ID: 950416680

View in Genome Browser
Species Human (GRCh38)
Location 3:12872908-12872930
Sequence CGGGAAGCAAGAAGCAGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 309}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950416672_950416680 0 Left 950416672 3:12872885-12872907 CCTTCCCCAACAAAGAGCAGGAA 0: 1
1: 0
2: 3
3: 35
4: 303
Right 950416680 3:12872908-12872930 CGGGAAGCAAGAAGCAGGCTGGG 0: 1
1: 0
2: 4
3: 29
4: 309
950416669_950416680 30 Left 950416669 3:12872855-12872877 CCTGGAGTTCAACCAGTCATATA 0: 1
1: 0
2: 0
3: 8
4: 127
Right 950416680 3:12872908-12872930 CGGGAAGCAAGAAGCAGGCTGGG 0: 1
1: 0
2: 4
3: 29
4: 309
950416677_950416680 -6 Left 950416677 3:12872891-12872913 CCAACAAAGAGCAGGAACGGGAA 0: 1
1: 0
2: 0
3: 14
4: 207
Right 950416680 3:12872908-12872930 CGGGAAGCAAGAAGCAGGCTGGG 0: 1
1: 0
2: 4
3: 29
4: 309
950416670_950416680 18 Left 950416670 3:12872867-12872889 CCAGTCATATAAGATTCTCCTTC 0: 1
1: 1
2: 2
3: 9
4: 130
Right 950416680 3:12872908-12872930 CGGGAAGCAAGAAGCAGGCTGGG 0: 1
1: 0
2: 4
3: 29
4: 309
950416674_950416680 -4 Left 950416674 3:12872889-12872911 CCCCAACAAAGAGCAGGAACGGG 0: 1
1: 0
2: 0
3: 13
4: 105
Right 950416680 3:12872908-12872930 CGGGAAGCAAGAAGCAGGCTGGG 0: 1
1: 0
2: 4
3: 29
4: 309
950416676_950416680 -5 Left 950416676 3:12872890-12872912 CCCAACAAAGAGCAGGAACGGGA 0: 1
1: 0
2: 0
3: 14
4: 130
Right 950416680 3:12872908-12872930 CGGGAAGCAAGAAGCAGGCTGGG 0: 1
1: 0
2: 4
3: 29
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950416680 Original CRISPR CGGGAAGCAAGAAGCAGGCT GGG Intergenic
900927129 1:5712764-5712786 CAGGAAGTAAGAAGCAGGCTGGG - Intergenic
901002815 1:6157095-6157117 AGGGAAGGAAGAAGAAGGGTGGG - Intronic
901501863 1:9657506-9657528 CGGAAAGCAGGAAGGAGGCTGGG - Intronic
901788314 1:11639226-11639248 CAGGAAGCTACAAGCTGGCTAGG + Intergenic
901843153 1:11966225-11966247 TGGGAAGTGGGAAGCAGGCTAGG - Intronic
903224562 1:21887368-21887390 CGGGGAGCAGGAAGCTGGCCCGG - Intronic
903533709 1:24052539-24052561 CAGAAAGCAAGAAGCTGGATGGG - Intergenic
904114724 1:28153387-28153409 TGGGAAGCAAGAACCCAGCTGGG + Intronic
905399747 1:37692628-37692650 AGGGAAGCAAGAAACTGGGTAGG - Exonic
905807964 1:40890579-40890601 CGGTAGGCAAGAAGAAGGTTGGG + Intergenic
905875132 1:41427455-41427477 TGAGCAGCAAGAGGCAGGCTAGG + Intergenic
905911143 1:41655666-41655688 GGAGAAGCATGAAGCAGGGTGGG - Intronic
906376343 1:45299676-45299698 TGGGAAGCAAGAGGCAGGTGTGG - Intronic
906608853 1:47188689-47188711 TGGGAAGGAGGAAGGAGGCTAGG + Intronic
908316885 1:62941497-62941519 TGGGGAGAAAGAAGCAGGCAGGG - Intergenic
911184267 1:94887688-94887710 TGGGAAGCAAGAAGCACTTTAGG + Intronic
912568501 1:110605923-110605945 CAGGGAGCAAGACTCAGGCTTGG + Intronic
912925367 1:113908104-113908126 CGGGAAGGAAGAACCAGGGCTGG - Exonic
913223593 1:116679387-116679409 CTGGTGGCCAGAAGCAGGCTGGG - Intergenic
913285778 1:117225125-117225147 CCTGGAGCCAGAAGCAGGCTGGG - Intergenic
914341762 1:146765995-146766017 AGGGAAGCAACGAGGAGGCTGGG + Intergenic
915734690 1:158077401-158077423 TGGGAAGCAAGAAGCGGGTGGGG + Intronic
916914415 1:169391168-169391190 CGGGAAGCAATAATAAGGCTTGG - Intronic
917627282 1:176859291-176859313 AGGGGAGCAAGAAGAAGGGTGGG - Intronic
