ID: 950416679

View in Genome Browser
Species Human (GRCh38)
Location 3:12872907-12872929
Sequence ACGGGAAGCAAGAAGCAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 302}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950416674_950416679 -5 Left 950416674 3:12872889-12872911 CCCCAACAAAGAGCAGGAACGGG 0: 1
1: 0
2: 0
3: 13
4: 105
Right 950416679 3:12872907-12872929 ACGGGAAGCAAGAAGCAGGCTGG 0: 1
1: 0
2: 2
3: 29
4: 302
950416676_950416679 -6 Left 950416676 3:12872890-12872912 CCCAACAAAGAGCAGGAACGGGA 0: 1
1: 0
2: 0
3: 14
4: 130
Right 950416679 3:12872907-12872929 ACGGGAAGCAAGAAGCAGGCTGG 0: 1
1: 0
2: 2
3: 29
4: 302
950416670_950416679 17 Left 950416670 3:12872867-12872889 CCAGTCATATAAGATTCTCCTTC 0: 1
1: 1
2: 2
3: 9
4: 130
Right 950416679 3:12872907-12872929 ACGGGAAGCAAGAAGCAGGCTGG 0: 1
1: 0
2: 2
3: 29
4: 302
950416672_950416679 -1 Left 950416672 3:12872885-12872907 CCTTCCCCAACAAAGAGCAGGAA 0: 1
1: 0
2: 3
3: 35
4: 303
Right 950416679 3:12872907-12872929 ACGGGAAGCAAGAAGCAGGCTGG 0: 1
1: 0
2: 2
3: 29
4: 302
950416669_950416679 29 Left 950416669 3:12872855-12872877 CCTGGAGTTCAACCAGTCATATA 0: 1
1: 0
2: 0
3: 8
4: 127
Right 950416679 3:12872907-12872929 ACGGGAAGCAAGAAGCAGGCTGG 0: 1
1: 0
2: 2
3: 29
4: 302
950416677_950416679 -7 Left 950416677 3:12872891-12872913 CCAACAAAGAGCAGGAACGGGAA 0: 1
1: 0
2: 0
3: 14
4: 207
Right 950416679 3:12872907-12872929 ACGGGAAGCAAGAAGCAGGCTGG 0: 1
1: 0
2: 2
3: 29
4: 302

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950416679 Original CRISPR ACGGGAAGCAAGAAGCAGGC TGG Intergenic
900356303 1:2266451-2266473 ACAGGAAGCAGGACCCAGGCAGG - Intronic
900927130 1:5712765-5712787 GCAGGAAGTAAGAAGCAGGCTGG - Intergenic
900970460 1:5989854-5989876 ACAGGGAGCATGAAGCATGCCGG + Intronic
901501864 1:9657507-9657529 ACGGAAAGCAGGAAGGAGGCTGG - Intronic
902251211 1:15154969-15154991 AAGGAAAGCCAGAAGCCGGCCGG - Intronic
902339311 1:15772390-15772412 GCTGGAAGCAGGAAGCAGCCAGG + Intronic
902797657 1:18809902-18809924 AAGGGAAGAAAGAAGAAGGCAGG + Intergenic
903018273 1:20375903-20375925 ACAGGCAGACAGAAGCAGGCAGG + Intergenic
903298982 1:22364499-22364521 GGGGGCAGCAAGAAGCAGCCAGG - Intergenic
903533710 1:24052540-24052562 ACAGAAAGCAAGAAGCTGGATGG - Intergenic
904114723 1:28153386-28153408 ATGGGAAGCAAGAACCCAGCTGG + Intronic
904302524 1:29563754-29563776 ACAGGAAACAGGAAGCAGGATGG - Intergenic
905807963 1:40890578-40890600 ACGGTAGGCAAGAAGAAGGTTGG + Intergenic
908316886 1:62941498-62941520 ATGGGGAGAAAGAAGCAGGCAGG - Intergenic
910115403 1:83726269-83726291 GCAGAAAGCAAGAAGCAGGCCGG + Intergenic
910718422 1:90257858-90257880 ACGGGGACAAAGAAGCAGGAAGG + Intergenic
911754985 1:101543754-101543776 ACAGGAAGCATGAAGCAAGCAGG + Intergenic
913285780 1:117225126-117225148 ACCTGGAGCCAGAAGCAGGCTGG - Intergenic
914196449 1:145450459-145450481 ACGGGAAGGCAGACGGAGGCAGG + Intergenic
914492791 1:148162601-148162623 CCGGGTAGCCAGGAGCAGGCCGG + Intergenic
914920971 1:151847260-151847282 AGGGGAGGCAGGAGGCAGGCAGG + Exonic
915734689 1:158077400-158077422 CTGGGAAGCAAGAAGCGGGTGGG + Intronic
