGGAACTGAAAACTAGAAGCAGG - Intronic
967004611 3:185372295-185372317 AGGAAGGGGAAGGGAGAACCTGG - Intronic
968713991 4:2141067-2141089 AGGAAAGGGCAGAGAGAAGCTGG + Intronic
970945688 4:21688821-21688843 AGGAAAGGCAAGGAAGCAGCTGG - Intronic
970989019 4:22191443-22191465 ATGAATGGGAAGCCAGAAGGGGG - Intergenic
972028084 4:34412533-34412555 AGGAATGGAAAGCATGAAGCAGG + Intergenic
972583512 4:40416055-40416077 ATGAAAGAGAAGCAAGAGGCCGG + Intergenic
973608013 4:52606968-52606990 TGGAACGGGGAGCCAGAGGCAGG + Intronic
974219629 4:58949617-58949639 GGGAAAGGGAAGCAGGAAGTAGG - Intergenic
976813837 4:89124378-89124400 AGGAGTGGGGAGAAAGAAGCTGG - Intergenic
977071746 4:92398708-92398730 AGGAACTGGAAGTAAGAATTGGG + Intronic
977573664 4:98655949-98655971 AGGAAGGGAAGGCAAGAGGCAGG + Intronic
977575953 4:98674292-98674314 AGGAATGGAAAGCAAGGACCTGG - Intergenic
977861227 4:101962570-101962592 AGGAAAGGGGAGCAAGCAGTTGG - Intronic
978077399 4:104549991-104550013 AGGAACAGCAGGCAAGAACCTGG - Intergenic
978816987 4:112918016-112918038 AAGCAAGGGAAGCAATAAGCAGG - Intronic
979619815 4:122786512-122786534 AGTAAGGGGAAGCAGGTAGCAGG - Intergenic
980097563 4:128507906-128507928 AGGATTGGGAAGAAAGAAACAGG - Intergenic
980798469 4:137715785-137715807 AGGGACAGGAGGCAGGAAGCAGG + Intergenic
981561933 4:146057575-146057597 AGCAATGGGAAGAAAGAAGTTGG - Intergenic
981838505 4:149082983-149083005 AGGGAAGGGAAGGAAGGAGCAGG + Intergenic
982722014 4:158869117-158869139 AGGAACGGGAGGGAGGAGGCTGG + Exonic
983466638 4:168101294-168101316 AGGAACAGGAAGCATGATCCTGG - Intronic
983830405 4:172320067-172320089 AGTAACAGGAAACAAGGAGCAGG - Intronic
984019559 4:174468503-174468525 ATGAACGGGAAGCATGGACCAGG + Intergenic
984803295 4:183733769-183733791 AGAAAGGGGAAGGAGGAAGCAGG - Intergenic
985913477 5:2900624-2900646 AGAAGCTGGGAGCAAGAAGCAGG - Intergenic
986424218 5:7614361-7614383 AGAAAGGTGAACCAAGAAGCTGG - Intronic
991538739 5:67703505-67703527 AGTAAATGGAAGCATGAAGCAGG + Intergenic
991942255 5:71864156-71864178 AGGAACCTGAAGCTAGAGGCAGG + Intergenic
994641607 5:102417372-102417394 ACAAATGGGAAGCAAGAAGAGGG - Intronic
997806372 5:136922168-136922190 AGGAAGGGGAAACAAGATGCAGG + Intergenic
998051811 5:139042202-139042224 TGGCCCAGGAAGCAAGAAGCCGG - Intronic
999038206 5:148377305-148377327 AGGAAAGAGAAGGAAGATGCTGG - Intergenic
1000516442 5:162241224-162241246 ATGAATGGGGAGCCAGAAGCCGG + Intergenic
1001052463 5:168424040-168424062 AGGAACGGAGGGCAAGCAGCTGG + Exonic
1002482212 5:179510095-179510117 AGGAAGAGGAAGAAAGAAGAAGG - Intergenic
1003409942 6:5853178-5853200 TGGAAGGGGAAGCAAGAAGGTGG + Intergenic