918671944 1:187228347-187228369 TGGGAAGCTGGAGGCAGGCTAGG + Intergenic
919423440 1:197400586-197400608 CTGGAAGGAAGAAGCAGGATAGG - Intronic
919640076 1:200038674-200038696 GGGGAAGCAAGAAGAAGGGATGG - Intronic
920364541 1:205441105-205441127 CAGGAAGAGAGAAGCAAGCTGGG + Intronic
920610174 1:207428271-207428293 AGGGAAGCTAAAAGCAGACTTGG - Intergenic
922550390 1:226490178-226490200 TGGGAAGCAAACAGCAGGCCTGG + Intergenic
923434400 1:233954774-233954796 CAGGAAGATAGAAGAAGGCTGGG + Intronic
1063374270 10:5544448-5544470 TGGCCAGCAAGTAGCAGGCTTGG - Intergenic
1063548287 10:7002910-7002932 TGGGATGCAAGATGCTGGCTAGG - Intergenic
1064354161 10:14603445-14603467 AGGGAGGAAGGAAGCAGGCTTGG + Intronic
1064642871 10:17432020-17432042 CCGGAAGCAAGAAGTAGACTAGG + Intronic
1064690446 10:17912184-17912206 TAGGAAGTAAGAAGTAGGCTGGG + Intergenic
1064802002 10:19086932-19086954 AGGGAAGCTAAAAGCAGACTTGG - Intronic
1065229846 10:23586809-23586831 CGGGAAGTAGGAATAAGGCTGGG + Intergenic
1067327232 10:45281094-45281116 CGGGAAACGAGAAGGAGGCCTGG + Intergenic
1067703367 10:48589331-48589353 GTTGAAGCCAGAAGCAGGCTGGG - Intronic
1069379573 10:67829123-67829145 AGGGAAGCAAAAAGCAGACTCGG + Intronic
1069635708 10:69923607-69923629 GAGGAAGCAAGACCCAGGCTGGG + Intronic
1070056943 10:72944763-72944785 CAGAAAGCTAGAAGCAGCCTGGG - Intronic
1070310370 10:75268993-75269015 CAGCAAGAAAGAAGGAGGCTGGG - Intergenic
1072166169 10:92815073-92815095 CAGGCAGCAGGAAGGAGGCTGGG - Intergenic
1073336698 10:102714953-102714975 CGGAGGGCAAGAAGCAGCCTGGG + Intronic
1073944199 10:108731259-108731281 CGGGAAGCAAGAAGGGGGCCTGG + Intergenic
1077485888 11:2838304-2838326 CAGAAAGAAGGAAGCAGGCTTGG + Intronic
1077920670 11:6639820-6639842 CAGGAAGCAAGTTCCAGGCTGGG + Exonic
1078758970 11:14236384-14236406 TGGGAAGAATGAAGGAGGCTGGG + Intronic
1080314813 11:30936718-30936740 AGGGAAGCTAAAAGCAGACTGGG + Intronic
1081847833 11:46253393-46253415 CTGGAAGCAAGGGGCAGTCTTGG + Intergenic
1081935888 11:46903747-46903769 AGGGGAGCAGGAAGCAGGGTGGG + Intronic
1083552126 11:63597956-63597978 TGGGAAGCAAGAAGAATGTTGGG + Intronic
1084113413 11:67027871-67027893 CGGCAAGGCAGAAGCAGGCTGGG + Intronic
1084321463 11:68375642-68375664 CGGGACCCAGGAAACAGGCTGGG + Intronic
1086283537 11:85219077-85219099 AGGGAGGCAAGGAGCAGGCATGG + Intronic
1088629698 11:111762858-111762880 TTGGAAGCATGAAACAGGCTGGG - Intronic
1089294016 11:117457394-117457416 TAGGAGGCAAGAAGAAGGCTGGG + Intronic
1089450004 11:118587754-118587776 TGGGAAGGAAGAATCAGTCTTGG - Intronic
1089826666 11:121283983-121284005 CGGGAAACAAGAAGGGGGCCTGG + Intergenic
1090840473 11:130483328-130483350 AGGGGAGGAAGAAGCCGGCTTGG + Intergenic
1093683536 12:22030498-22030520 TGGGAAGCCAGAAGCAGGGGTGG - Intergenic
1094125364 12:27017452-27017474 AGGGAAGCTAAAAGCAGACTCGG - Intergenic
1094203869 12:27819937-27819959 AGGGAAGCTAAAAGCAGACTCGG - Intergenic
1094568286 12:31619493-31619515 AATGAAGAAAGAAGCAGGCTGGG - Intergenic
1095141587 12:38669825-38669847 AGGGAAGCTAAAAGCAGACTCGG + Intronic
1096263153 12:50105252-50105274 CGGGAGGCCAAAAGCAGCCTGGG - Intronic
1096584078 12:52608272-52608294 GGGGAAGCCAGGACCAGGCTGGG - Exonic