916167276 1:161975410-161975432 TGGGAAGGCAAGAAGCAGGCTGG - Intergenic
916324198 1:163538906-163538928 AAGGGAATAAAGAAGGAGGCTGG + Intergenic
918673045 1:187244763-187244785 ACGACAAGCAAGGAGCTGGCAGG + Intergenic
920046601 1:203136765-203136787 AGGGGAAGCAAGAGGCAAGAAGG - Intronic
920506866 1:206521436-206521458 ACAGGAGGCCAGGAGCAGGCAGG - Intronic
921092924 1:211860229-211860251 AGGGGAAGAAGGAAGGAGGCTGG + Intergenic
921723092 1:218495236-218495258 AAGGGAAGAAAGAAGAAGCCCGG - Intergenic
922034170 1:221832280-221832302 ACAGGAAGCAAGGAGAGGGCTGG - Intergenic
924208917 1:241744600-241744622 AAGGAGAGCATGAAGCAGGCTGG + Intronic
1064690445 10:17912183-17912205 ATAGGAAGTAAGAAGTAGGCTGG + Intergenic
1065229845 10:23586808-23586830 ACGGGAAGTAGGAATAAGGCTGG + Intergenic
1065319004 10:24491653-24491675 ACTGGAAGCAGAAAGAAGGCTGG + Intronic
1065579354 10:27155439-27155461 GCGGGAAGCAAGAAGGAGCCTGG + Exonic
1065849567 10:29775978-29776000 CCAGTAAGGAAGAAGCAGGCAGG - Intergenic
1066682723 10:37949595-37949617 AGGGGAAGTAAGACGCTGGCAGG + Exonic
1067000603 10:42608746-42608768 ACTCAAAGCAAGAAGAAGGCAGG + Intronic
1067063770 10:43091999-43092021 AAAGGAAGCAGGAAGCAGTCAGG + Intronic
1067703368 10:48589332-48589354 AGTTGAAGCCAGAAGCAGGCTGG - Intronic
1067714906 10:48683479-48683501 CCGGGTAGCCAGCAGCAGGCAGG - Intergenic
1069635707 10:69923606-69923628 AGAGGAAGCAAGACCCAGGCTGG + Intronic
1069963914 10:72097798-72097820 ACTGGAAGTCAGAAGCAGCCTGG - Intronic
1070310371 10:75268994-75269016 ACAGCAAGAAAGAAGGAGGCTGG - Intergenic
1073575301 10:104618082-104618104 AGAGGAGGCAGGAAGCAGGCAGG - Intergenic
1074100830 10:110353931-110353953 AGAGGAAGCAAGGGGCAGGCTGG + Intergenic
1074480615 10:113816840-113816862 AGTAGAAGCAAGAAACAGGCTGG + Intergenic
1076219772 10:128723777-128723799 AAGGGAAGCACCAAGAAGGCCGG - Intergenic
1077884659 11:6378011-6378033 ACAGGAAGCCAGGAGCAGGTGGG + Intergenic
1078421465 11:11216398-11216420 AGAGGATGCAGGAAGCAGGCTGG - Intergenic
1078758969 11:14236383-14236405 ATGGGAAGAATGAAGGAGGCTGG + Intronic
1079310427 11:19360727-19360749 AAGGGGAGGAAGAAGAAGGCTGG + Intronic
1080249707 11:30219231-30219253 ACTGGAAGGAAGAAGAAGGAAGG + Intergenic
1080314812 11:30936717-30936739 AAGGGAAGCTAAAAGCAGACTGG + Intronic
1081643477 11:44774232-44774254 ACTTGAACCAAGAGGCAGGCAGG + Intronic
1081693120 11:45091921-45091943 ATGAGAAGCACGCAGCAGGCGGG - Intergenic
1083754703 11:64785212-64785234 ATGGGAGGCAAGAAGCAGGAGGG + Intergenic
1084035780 11:66509417-66509439 AGGGGAAGCAATTGGCAGGCTGG - Exonic
1084113412 11:67027870-67027892 CCGGCAAGGCAGAAGCAGGCTGG + Intronic
1087150452 11:94854988-94855010 ACGGCAAGCAGGAAGAAGACTGG + Intronic
1088030725 11:105246164-105246186 ACAAGAAGCAAGAAGCAAGTAGG - Intergenic
1088813489 11:113406738-113406760 AGGGGAAGCAGGAAGCTGGTGGG - Intergenic
1089294015 11:117457393-117457415 ATAGGAGGCAAGAAGAAGGCTGG + Intronic
1089717058 11:120370787-120370809 ATGGGAAGGAAGAAACAGGAAGG - Intronic
1090945011 11:131421669-131421691 ATGGGAAGCATGAACCAGGTAGG - Intronic
1091058075 11:132437360-132437382 CTGGGAAGAAAGAAGCAGACAGG + Intronic