1003998485 6:11568112-11568134 AGGAAAGGAAAGAAAGAAGAGGG + Intronic
1006058803 6:31404458-31404480 AGGAAGGGGTAGCAGGGAGCTGG - Intronic
1006071290 6:31499343-31499365 AGGAAGGGGTAGCAGGGAGCTGG - Intronic
1006920895 6:37626363-37626385 AGGAAGGGGGAGCAAGAGGCCGG + Intergenic
1007793876 6:44331678-44331700 AGGAAGGGGAAGCAGGACGCAGG - Intronic
1011222137 6:85065767-85065789 AGGAACGGGAGCCAATAATCTGG + Intergenic
1013661764 6:112305295-112305317 AGAAAAGAGAAGCAAGAAGTGGG - Intergenic
1015355257 6:132270503-132270525 AGGAAAGGGAAGGAAGAAAAAGG + Intergenic
1018503805 6:164442496-164442518 AGGAAGGGGAAGGAGCAAGCAGG - Intergenic
1019013345 6:168860939-168860961 AGGAAGGGGGAGCCAGCAGCAGG + Intergenic
1019578552 7:1749156-1749178 AGGAACCGGAGGGATGAAGCCGG + Intergenic
1019658743 7:2211894-2211916 AGGAAAGACAGGCAAGAAGCGGG + Intronic
1021984389 7:26084927-26084949 AGGAAAGGAAAGCCAGTAGCTGG + Intergenic
1022037625 7:26549402-26549424 AGACACGGGAACCAAGAAGGGGG + Intergenic
1024051241 7:45624747-45624769 AGGGGTGGGAAGCAAGGAGCAGG - Intronic
1025830602 7:65045892-65045914 AGGAAAGGAAAGGAAGAAGGAGG - Intergenic
1026270299 7:68830746-68830768 AGGAATGGGGAGCCAGAAGGGGG - Intergenic
1027952859 7:84840567-84840589 AGGAAGGGGAAGGAAAAAGAAGG - Intergenic
1029421584 7:100474614-100474636 AGGTACTAGAAGCAAGAAGTGGG + Intronic
1029479623 7:100804676-100804698 AGGAACGGGAAGGCAGAAAGGGG + Intronic
1029633695 7:101769593-101769615 AGGAAATGAAAGGAAGAAGCTGG - Intergenic
1031060451 7:117045653-117045675 GGGAATGGGAGGCTAGAAGCTGG - Intronic
1031124921 7:117762832-117762854 AGGAAAGAGAAGCAGGAAGACGG - Intronic
1031339852 7:120585688-120585710 AGGGAAGGGAATCAAGAATCTGG + Intronic
1033405657 7:141070454-141070476 AGGAATCGGAAGCAGGCAGCAGG + Intergenic
1034184774 7:149166950-149166972 AGGAAAGGGAGACAAGAAGTAGG - Intronic
1034285372 7:149880273-149880295 AGGAGTGGGAAGCAACACGCAGG + Exonic
1034521744 7:151625776-151625798 AGGAAGGGGAAGGAAGGAGATGG + Intronic
1036493455 8:9248977-9248999 AGGAATGGGAATCAAAATGCAGG - Intergenic
1037091694 8:14927533-14927555 AGGAAGAGGAAGAAAGAAGAGGG + Intronic
1039923330 8:41907999-41908021 AGCAACTGGAGGCATGAAGCTGG - Intergenic
1040602360 8:48897358-48897380 ATGAATGGGGAGCAAGAAGGGGG + Intergenic
1040980125 8:53238477-53238499 TGGAATGGGAAGCAAGGGGCAGG + Intronic
1042567938 8:70131677-70131699 AGGAAAGGGGAGGAAGAAACAGG + Intronic
1043366151 8:79535804-79535826 AGAAACCAGAAGCCAGAAGCGGG - Intergenic
1045894187 8:107194515-107194537 GGTAACTGGAAGCCAGAAGCAGG - Intergenic
1045981770 8:108198000-108198022 TGGAAGGGGAGGCATGAAGCAGG - Intergenic