1096591345 12:52661998-52662020 CAGGTGGCAAGATGCAGGCTAGG - Intergenic
1099690023 12:85940114-85940136 CAGGAAGAAAGATGTAGGCTGGG - Intergenic
1100287185 12:93178051-93178073 AGGGAAGCTAAAAGCAGGCTTGG + Intergenic
1100361848 12:93886454-93886476 TAAGAAGCAAGAGGCAGGCTGGG - Intronic
1100366522 12:93926171-93926193 AGGGAAGCTAAAAGCAGACTGGG + Intergenic
1100701758 12:97155875-97155897 AGGAGAGCAAGAAGCAGGCATGG - Intergenic
1101243925 12:102866529-102866551 GGGCAAGGGAGAAGCAGGCTAGG + Intronic
1101259627 12:103014828-103014850 AGGGAAGGAATAAGCAGGCCTGG + Intergenic
1103427969 12:120855011-120855033 AGGGAAGGAAGAAGCATGCAGGG + Intronic
1103453729 12:121048530-121048552 AGGGAAGCTAGAAGCAGACGTGG - Intergenic
1104529874 12:129559651-129559673 CAGGAAGCAAGAAGAATTCTAGG - Intronic
1104594775 12:130113602-130113624 GGGGAGGAAAGAGGCAGGCTGGG + Intergenic
1105592813 13:21810365-21810387 CTGGAAGAAAGAAGCAGGTTAGG - Intergenic
1105595621 13:21834939-21834961 GGAAAAGCAAAAAGCAGGCTGGG - Intergenic
1106589042 13:31083187-31083209 CGGGAAGCAGGAAACAGACATGG + Intergenic
1108457543 13:50631335-50631357 GTGAAAGCAAGAAGAAGGCTAGG + Intronic
1108825076 13:54403544-54403566 AGGGGAGAAAGATGCAGGCTGGG - Intergenic
1110986566 13:81977959-81977981 GGGGAAGCTAAAAGCAGACTTGG + Intergenic
1112084539 13:96016586-96016608 AGGCAAGCATGAAGGAGGCTTGG + Intronic
1112740450 13:102467183-102467205 AGTGAAGCCAGAAGTAGGCTGGG + Intergenic
1113637079 13:111927000-111927022 CGGGCAGCCAGGAGGAGGCTGGG + Intergenic
1113842867 13:113370184-113370206 CAGGAAGCAAGAGGCTGACTCGG + Intergenic
1114497551 14:23143435-23143457 CTGGAAGCCAGAAGTAGGCATGG + Intronic
1119348187 14:73943486-73943508 TGGGAAGGAAGAGGCAGGCATGG - Intronic
1120961472 14:90128936-90128958 CGGGGAGGAAGACGCAGGATAGG - Intronic
1121324755 14:93013405-93013427 AGGGCAGCCAGAAGCAGGCACGG + Intronic
1121570409 14:94942748-94942770 CTGTAAGCAACAAGCAGGCAAGG + Intergenic
1122781988 14:104147596-104147618 CGGGGGGCAAGGAGCGGGCTCGG - Intronic
1122800847 14:104228850-104228872 AGGGAAGCAGGGAGCAGGGTGGG + Intergenic
1124968812 15:34463716-34463738 CCGGGAGAAAGATGCAGGCTGGG - Intergenic
1125724563 15:41861695-41861717 GGGGGGGCAAGATGCAGGCTGGG + Intronic
1127604102 15:60568606-60568628 TGGGAGGCAGGAAGCAGGCCAGG + Intronic
1127773005 15:62245536-62245558 CAGGAAGCAAGAAACAGTCACGG + Intergenic
1129263572 15:74382261-74382283 CGGGAATGAAGAGGCAGGCTAGG + Intergenic
1131393640 15:92069564-92069586 CTGGAAGCAAGAGGCAGGACTGG - Intronic
1131753656 15:95537343-95537365 CTGGAAGCAAGAACCAGGACTGG - Intergenic
1132256421 15:100380582-100380604 GGGGAAACCAGATGCAGGCTGGG - Intergenic
1132875517 16:2135378-2135400 CGGGAAGCAGGACGCGGGCCAGG - Intronic
1132882913 16:2170299-2170321 CGGGAAGCAGGAAGCAGCCCGGG + Intronic
1134519470 16:14911982-14912004 CGGGAAGCAGGACGCGGGCCAGG + Intronic
1134554466 16:15154253-15154275 CGGGAAGCAGGACGCGGGCCAGG - Intergenic
1134707140 16:16310637-16310659 CGGGAAGCAGGACGCGGGCCAGG + Intergenic
1134960400 16:18401487-18401509 CGGGAAGCAGGACGCGGGCCAGG - Intergenic
1135349052 16:21713432-21713454 CGCGATGGAGGAAGCAGGCTAGG - Intronic
1135859143 16:26038976-26038998 CTTGAAGGAAGAACCAGGCTGGG - Intronic