1091551210 12:1536213-1536235 AAGGGAAGGAAGAGGGAGGCAGG + Intronic
1092566846 12:9674398-9674420 ACAGGAAGCAGGAAGAAAGCAGG - Intronic
1092650055 12:10625127-10625149 ACGGGAAACGAAAATCAGGCAGG - Intronic
1093656934 12:21705760-21705782 AGAGGAAGCAAGATGCAGGGAGG - Intronic
1093848280 12:24002167-24002189 ACTCAAAGCAAGAAGAAGGCAGG + Intergenic
1095954087 12:47796718-47796740 ATGGGAAGAAAGCAGGAGGCCGG - Intronic
1097906773 12:64928500-64928522 AAGGGAAGCCAAAAGCAAGCAGG - Intergenic
1098230783 12:68370149-68370171 AAGGGAAGCAGGCAGCAAGCAGG + Intergenic
1100080671 12:90846334-90846356 TCTGGGAGCAACAAGCAGGCAGG + Intergenic
1100408375 12:94290921-94290943 ACGGGTGGCAAGAAGGAGGCAGG - Intronic
1101408751 12:104452421-104452443 AGGAGCAGCAAGAGGCAGGCAGG + Intergenic
1101605801 12:106247290-106247312 TCGGGAAGCACGAAGGAGCCCGG + Intronic
1103427968 12:120855010-120855032 CAGGGAAGGAAGAAGCATGCAGG + Intronic
1103845527 12:123899433-123899455 AGGAGAAGGAAGAGGCAGGCAGG - Intronic
1105529289 13:21203698-21203720 AAAGGAAGAAAGAAGCATGCAGG + Intergenic
1105716070 13:23066094-23066116 AAGGGATGCAAGCAGCAGGTGGG + Intergenic
1105948353 13:25208668-25208690 AAGGGAAGGAAGAAGGTGGCGGG + Intergenic
1106269527 13:28139240-28139262 AGGGGAAGCAGGAAGAAGGAAGG - Intronic
1106436858 13:29730892-29730914 TGGGGAAGCAAGAGACAGGCAGG + Intergenic
1106616492 13:31334691-31334713 ACAGGCAGCAAGAAGCAGACTGG + Intergenic
1107851869 13:44578242-44578264 ACTGGAGGACAGAAGCAGGCCGG + Intergenic
1108112301 13:47088198-47088220 GCTGGAAGCAAGAAGCAAGAAGG + Intergenic
1109438842 13:62343219-62343241 ACTGGAAGCAAGAAGAAGCCAGG - Intergenic
1109767551 13:66924048-66924070 ACGTAAAGCAAGAAGCATGAGGG + Intronic
1110752907 13:79136673-79136695 AAAGGAAGGAAGAAGAAGGCAGG + Intergenic
1111677085 13:91399947-91399969 ACAGGAAGCAAGATCCACGCTGG - Intronic
1113637078 13:111926999-111927021 ACGGGCAGCCAGGAGGAGGCTGG + Intergenic
1116970820 14:51063396-51063418 AGGGAAAGCAAGAATCATGCAGG + Intronic
1117984360 14:61373301-61373323 AGGGGAAGCAAGCAGCATGACGG + Intronic
1119997651 14:79271382-79271404 AGGGGAAGGAAGAAGGAGGAAGG - Intronic
1120644606 14:87058458-87058480 ACGGGAGCCAAGCAGGAGGCAGG - Intergenic
1121139781 14:91531277-91531299 ATAGGAAGCAGGAAGCAGGAAGG + Intergenic
1121883881 14:97525095-97525117 AGAGGAAGCATTAAGCAGGCTGG + Intergenic
1122052710 14:99070905-99070927 ATGGGAAGCCACATGCAGGCAGG - Intergenic
1122974652 14:105166115-105166137 GCTGGAAGCAAGAGGCAGGGAGG + Intronic
1123136602 14:106033049-106033071 AGGGCCAGCAAGCAGCAGGCAGG - Intergenic
1125761964 15:42103021-42103043 AGGGGCAGGAAGGAGCAGGCTGG - Intergenic
1125883607 15:43212788-43212810 CTGGGAAGCTAGAAGCAGGAGGG + Intronic
1126348587 15:47721014-47721036 AGAGGAAGCAAGAAGCAGTTGGG + Intronic
1127522060 15:59752957-59752979 AGGGGAAACAAGAACCAGGAGGG - Intergenic
1127897265 15:63312390-63312412 ACAGGAAGCTAGAAGGTGGCTGG + Intergenic
1127963560 15:63907757-63907779 TAGGGAAGCAAGGAGGAGGCAGG + Exonic
1130403641 15:83579502-83579524 GCAGGAAGCAGGAAGCAGGAAGG - Intronic
1130847378 15:87759871-87759893 AGGGCAAGCAAGCAGCTGGCTGG - Intergenic