1046188537 8:110757820-110757842 AGGAAAGGAAAGAAAGAAGGAGG - Intergenic
1047908522 8:129499931-129499953 AGGAATGTGAAGCACAAAGCAGG + Intergenic
1048106221 8:131413198-131413220 AAGAAAGGGAAGCAGGAGGCAGG + Intergenic
1048150468 8:131888716-131888738 AGGAAAGAGAAGCAAAAAGGTGG + Intergenic
1048807461 8:138253933-138253955 AGGAACAGGAAGCCAGAGGCTGG - Intronic
1048996120 8:139794634-139794656 AGGAACGGGAGCCAAGAGGATGG - Intronic
1049203696 8:141353693-141353715 AGGAGAAGGAAGCAAGCAGCCGG + Intergenic
1049277721 8:141728277-141728299 AGGAATGGGAAGCCAGGAGAAGG - Intergenic
1049331698 8:142058008-142058030 AGGAAGGGGAAGAAGGAAGAGGG + Intergenic
1050204525 9:3182626-3182648 AGGAACTGGGAGAAAGAAGAAGG - Intergenic
1053003724 9:34591299-34591321 CGGCACGGGAAGCAGGAGGCCGG - Intergenic
1055205855 9:73729215-73729237 AGGAAGGGGAAAGAAGAAGAGGG + Intergenic
1056047374 9:82733108-82733130 AGGAAGGGGAGCCAAGAAGAGGG - Intergenic
1059414956 9:114156585-114156607 AGGGACAGGAACCGAGAAGCAGG - Intronic
1060582603 9:124764515-124764537 AGGAACTGGAAATAAAAAGCTGG + Intronic
1060980278 9:127787862-127787884 TGGAGCAGGAAGAAAGAAGCTGG + Intronic
1061236021 9:129343017-129343039 AGGAAGGGGCAGCCAGAGGCTGG + Intergenic
1061475407 9:130862461-130862483 TGGAACGGGAAGCGAGAACTGGG + Intronic
1062459572 9:136657256-136657278 AGGAGCGGGATCCCAGAAGCTGG + Intergenic
1186557277 X:10573207-10573229 AGGAAAGGAAAGGAAGAAGAGGG - Intronic
1186664848 X:11706207-11706229 AGAAACGGGGAGGAGGAAGCAGG + Intergenic
1187023825 X:15411771-15411793 AGGAGCGGGAGGGAAGAACCAGG - Intronic
1187299270 X:18031947-18031969 AGGAAGGGGAAGCAGGAGGCAGG + Intergenic
1188121426 X:26312941-26312963 AAGAAAGGGAGGCAAGAAGGAGG + Intergenic
1190007499 X:46754697-46754719 AGGAGGAGGAAGCGAGAAGCAGG + Intronic
1191901605 X:66046430-66046452 AGGAAAGTGCAGAAAGAAGCAGG + Intergenic
1191961752 X:66711109-66711131 AGGAACAGGAAGTAGGAAGAGGG - Intergenic
1193103007 X:77636931-77636953 AGGAAGGAGAAGGAAGAAGGAGG + Intronic
1195663457 X:107405549-107405571 AGGAACAGGAAGCAAGTAGAAGG - Intergenic
1196593533 X:117516943-117516965 TGAAAGGGGAAGCACGAAGCGGG + Intergenic
1197033669 X:121849234-121849256 AGGAAGGGGGAGGAAGAAGAAGG - Intergenic
1197269805 X:124413170-124413192 TGGAAGGGGAGGCAAGGAGCAGG + Intronic
1197604466 X:128568375-128568397 AGAAAAGGGAAGGAAGAAGAGGG - Intergenic
1197837670 X:130712657-130712679 GGAAACGGGATGCAAGATGCTGG + Intronic
1200055969 X:153461099-153461121 AGGAACGGCAGGCAAGAGGCGGG + Intronic
1201296161 Y:12464930-12464952 AGGAAGAGGAAACATGAAGCTGG - Intergenic