1135948566 16:26889372-26889394 CGAGAAGCAAAAGGAAGGCTTGG + Intergenic
1137019431 16:35409071-35409093 AGGGAAGCTAAAAGCAGACTTGG - Intergenic
1139440070 16:66962159-66962181 CGGGTACCAGGAAGCTGGCTGGG - Intronic
1139992518 16:70951447-70951469 AGGGAAGCAACGAGGAGGCTTGG - Intronic
1140064660 16:71600811-71600833 ATGAAAGCAAGAAGCAGGCTAGG - Intergenic
1140752862 16:78041902-78041924 CTGGAAGCCAGAAGGAGGCTTGG + Intronic
1142245316 16:88967634-88967656 AGGGAAGGAAGGAGCAGGCCGGG + Intronic
1142534057 17:601408-601430 CGGGAAGCCAGCAGCACCCTCGG - Intronic
1142714030 17:1738243-1738265 CGGGAAGGAAGAAGGAGGCTAGG + Exonic
1142899859 17:3005128-3005150 CTGGAGGCCAGAAGCAGGTTTGG - Intronic
1144021781 17:11244446-11244468 CCGGAAGCAAGAAGCTGAGTTGG - Intronic
1145694354 17:26775063-26775085 CGGGAAGCAAAAAGCCGCTTTGG - Intergenic
1145928295 17:28664549-28664571 AGGGAAGCATGTAGAAGGCTCGG - Intronic
1147183694 17:38702509-38702531 CGGGAAGCGGGAAGCAGGAGCGG + Intergenic
1147254426 17:39173768-39173790 CGAGGACAAAGAAGCAGGCTTGG + Exonic
1148201005 17:45750015-45750037 TGGGAAGCAGGTAGCAGGCAAGG + Intergenic
1148322889 17:46768280-46768302 CGGGAAGCAGGGGGGAGGCTGGG - Intronic
1149912270 17:60577476-60577498 GGGTAAGCAAGAGACAGGCTGGG - Intronic
1149988825 17:61368893-61368915 GAGTAAGCATGAAGCAGGCTGGG + Intronic
1150616369 17:66775482-66775504 TGGTAATCACGAAGCAGGCTTGG + Intronic
1150681688 17:67289801-67289823 CTGGAAGGGAGCAGCAGGCTGGG + Intergenic
1150706835 17:67494673-67494695 GCAGAAGCAAGAAGTAGGCTGGG + Intronic
1151788376 17:76287843-76287865 AGGGAATCAAGAAGCAGGGAAGG - Exonic
1152072702 17:78141894-78141916 AGGGAGCCATGAAGCAGGCTGGG - Exonic
1152418097 17:80175908-80175930 AGGGAAGCAGGAGGCAGGGTGGG + Intronic
1152528125 17:80901236-80901258 CGGGAAGCACACAGCAGCCTGGG + Intronic
1155465463 18:26130175-26130197 GGTGAAGGAAGAAGCAGGGTGGG - Intergenic
1158708775 18:59818525-59818547 CAGGAAGCAGGAAGCAAACTGGG + Intergenic
1160130819 18:76223511-76223533 CTTGGAGAAAGAAGCAGGCTGGG - Intergenic
1160899795 19:1421953-1421975 CGGGAAGCAAAGGGCACGCTCGG - Intronic
1161550375 19:4909380-4909402 CGGGAAGCGAGAAAGAGGGTGGG - Intronic
1162232703 19:9280994-9281016 CTAGAAGCAAGAAGCAGCATGGG + Intergenic
1162464232 19:10830908-10830930 CCGGGAGCAAGAGGCAGGCCTGG - Intronic
1163057689 19:14733497-14733519 AGGGAAGCTAAAAGCAGACTTGG + Exonic
1163073468 19:14866212-14866234 AGGGAAGCTAAAAGCAGACTTGG + Intergenic
1163378381 19:16948449-16948471 CAGGAAGAAAGAAAGAGGCTGGG + Intronic
1163786252 19:19276448-19276470 CGGGATGCAAGATGCTGTCTCGG - Intronic
1164554636 19:29241800-29241822 GGGGAAGAAAGAAGGAGGCTGGG - Intergenic
1164574450 19:29397594-29397616 CAGGAAGCATGAGGCAGGCCAGG - Intergenic
1164842835 19:31406347-31406369 TGGGAACCAAAAAGCAGGCAAGG - Intergenic
1165373747 19:35426863-35426885 GGGAAAGCAAGAAGCAGGATGGG - Intergenic
1165790597 19:38489374-38489396 AGGGGAGAAAGAAGAAGGCTTGG + Exonic
1165951564 19:39476388-39476410 CTGGAAGCCTGAAGCAGGCAGGG + Exonic
1166812318 19:45522008-45522030 AGGGAACCAAGAAGGGGGCTGGG - Intronic
1166929394 19:46292701-46292723 CAGAGAGCAAGAAGGAGGCTGGG - Intergenic
1167075697 19:47247463-47247485 CGGGAAACTAGAAGGAGGCCCGG + Intergenic