1132256422 15:100380583-100380605 AGGGGAAACCAGATGCAGGCTGG - Intergenic
1132882912 16:2170298-2170320 ACGGGAAGCAGGAAGCAGCCCGG + Intronic
1134106637 16:11490096-11490118 ACAAAAAGCAAGCAGCAGGCTGG + Intronic
1135922907 16:26667337-26667359 CCGGGCAGCAAGAAGCCGGCTGG - Intergenic
1139306192 16:65988222-65988244 AGGGAAAGCAAGCAGCTGGCTGG - Intergenic
1139341339 16:66270010-66270032 ACGGAAAGCAGGAAGGAGGGAGG + Intergenic
1139659667 16:68412021-68412043 GGGGGAAGGAAGAAGGAGGCAGG + Intronic
1139792317 16:69448899-69448921 ATGGGAAGCAAGCAGCAAGGAGG - Intronic
1140924012 16:79565641-79565663 AGGGGAAGCAACATGAAGGCGGG - Intergenic
1141715926 16:85726849-85726871 CTGGGAAGCAAGCAGCAGCCTGG - Intronic
1142245315 16:88967633-88967655 GAGGGAAGGAAGGAGCAGGCCGG + Intronic
1142676889 17:1519159-1519181 CCGGGAAGCAAGAAGTGGGTGGG - Exonic
1142719125 17:1764556-1764578 ACGGGCAGCAGGAAGCAGCCTGG - Intronic
1142974023 17:3632516-3632538 ACGGGAAGAAGTAAGCAGGCTGG + Intronic
1143828614 17:9632856-9632878 AAGGGAAACAAAAGGCAGGCAGG - Intronic
1144290328 17:13820186-13820208 ACGGTAAGCAAGAAGCTGTTTGG + Intergenic
1144575264 17:16425867-16425889 AGGGGAAGGAAGAGCCAGGCTGG + Intronic
1146378042 17:32307958-32307980 ACAGGGAGGAAGAAGCACGCTGG + Intronic
1147447600 17:40484262-40484284 TCGGGAAGGCAGAAGCACGCAGG + Intronic
1148159696 17:45442886-45442908 ACCGGTAGCAAGAGGCTGGCAGG - Intronic
1150390980 17:64789758-64789780 ACCGGTAGCAAGAGGCTGGCAGG - Intergenic
1150593172 17:66580767-66580789 AAGGGAAGCAAGAAGGGCGCAGG - Intronic
1151346969 17:73508157-73508179 ACGGGGAGGTAGAGGCAGGCTGG - Intronic
1151368546 17:73632370-73632392 ACGGGGAGAAAGATGGAGGCTGG - Intronic
1152091596 17:78250549-78250571 ACAGGAAGCCAGGATCAGGCTGG + Intergenic
1152528124 17:80901235-80901257 ACGGGAAGCACACAGCAGCCTGG + Intronic
1152638058 17:81438280-81438302 CAGGGAGGCAAGAAGCCGGCAGG - Intronic
1153712571 18:7814683-7814705 AAGGGAAGGAAGAAGCAGCTGGG - Intronic
1154266722 18:12884577-12884599 ATGGGAAGCAAGAAGGAAGGCGG - Intronic
1154970188 18:21400522-21400544 ACGGGAACCAAGAACCATGAAGG - Intronic
1156479392 18:37426623-37426645 CCTGGAAGGAAGAAGGAGGCTGG - Intronic
1159299051 18:66538758-66538780 ACTGGAAGCTAGAAACAGGAAGG - Intronic
1160062278 18:75543004-75543026 ACATGAAGCAAGAAACAGGCAGG + Intergenic
1160130820 18:76223512-76223534 ACTTGGAGAAAGAAGCAGGCTGG - Intergenic
1160863274 19:1246541-1246563 ACGAGAGGCAAGAGGCAGGGAGG + Intergenic
1161405743 19:4090293-4090315 AACGGAAGAAAGAAGCAGGATGG + Intergenic
1164554637 19:29241801-29241823 GGGGGAAGAAAGAAGGAGGCTGG - Intergenic
1165062352 19:33211036-33211058 AAAGAAAGCAAGAGGCAGGCAGG - Intronic
1165373748 19:35426864-35426886 AGGGAAAGCAAGAAGCAGGATGG - Intergenic
1165951563 19:39476387-39476409 CCTGGAAGCCTGAAGCAGGCAGG + Exonic
1167128947 19:47572056-47572078 GTGGGAAGGAAGAAGCAGTCAGG + Intergenic
1167762568 19:51458663-51458685 CCGGGAAGCAAGAAAGAGGTTGG - Intergenic
1167767918 19:51496639-51496661 AGGGGAGGCAAGAGGCAGGGAGG + Intronic
925749494 2:7074821-7074843 AAGGGAAGAAAGAAGGAGGGGGG + Intergenic
926135275 2:10331695-10331717 ACGGGGAGAAAGATGCATGCGGG - Intronic