1167576589 19:50320629-50320651 CGGTGAGGAGGAAGCAGGCTCGG + Exonic
1167762567 19:51458662-51458684 CGGGAAGCAAGAAAGAGGTTGGG - Intergenic
1168355871 19:55699323-55699345 CGGGAAGCTAGAAGCACGTGTGG - Intronic
925233156 2:2253669-2253691 TGGGAAACAAGAAGCAGGGCAGG + Intronic
925827993 2:7869203-7869225 CTGGAAGCATCAAGCAGGCCTGG + Intergenic
927465617 2:23334264-23334286 TAGGAAGCAAGAACCAGGCGGGG + Intergenic
927843179 2:26457896-26457918 CCGCAAGCAGGAGGCAGGCTCGG + Exonic
927887917 2:26729872-26729894 TGGCTAGCAACAAGCAGGCTGGG - Exonic
927971512 2:27308445-27308467 AGGAAAGCGAGAAGCCGGCTGGG + Exonic
928377793 2:30790042-30790064 GGGGAAGGGAGAAGCAGGCAGGG + Intronic
929689307 2:44061377-44061399 CGGGGAGGAAGACGCAGGATTGG - Intergenic
929819710 2:45263358-45263380 CCGAAAACAGGAAGCAGGCTGGG - Intergenic
930599179 2:53424197-53424219 AGGGAAGCTAAAAGCAGACTCGG - Intergenic
932740151 2:74284985-74285007 GGGAAAGTAACAAGCAGGCTGGG - Intronic
933182788 2:79245955-79245977 CCAGAATGAAGAAGCAGGCTGGG - Intronic
936230403 2:110695361-110695383 AGGGAAGCTAAAAGCAGACTCGG + Intergenic
936233602 2:110725050-110725072 GGGGAAGAAAGAAGGAGGCAAGG + Intergenic
936867163 2:117087835-117087857 AGGGAAGCTAAAAGCAGACTTGG + Intergenic
938536949 2:132255455-132255477 CGAGAGGCAAGAAGCAGGGACGG + Intronic
941820510 2:169840116-169840138 AGGGAAGCTAAAAGCAGACTCGG - Intronic
942398936 2:175580940-175580962 CTGGAGGGAAGAAGCATGCTAGG + Intergenic
942748778 2:179264819-179264841 CGGGAAGGAGGAAGGAGGCGGGG + Intergenic
945998888 2:216464179-216464201 AGGGAAGCAAAAAGCAAGTTGGG + Intronic
946823653 2:223655074-223655096 CAGGAAAGAAGGAGCAGGCTGGG - Intergenic
947402883 2:229746326-229746348 TGGGAAGGCAGAGGCAGGCTGGG + Intergenic
947567348 2:231202885-231202907 AGGGAAGCTAAAAGCAGACTTGG + Intronic
948301868 2:236913809-236913831 AGGGAAGCTAGAACCAGGGTGGG + Intergenic
948707185 2:239802224-239802246 CAGGAAGGAACACGCAGGCTGGG + Exonic
949072548 2:242034483-242034505 CCGGCAGCCAGCAGCAGGCTGGG + Intergenic
1169549631 20:6688840-6688862 CGGGCAGAAAGAAGAAGGCTAGG - Intergenic
1169889254 20:10434758-10434780 CTGGAACCCAGAAGCAGGATGGG - Intergenic
1170084200 20:12510792-12510814 CTGGAAGCTAGAATCAAGCTGGG + Intergenic
1171865854 20:30487234-30487256 CGAGAGGCAAGAAGCAGGGATGG + Intergenic
1172427059 20:34862764-34862786 CTGGAGGCAAGAAGTAGGCCTGG + Intronic
1172593785 20:36135617-36135639 AGGGAAGCAGGAAGGAGGCAGGG - Intronic
1173733252 20:45342672-45342694 CAGGAGGCAAGAACAAGGCTGGG + Intronic
1175285072 20:57832362-57832384 GGTGAAGCAGGAAGGAGGCTGGG + Intergenic
1175600884 20:60271901-60271923 CAAGAAGCAAGATGCTGGCTGGG + Intergenic
1175991475 20:62791944-62791966 AGGGCAGGAAGAGGCAGGCTCGG + Intergenic
1176076457 20:63250552-63250574 CGAGATGCAGGCAGCAGGCTGGG - Intronic
1178505386 21:33158478-33158500 CCGGAACCCAGGAGCAGGCTGGG + Intergenic
1178524825 21:33318752-33318774 CGGGAAACTGAAAGCAGGCTTGG + Intergenic
1180983492 22:19890698-19890720 CAGAAAGCAAGAACCAAGCTGGG - Intronic
1182102969 22:27670691-27670713 GGGGCAGAAAGAAGCAGGCTGGG - Intergenic
1182972119 22:34588921-34588943 CGGGGAGCAGGAAGCACGTTTGG + Intergenic