926210009 2:10862630-10862652 AGAGGAGGCAAGAAGCAGGTGGG + Intergenic
927465616 2:23334263-23334285 CTAGGAAGCAAGAACCAGGCGGG + Intergenic
927504606 2:23604806-23604828 ACAGGCAGCAAGGAGCAGGGAGG - Intronic
928377792 2:30790041-30790063 TGGGGAAGGGAGAAGCAGGCAGG + Intronic
929454346 2:42055417-42055439 CAGGGAAGCAAGAAACAGGTGGG + Intronic
930140882 2:47950375-47950397 AAAGGAAGCAAGAAGCAGCTGGG - Intergenic
930365460 2:50434011-50434033 ACCGGAAGCAAGGAGTAAGCAGG - Intronic
932740152 2:74284986-74285008 AGGGAAAGTAACAAGCAGGCTGG - Intronic
932854750 2:75221511-75221533 ACTTGAATCAAGAAGCTGGCAGG + Intergenic
933182790 2:79245956-79245978 ACCAGAATGAAGAAGCAGGCTGG - Intronic
933493977 2:83024736-83024758 ACGGGAAACAATAAGAAGACTGG - Intergenic
934925082 2:98376587-98376609 AGGAGAAGCAAGCAGCAGCCTGG + Intronic
935320548 2:101884034-101884056 AGGGGGAGCAAGAGGCAGACGGG + Intronic
935586880 2:104808783-104808805 AAGGGAGGCAGGAAGGAGGCAGG - Intergenic
937377602 2:121348392-121348414 ACGGGTAGGAAAAACCAGGCAGG - Intronic
939805788 2:146774881-146774903 ACGGAAAGAAAGATGAAGGCTGG - Intergenic
940075662 2:149739252-149739274 TGGGGGAGCAAGGAGCAGGCGGG - Intergenic
940694509 2:156961568-156961590 AGGTGAAGCAGAAAGCAGGCAGG + Intergenic
940894348 2:159065950-159065972 AAGGGAGGCAAGAAGGAAGCAGG + Exonic
941772575 2:169361102-169361124 ACGGGAGGGAAGGAGCAGGAGGG + Intronic
942123466 2:172801364-172801386 CAGGGCAGCAAGGAGCAGGCTGG - Intronic
942602824 2:177658543-177658565 ACAGGAAGAAAGAAGGAGGGAGG - Intronic
942748777 2:179264818-179264840 GCGGGAAGGAGGAAGGAGGCGGG + Intergenic
942973778 2:181989804-181989826 AGGGGGAGGAAGATGCAGGCAGG - Intronic
943841942 2:192594605-192594627 ACAAGAAGAAAGAAGCAGCCTGG + Intergenic
944061791 2:195577475-195577497 AAAGGAAACAAGATGCAGGCCGG + Intronic
944479824 2:200145060-200145082 ACAGGATGCTAGAAGCAGCCAGG + Intergenic
946090593 2:217219306-217219328 AAAGGAGGCAAGATGCAGGCTGG + Intergenic
946823654 2:223655075-223655097 ACAGGAAAGAAGGAGCAGGCTGG - Intergenic
947765243 2:232633643-232633665 ACGGGACGCAGGGAGCTGGCGGG - Exonic
947981995 2:234418531-234418553 AGATGAAGAAAGAAGCAGGCAGG - Intergenic
948301867 2:236913808-236913830 AAGGGAAGCTAGAACCAGGGTGG + Intergenic
1168829321 20:835920-835942 AGGGAAAGAAAGAAGCAGGTGGG + Intronic
1169928272 20:10805759-10805781 AAGAGCAGCCAGAAGCAGGCAGG - Intergenic
1170082253 20:12490066-12490088 AAGGGAAGAATGAAGCAGGGAGG + Intergenic
1170558335 20:17533649-17533671 AGAGGAAGCAAGGAGGAGGCAGG + Intronic
1170894248 20:20399664-20399686 ACAGGAAACAAGAGGCTGGCTGG + Intronic
1172097341 20:32466898-32466920 ACGGGGAGGCAGCAGCAGGCCGG + Intronic
1172458090 20:35093147-35093169 ACGTGTAGAGAGAAGCAGGCAGG - Intergenic
1172593786 20:36135618-36135640 GAGGGAAGCAGGAAGGAGGCAGG - Intronic
1173102751 20:40102784-40102806 AACGGAAACAGGAAGCAGGCTGG + Intergenic
1173112831 20:40209957-40209979 AAGGGAAGAAAGGAGGAGGCAGG + Intergenic
1174200153 20:48801567-48801589 ACTGGATGCAGGACGCAGGCTGG - Intronic
1175962341 20:62643293-62643315 ATGGAAAGGAAGGAGCAGGCAGG + Exonic
1177182589 21:17758918-17758940 ACAGGAAGCAAGAGGGAGACAGG - Intergenic
1177350792 21:19938765-19938787 ACTGTAAGCAAGAAGAAGCCAGG + Intergenic
1179551622 21:42147122-42147144 ACGGGAAGCTCGCGGCAGGCCGG + Intergenic
1181666485 22:24402007-24402029 AGAGGGAGCAAGAAGGAGGCAGG - Intronic
1181720228 22:24768582-24768604 AAGGAAAACAAGAAGCAGGAAGG + Intronic
1182102970 22:27670692-27670714 AGGGGCAGAAAGAAGCAGGCTGG - Intergenic
1182675048 22:32032518-32032540 ATGGGAAGCCAGAAACAGGTTGG - Intergenic
1183313556 22:37124794-37124816 GCGGGAAGCAGGAGGCAGCCAGG - Intergenic
1184405208 22:44296975-44296997 AGGGGAGGGAAGAAGCAGGCAGG - Intronic
950414610 3:12861780-12861802 CCAGGAAGCAGGAAGCAGGCTGG + Intronic
950416679 3:12872907-12872929 ACGGGAAGCAAGAAGCAGGCTGG + Intergenic
950466032 3:13154144-13154166 CCAGGAAGCAAGAAGTGGGCTGG - Intergenic
950936212 3:16842275-16842297 ACAAGAAACAAGAAGCAGGCTGG + Intronic
951080063 3:18443661-18443683 ACGAGAAGGACGAAGCAGGCAGG - Intronic
952918559 3:38267899-38267921 CCTGGCAGCAGGAAGCAGGCAGG + Intronic
953932744 3:47013915-47013937 ACAGGAGGCAAGAAGCAGGCTGG + Intergenic
955498207 3:59558567-59558589 ATTGAAAGCAAGAACCAGGCTGG - Intergenic
957095013 3:75770262-75770284 AATGAAAACAAGAAGCAGGCCGG + Intronic
957541131 3:81570559-81570581 ACAGGAAGTAAAAAGTAGGCAGG - Intronic
958715404 3:97774341-97774363 CCGGGATTCTAGAAGCAGGCGGG + Intronic
959369059 3:105500261-105500283 AGAGGAAGGAAGAAGAAGGCAGG - Intronic
961786167 3:129348102-129348124 CCAGGAAGCAAGAGGCGGGCTGG + Intergenic
962063599 3:131955624-131955646 ATGGGAAGCAAGAGTCAGGAGGG + Intronic
962390975 3:134972731-134972753 ACAGGGACCAAGAGGCAGGCTGG + Intronic
962454246 3:135550493-135550515 GAGGGAAGCAAGAGGCAGGCAGG + Intergenic
963299210 3:143580234-143580256 ACTGGAAGGAAGAAACATGCTGG - Intronic
963776842 3:149448472-149448494 GGGGGAAGGAAGAAGCAGGGAGG - Intergenic
963945765 3:151144411-151144433 ACAGGAAGAAAGATGCAGTCGGG + Intronic
965005611 3:163019048-163019070 ACGGGCAGCAGCAAGCAGACAGG + Intergenic
965906661 3:173716475-173716497 ACAGGAAGCAAGAGGCAGCAGGG + Intronic
966861353 3:184232669-184232691 TAGAGAAGCAGGAAGCAGGCTGG - Intronic
966996275 3:185283506-185283528 CCGGGAAGCCAGAAACAGGTTGG - Intronic
967319700 3:188183487-188183509 ACTGGAAGCAAGAAGTTGACCGG - Intronic
968036590 3:195553090-195553112 ACTGGAAGCTAGGAGAAGGCAGG - Intergenic
968811499 4:2801489-2801511 AGGGGAAGGGAGATGCAGGCAGG - Intronic
969511786 4:7622206-7622228 ACAGGGAGCAAGAAGGAGGAGGG + Intronic
969566975 4:7984482-7984504 ACGGGGAGCAAGGCGCAGGCAGG + Intronic
973682487 4:53334898-53334920 ATGGGATGCAATAAACAGGCAGG + Intronic
973852492 4:54974916-54974938 AAGGGAGGGAAGAAGAAGGCAGG - Intergenic
973856622 4:55017511-55017533 AAGGGATTCAACAAGCAGGCTGG + Intergenic
974799739 4:66801610-66801632 AAGGGAAAAAAGAGGCAGGCAGG - Intergenic
975040995 4:69744052-69744074 AGCGGAAGCAGGGAGCAGGCAGG - Intronic
975686358 4:76919707-76919729 AAGGAAGGAAAGAAGCAGGCAGG - Intergenic
984476114 4:180237205-180237227 ATGAGAAGCAAGAAGTAGGAAGG + Intergenic
985804729 5:2034344-2034366 ACAAGCAGCAAGAAGAAGGCAGG + Intergenic
985887175 5:2688720-2688742 AAGGGGAGCAGGAAGCATGCAGG - Intergenic