1183313555 22:37124793-37124815 CGGGAAGCAGGAGGCAGCCAGGG - Intergenic
1183592481 22:38788060-38788082 CGGGAAGCAAGAGGCAGGCCTGG - Intronic
1183722853 22:39572403-39572425 AGGGATGCCAGATGCAGGCTGGG + Intronic
1184097338 22:42323630-42323652 GGAGAAGCGGGAAGCAGGCTTGG + Intronic
1184595589 22:45512176-45512198 TGGGATGGAAGAAGCAGGCGTGG + Intronic
1184850830 22:47119304-47119326 CTGGAAAGAAGCAGCAGGCTTGG + Intronic
1185066281 22:48633144-48633166 TGGGCAGCAAGGAGGAGGCTGGG + Intronic
1185111290 22:48901547-48901569 CTGGAAGCAGGGAGGAGGCTTGG + Intergenic
1185111618 22:48903221-48903243 CCGGAAGCAGGGAGGAGGCTTGG - Intergenic
949119099 3:364001-364023 GTGGAAGTGAGAAGCAGGCTGGG - Intronic
950414611 3:12861781-12861803 CAGGAAGCAGGAAGCAGGCTGGG + Intronic
950414939 3:12863770-12863792 CAGGAAGTAAGAAGTGGGCTGGG + Intronic
950416680 3:12872908-12872930 CGGGAAGCAAGAAGCAGGCTGGG + Intergenic
950466031 3:13154143-13154165 CAGGAAGCAAGAAGTGGGCTGGG - Intergenic
950610089 3:14121060-14121082 AGGGAAGCTAAAAGCAGTCTTGG - Intronic
951534009 3:23725384-23725406 AGGTAAGCAAGGACCAGGCTGGG + Intergenic
952752576 3:36837230-36837252 CTAGAGGCAAGAAGCAGGCAAGG - Intronic
952898293 3:38093797-38093819 AGGTAAGCAAGAAGAAGGGTTGG - Intronic
953810673 3:46109719-46109741 TGGGCAGCAAGAAGCCTGCTGGG - Intergenic
954663339 3:52237645-52237667 GGGGAAGGAAGAAGCTGGCCAGG + Intronic
955072981 3:55587345-55587367 TTGGATGAAAGAAGCAGGCTGGG - Intronic
956344431 3:68262421-68262443 GGGGAAGGAAGAAGGAGGCATGG - Intronic
957515145 3:81240661-81240683 TGGGAAGAAAGAAGCAGGGAAGG + Intergenic
958415322 3:93867108-93867130 CGTGAAGGAAGAAGCTTGCTTGG - Intergenic
958715405 3:97774342-97774364 CGGGATTCTAGAAGCAGGCGGGG + Intronic
961171002 3:124797663-124797685 AGGAAAGCAAGAATGAGGCTTGG + Intronic
961544357 3:127621937-127621959 TGAGAAGCACAAAGCAGGCTTGG - Exonic
961583519 3:127902977-127902999 CGGGAAGAAATAAGGGGGCTTGG - Intergenic
961713330 3:128843261-128843283 CAGAAAGCCGGAAGCAGGCTGGG - Intergenic
961786168 3:129348103-129348125 CAGGAAGCAAGAGGCGGGCTGGG + Intergenic
961796613 3:129413489-129413511 AGGGAAGCTAAAAGCAGACTTGG + Intronic
963776841 3:149448471-149448493 GGGGAAGGAAGAAGCAGGGAGGG - Intergenic
965621331 3:170644872-170644894 AGGGAACCAGGAAGCAGGCCAGG + Intronic
966656591 3:182365056-182365078 CTGGAAACAAGAATCAGGCTTGG + Intergenic
969423276 4:7109425-7109447 TGGGAAGACAGGAGCAGGCTTGG - Intergenic
969534455 4:7747295-7747317 AGGGAAGGAAGGAGCAGGCCTGG + Intergenic
969566976 4:7984483-7984505 CGGGGAGCAAGGCGCAGGCAGGG + Intronic
970410309 4:15799997-15800019 AGGGAAGCTAAAAGCAGACTCGG + Intronic
971476809 4:27080283-27080305 CAGGAAGGAAGAATCAGGCATGG + Intergenic
974863527 4:67552345-67552367 AGGGAAGCTAAAAGCAGACTCGG - Intergenic
975601670 4:76106610-76106632 AGGGAAGCTAAAAGCAGACTTGG - Intronic
976165743 4:82252708-82252730 CAAGAAGCAAGAAGCACACTGGG - Intergenic
976834658 4:89357569-89357591 TGGGAAGAGAGAAGCAGGATTGG - Intergenic
978834265 4:113128924-113128946 TGGAAACCAAGATGCAGGCTAGG - Intronic
979398587 4:120219787-120219809 CTGGAAGAAAGATGTAGGCTGGG - Intergenic
981307193 4:143259312-143259334 CAGGAAGCAGGAAGCAGGGGTGG + Intergenic
982358708 4:154495581-154495603 CGGGAAGTAAAAACCAGCCTAGG + Intergenic
983627672 4:169818761-169818783 CGGGAAGGAAGAAGTAAGGTGGG - Intergenic
983929449 4:173436954-173436976 GGGAAAGCCAGCAGCAGGCTTGG - Intergenic
985913476 5:2900619-2900641 CTGGGAGCAAGAAGCAGGAGAGG - Intergenic
986079026 5:4369791-4369813 CCAGAAAAAAGAAGCAGGCTGGG + Intergenic
986511162 5:8507588-8507610 CAGGAAGCAGGAAGGAGGCATGG + Intergenic
987692385 5:21283527-21283549 TGGGAAGCAAGAAGGGGGCCTGG - Intergenic
987871072 5:23617512-23617534 AGGGAAGCTAAAAGCAGGCTTGG - Intergenic
988080239 5:26404909-26404931 CGGGGAGAAAGATGCAGGATGGG + Intergenic
989263571 5:39446627-39446649 AGGGAAGGAAGAAGTAGGCAGGG + Intronic
990875405 5:60478776-60478798 CTGCAAGCATGAAGGAGGCTGGG - Intronic
991747973 5:69766523-69766545 TGGGAAGCAAGAAGGGGGCCTGG + Intergenic
991799549 5:70346371-70346393 TGGGAAGCAAGAAGGGGGCCTGG + Intergenic
991829048 5:70663667-70663689 TGGGAAGCAAGAAGGGGGCCTGG - Intergenic
991891908 5:71345800-71345822 TGGGAAGCAAGAAGGGGGCCTGG + Intergenic
993970683 5:94416107-94416129 TGGGAAGCAAGAAGCAGTAAGGG + Intronic
995725924 5:115180180-115180202 GGGAAAGCAAGAAGCGGGCTTGG + Intronic
996498736 5:124192273-124192295 CTGGAAGAAAGATGCAGGTTAGG - Intergenic
996874062 5:128222258-128222280 CGGGAAGCGAGAAGGGGGCCTGG - Intergenic
998140330 5:139696470-139696492 CGGAAAGCAAGGCTCAGGCTAGG + Intergenic
998258731 5:140611311-140611333 AGGGAAGCTAAAAGCAGACTGGG - Intergenic
1000292970 5:159888520-159888542 CAGGAAGCAAGAAGCATATTAGG + Intergenic
1000470291 5:161631582-161631604 TTGGAAGCAAGAAGTAGGTTTGG - Intronic
1001761726 5:174213491-174213513 GGGGAAGAAAGAAGGAAGCTGGG - Intronic
1002434989 5:179225739-179225761 GGGGAAGCCAGAAGGAGGATGGG - Intronic
1003277892 6:4667842-4667864 TGGGAAGAGAGAAGAAGGCTAGG - Intergenic
1003287419 6:4746662-4746684 AGGGAAGAGAGAAGCAGGTTTGG + Intronic
1003810794 6:9777524-9777546 TGGGGAGCAAGAAGCTGGCGGGG - Intronic
1004447790 6:15716673-15716695 CAGGAAGCAACATGCAGACTAGG + Intergenic
1006266643 6:32931317-32931339 CTGGAAGCAAGAAGAAGCCAGGG - Intergenic
1006576307 6:35048944-35048966 CGTGCAGCAGGAAGCAGGTTCGG + Intronic
1014634096 6:123823628-123823650 TGGGAAGCAAGAAGAGGGCTGGG + Intronic
1015020802 6:128472113-128472135 CTGGAGGGAAGAAGCAGCCTTGG - Intronic
1015994892 6:138987771-138987793 CGGGAAGCTAGCAGGAGGCCGGG - Exonic
1016339790 6:143049977-143049999 GGGGGAGCCAGAAGCAGGCAGGG - Intergenic
1016627482 6:146189280-146189302 CAGAAAGCAAAAAGCAGGCCAGG - Intronic
1017262507 6:152403289-152403311 CGGGAACCATGAAGCAGGCCAGG - Intronic
1019173775 6:170149498-170149520 GGGGCAGCAGGTAGCAGGCTTGG - Intergenic
1019173867 6:170149963-170149985 GGGGCAGCAGGTAGCAGGCTTGG - Intergenic
1019351220 7:554915-554937 CAGGAAGCAAGAGCAAGGCTGGG - Intronic
1021609757 7:22445589-22445611 CGGGAAGCCAGGCCCAGGCTCGG - Intronic
1021898756 7:25262620-25262642 CCTGAAGCAAGAAGCAGCCCTGG - Intergenic
1024550526 7:50559176-50559198 AGGGAAGCATGCAGCAGGCACGG + Intronic
1025770394 7:64499902-64499924 TGGGAAGCTAAAAGCAGACTGGG + Intergenic
1025998346 7:66542731-66542753 GGTGAAGCTAGAAGCAGGCAGGG - Intergenic
1026125320 7:67574392-67574414 AGGGAAGCTAAAAGCAGACTTGG + Intergenic
1027952857 7:84840562-84840584 GGGGAAGGAAAAAGAAGGCTGGG - Intergenic