986643375 5:9893152-9893174 AGGGGAAGAAGGAAGAAGGCTGG - Intergenic
989263570 5:39446626-39446648 AAGGGAAGGAAGAAGTAGGCAGG + Intronic
990090095 5:52033944-52033966 CTGAGAAGCATGAAGCAGGCAGG + Intronic
991679836 5:69127822-69127844 ATGAGAAGCCAGAAGCAGGAAGG - Intronic
992970970 5:82057415-82057437 ACTGGAAGCTAGAAGCAGTAAGG - Intronic
993300617 5:86205217-86205239 ATGGCAAGCCAGAAGCAAGCGGG - Intergenic
993970682 5:94416106-94416128 TTGGGAAGCAAGAAGCAGTAAGG + Intronic
995808812 5:116082494-116082516 ATGGGAAGCAAAAAGAAGCCGGG + Intergenic
998208034 5:140173475-140173497 AGGGGGAGGAAGAAGCAGGTGGG - Intergenic
1000101876 5:158024167-158024189 AAGTGAAGCAGAAAGCAGGCAGG - Intergenic
1001761727 5:174213492-174213514 AGGGGAAGAAAGAAGGAAGCTGG - Intronic
1002183406 5:177442906-177442928 ACCGGAAGCAAGAAAGAGGCAGG - Intergenic
1003810795 6:9777525-9777547 CTGGGGAGCAAGAAGCTGGCGGG - Intronic
1005850210 6:29815181-29815203 AGGGAAAGCAAGAAGTAGGGGGG - Intergenic
1006266644 6:32931318-32931340 GCTGGAAGCAAGAAGAAGCCAGG - Intergenic
1007663188 6:43498952-43498974 CTGAGAAGCAAGAAGGAGGCAGG - Intronic
1010173838 6:73002921-73002943 AGGGGAAGCAAGGAGGAGTCAGG + Intronic
1010465311 6:76161243-76161265 ATGGGAACCAAGAAGAAGGATGG - Intergenic
1010749633 6:79603742-79603764 ACGACAAGCAAGAATTAGGCAGG + Intergenic
1013752954 6:113428045-113428067 AGGGGAAGCAAGATGCAGAGAGG + Intergenic
1013795895 6:113888498-113888520 AAGGGGAGCAGGAAGAAGGCAGG + Intergenic
1014350914 6:120344323-120344345 ACTGGAAGCTGGAAGCAGGGAGG + Intergenic
1014634095 6:123823627-123823649 GTGGGAAGCAAGAAGAGGGCTGG + Intronic
1015994893 6:138987772-138987794 TCGGGAAGCTAGCAGGAGGCCGG - Exonic
1016339791 6:143049978-143050000 CGGGGGAGCCAGAAGCAGGCAGG - Intergenic
1016977671 6:149824944-149824966 TGGGGAGGCAAGAGGCAGGCTGG + Intronic
1017630386 6:156391220-156391242 ACAGGAAACGCGAAGCAGGCTGG + Intergenic
1017929120 6:158937440-158937462 ACGGAAAGGAAGAAACAGACTGG - Intergenic
1017960451 6:159216758-159216780 ACAGTAAGTAAGAAGCAAGCTGG - Intronic
1018421890 6:163647300-163647322 ACAGGAAGCACGCAGCAGGTGGG + Intergenic
1019173800 6:170149622-170149644 AGGGGCAGCAGGCAGCAGGCTGG - Intergenic
1019173815 6:170149682-170149704 AGGGGCAGCAGGCAGCAGGCTGG - Intergenic
1019173881 6:170150025-170150047 AGGGGCAGCAGGCAGCAGGCTGG - Intergenic
1019553452 7:1616552-1616574 ACAGAAAGCAGGCAGCAGGCTGG - Intergenic
1019801968 7:3094513-3094535 ACTGGAAACCAGAAGGAGGCGGG + Intergenic
1021431388 7:20562232-20562254 ACAGGAAGCAGTCAGCAGGCAGG + Intergenic
1022633893 7:32112882-32112904 ACAATAACCAAGAAGCAGGCAGG - Intronic
1024128735 7:46327570-46327592 ACAAGAAGCAAGGAGCCGGCAGG + Intergenic
1024577913 7:50779988-50780010 AAGGGAAGAAAGAAGCAAACGGG + Intronic
1025998347 7:66542732-66542754 GGGTGAAGCTAGAAGCAGGCAGG - Intergenic
1026598586 7:71754446-71754468 AGGGGAGGGGAGAAGCAGGCAGG - Intergenic
1027916783 7:84334717-84334739 ACAGGAGGGAAGAAGCAGGGGGG - Intronic
1027952858 7:84840563-84840585 AGGGGAAGGAAAAAGAAGGCTGG - Intergenic
1029703419 7:102262571-102262593 ACGGGCAGCAAGACCCTGGCAGG - Intronic
1032017417 7:128388888-128388910 AGGGTAAGCAAGGAGGAGGCTGG + Intergenic