1028983967 7:96995817-96995839 CAGGAGGCAAGAAGGAGGCTAGG + Intergenic
1032798684 7:135300722-135300744 AGGGAAGCTAAAAGCAGACTTGG + Intergenic
1033674012 7:143519899-143519921 AGAGAAGCAAGAAGCACTCTAGG - Intergenic
1035634722 8:1136100-1136122 CTGGAAGCAAGAGGAAGGCAAGG - Intergenic
1035764184 8:2092360-2092382 CGGGAAGCAAGAACCCGACCCGG - Exonic
1035950870 8:4019395-4019417 AGGGAAGCTAAAAGCAGACTTGG - Intronic
1036696632 8:10979338-10979360 GAGGAAGCAAGCAGAAGGCTCGG + Intronic
1037552065 8:19984438-19984460 AGGTAAGGAAGGAGCAGGCTGGG + Intergenic
1039105132 8:33981950-33981972 CAGGAAGGAGGGAGCAGGCTGGG + Intergenic
1039250892 8:35662835-35662857 CAGGAGGTAAGAAGCAGGCGAGG + Intronic
1039774079 8:40718644-40718666 AGGGAAAGAAGAAGGAGGCTGGG - Intronic
1040674924 8:49736974-49736996 CAGGAAGGAAGAAGCAGGTGAGG - Intergenic
1040980127 8:53238482-53238504 TGGGAAGCAAGGGGCAGGCCGGG + Intronic
1041837293 8:62230801-62230823 AGGAAACCCAGAAGCAGGCTTGG - Intergenic
1042037549 8:64552099-64552121 CAGGAAGCATGAAGCTGGCTTGG - Intergenic
1047428025 8:124764488-124764510 TGGCAAGCAAGAAGCAGAGTTGG + Intergenic
1047615946 8:126562594-126562616 AGGAAAGCAAAGAGCAGGCTGGG + Intergenic
1048555309 8:135470223-135470245 CGGGAGGAAAGAAGCCTGCTCGG - Intronic
1049426427 8:142539902-142539924 CGGGGAGCAAGAGGAAGGCGGGG + Intronic
1049763565 8:144342405-144342427 CTGAAAGCAAGAAGGAGGCGGGG - Intergenic
1049985272 9:944691-944713 CAAAAAGCAAGAATCAGGCTTGG - Intronic
1051056022 9:12987065-12987087 TGGGAAGCAAGAAGCACATTGGG + Intergenic
1052029449 9:23611585-23611607 CGGGAGGCAAGAAGCATGTGAGG + Intergenic
1053174481 9:35912125-35912147 GGAGAAGGAAGAAGCAGGATTGG + Intergenic
1055068004 9:72138100-72138122 AGGGAAGCCAAAAGCAGACTCGG - Intronic
1057825509 9:98369660-98369682 CAGGGAGCAAAATGCAGGCTTGG + Intronic
1059162421 9:112047731-112047753 CAGGAAGCAAGAAAGAGTCTAGG - Intronic
1061138497 9:128750547-128750569 CGGGACGCAAGAAGCAGGAAAGG + Intronic
1061318772 9:129814752-129814774 CGGGAAGCAAGAAGAATTCCCGG + Intronic
1061874790 9:133538326-133538348 CTGGCAGAAAGATGCAGGCTCGG - Intronic
1061936717 9:133861934-133861956 AGGGAAGCAAGCAGCACCCTGGG - Intronic
1062135095 9:134922599-134922621 CGTGAAGCAACAGCCAGGCTAGG - Intergenic
1062388354 9:136324154-136324176 GGGGAAGGAAGAAGCAGGCCGGG - Intergenic
1062522476 9:136964019-136964041 CAGGGAGCAGCAAGCAGGCTCGG + Intergenic
1187798819 X:23036238-23036260 CTGGAACCTGGAAGCAGGCTTGG - Intergenic
1192246043 X:69372536-69372558 CCAGAAGCAAGCAGCTGGCTTGG + Intergenic
1195004480 X:100672356-100672378 AGGGGAGAAGGAAGCAGGCTGGG + Intergenic
1198404598 X:136300164-136300186 AGGGAAGCTAAAAGCAGACTTGG - Intergenic
1199944279 X:152652957-152652979 GGGTGTGCAAGAAGCAGGCTGGG + Exonic
1201550802 Y:15214559-15214581 CTGGAAGCAGGAAACAGGGTGGG - Intergenic
1201648147 Y:16258268-16258290 AGGGAAGCTAAAAGCAGTCTTGG - Intergenic
1201654663 Y:16327033-16327055 AGGGAAGCTAAAAGCAGTCTTGG + Intergenic
1202106223 Y:21369709-21369731 AGGGAAGCTAAAAGCAGACTGGG + Intergenic
1202194084 Y:22278020-22278042 AGGGAAGCTAAAAGCAGACTGGG + Intergenic
1202201391 Y:22354125-22354147 AGGGAAGCTAAAAGCAGACTGGG - Intronic