1032538698 7:132685674-132685696 AGGGGACTCAAGAAGCAGGAGGG - Intronic
1036089564 8:5650741-5650763 ATGGAAGGGAAGAAGCAGGCAGG - Intergenic
1036776376 8:11615696-11615718 TCGGGAAACAAGAAGGAGGCAGG - Intergenic
1040111525 8:43568995-43569017 AGGGGAAGCTTGAGGCAGGCCGG - Intergenic
1040980126 8:53238481-53238503 ATGGGAAGCAAGGGGCAGGCCGG + Intronic
1041732401 8:61075849-61075871 AAGGGAAGAAGGAAGGAGGCTGG - Intronic
1042676690 8:71329258-71329280 ACGGGTAGAAAGAAGAAGGTAGG - Intronic
1043477214 8:80616897-80616919 GAGGGCAGCAAGCAGCAGGCTGG - Intergenic
1044900918 8:96943580-96943602 ACAGCAAGAAAGTAGCAGGCTGG + Intronic
1045343949 8:101277871-101277893 ATTGGAAGAGAGAAGCAGGCAGG - Intergenic
1047026969 8:120834954-120834976 CATGGAAGCAAGAAGCAGCCAGG + Intergenic
1047185030 8:122625114-122625136 ACTGGAATCTAGAAGCAAGCAGG - Intergenic
1049047205 8:140162224-140162246 AGGGGAGGGAAGAAGCAGGGTGG - Intronic
1049303281 8:141883159-141883181 AAGAGAAGGAAGAAGCAGGAGGG + Intergenic
1049426426 8:142539901-142539923 ACGGGGAGCAAGAGGAAGGCGGG + Intronic
1049763566 8:144342406-144342428 GCTGAAAGCAAGAAGGAGGCGGG - Intergenic
1050298356 9:4230302-4230324 ACTGCAGGCCAGAAGCAGGCAGG + Intronic
1051056021 9:12987064-12987086 ATGGGAAGCAAGAAGCACATTGG + Intergenic
1051464771 9:17365291-17365313 AAGGGGAACAGGAAGCAGGCAGG - Intronic
1051692226 9:19727501-19727523 AAGGGAAGCTCCAAGCAGGCAGG + Intronic
1052999637 9:34570887-34570909 AAGGGTAGCAAAAGGCAGGCAGG - Intronic
1055861618 9:80756980-80757002 AAGGTAAGGGAGAAGCAGGCAGG + Intergenic
1056556749 9:87695694-87695716 AGAAGAAGCAAGAAGCATGCAGG - Intronic
1058033449 9:100224908-100224930 ACCTCAAGAAAGAAGCAGGCCGG - Intronic
1060213239 9:121723243-121723265 GAGGGAGGCAACAAGCAGGCTGG + Intronic
1060892398 9:127197080-127197102 ATGGGAAGCTAGAAGGAGGGAGG + Intronic
1061001636 9:127905986-127906008 TGGCGAAGCAAGGAGCAGGCTGG - Intergenic
1061116908 9:128619405-128619427 TCTGAAATCAAGAAGCAGGCAGG + Intronic
1061791741 9:133062776-133062798 ACGGGTGGAGAGAAGCAGGCAGG + Intronic
1061936718 9:133861935-133861957 AAGGGAAGCAAGCAGCACCCTGG - Intronic
1062241891 9:135545416-135545438 ACGTGCAGGAAGAAACAGGCAGG + Intergenic
1062269096 9:135700547-135700569 AGGGGAGGCAAGAAGGAGCCCGG + Intergenic
1062388355 9:136324155-136324177 TGGGGAAGGAAGAAGCAGGCCGG - Intergenic
1062698284 9:137886376-137886398 ACGGGAAGGCAGACGAAGGCAGG - Intronic
1062725942 9:138073640-138073662 AGGGGAAGCAAGACGGAGGAAGG - Intronic
1185714582 X:2330715-2330737 AGGGGAAGGAAGAAGTAGGAGGG + Intronic
1187023824 X:15411767-15411789 GCGGGAGGGAAGAACCAGGCAGG - Intronic
1188121428 X:26312945-26312967 AAGGGAGGCAAGAAGGAGGTGGG + Intergenic
1189496890 X:41516669-41516691 ATAGGAAGCAAGAAGGAGGAGGG + Intronic
1189517913 X:41734006-41734028 AAGGGAACCAAAAAGCAGCCAGG + Intronic
1192214176 X:69146704-69146726 AAGGGAAGCAGGAAGCGGGAGGG + Intergenic
1194875886 X:99187456-99187478 AAGGGAAGCAAGAACAAGGGAGG - Intergenic
1195770701 X:108347946-108347968 GCAGGAAACAAGCAGCAGGCAGG + Intronic
1199944278 X:152652956-152652978 AGGGTGTGCAAGAAGCAGGCTGG + Exonic