ID: 950416681

View in Genome Browser
Species Human (GRCh38)
Location 3:12872909-12872931
Sequence GGGAAGCAAGAAGCAGGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 704
Summary {0: 1, 1: 0, 2: 8, 3: 69, 4: 626}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950416677_950416681 -5 Left 950416677 3:12872891-12872913 CCAACAAAGAGCAGGAACGGGAA 0: 1
1: 0
2: 0
3: 14
4: 207
Right 950416681 3:12872909-12872931 GGGAAGCAAGAAGCAGGCTGGGG 0: 1
1: 0
2: 8
3: 69
4: 626
950416672_950416681 1 Left 950416672 3:12872885-12872907 CCTTCCCCAACAAAGAGCAGGAA 0: 1
1: 0
2: 3
3: 35
4: 303
Right 950416681 3:12872909-12872931 GGGAAGCAAGAAGCAGGCTGGGG 0: 1
1: 0
2: 8
3: 69
4: 626
950416674_950416681 -3 Left 950416674 3:12872889-12872911 CCCCAACAAAGAGCAGGAACGGG 0: 1
1: 0
2: 0
3: 13
4: 105
Right 950416681 3:12872909-12872931 GGGAAGCAAGAAGCAGGCTGGGG 0: 1
1: 0
2: 8
3: 69
4: 626
950416676_950416681 -4 Left 950416676 3:12872890-12872912 CCCAACAAAGAGCAGGAACGGGA 0: 1
1: 0
2: 0
3: 14
4: 130
Right 950416681 3:12872909-12872931 GGGAAGCAAGAAGCAGGCTGGGG 0: 1
1: 0
2: 8
3: 69
4: 626
950416670_950416681 19 Left 950416670 3:12872867-12872889 CCAGTCATATAAGATTCTCCTTC 0: 1
1: 1
2: 2
3: 9
4: 130
Right 950416681 3:12872909-12872931 GGGAAGCAAGAAGCAGGCTGGGG 0: 1
1: 0
2: 8
3: 69
4: 626

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950416681 Original CRISPR GGGAAGCAAGAAGCAGGCTG GGG Intergenic
900331505 1:2137024-2137046 GGGAAGAAAGAAGCCAGCAGTGG + Intronic
900357166 1:2270562-2270584 GGGAAACAAGCTGCCGGCTGAGG + Intronic
900927128 1:5712763-5712785 AGGAAGTAAGAAGCAGGCTGGGG - Intergenic
900928789 1:5722820-5722842 GTGAAGGAAGATGCAAGCTGGGG - Intergenic
901167421 1:7230273-7230295 GGGAAGCAGGAATGAGGCCGGGG + Intronic
901251850 1:7784815-7784837 AGTGAGCGAGAAGCAGGCTGCGG + Exonic
901464746 1:9413871-9413893 GGGAGGCAAGAAGCAGGACCAGG + Intergenic
901501862 1:9657505-9657527 GGAAAGCAGGAAGGAGGCTGGGG - Intronic
901843152 1:11966224-11966246 GGGAAGTGGGAAGCAGGCTAGGG - Intronic
902289803 1:15428649-15428671 GGAAAGGAAGAAGCAGGCGGAGG + Exonic
902415844 1:16238584-16238606 GGGAAGCAGAAAGCAGCCAGAGG + Intergenic
902568312 1:17330447-17330469 GGGAAGAGAGAAGCTGGCAGTGG + Intronic
902647353 1:17809426-17809448 AGGAAGGAAGAAGCAGGCTGTGG + Intronic
902863169 1:19260315-19260337 GGACAGCAGGAAGCAGGCTTCGG + Intergenic
902885718 1:19403331-19403353 GAGAAGCAAGGGGCATGCTGGGG + Intronic
903102788 1:21047571-21047593 GGGAAGAGGGAAGCAGGGTGGGG - Intronic
903141230 1:21340314-21340336 GTGAAGACAGAAGGAGGCTGTGG - Intronic
903747673 1:25599241-25599263 GGGAAGCAAGAGGCAGCTGGAGG + Intergenic
903927710 1:26842637-26842659 GGGCAGCATGAAGAAGGGTGGGG - Intronic
904061386 1:27713632-27713654 GGGAAGCTAAAAGCAGACTCAGG + Intergenic
904114725 1:28153388-28153410 GGGAAGCAAGAACCCAGCTGGGG + Intronic
904237759 1:29125173-29125195 GGGAGGCAAGAAGGAGGCCCTGG - Intergenic
904295755 1:29518827-29518849 GAGAAGGAAGAAGCAGGAGGAGG - Intergenic
904445520 1:30570560-30570582 AGCATGCAAGATGCAGGCTGAGG + Intergenic
904577052 1:31511584-31511606 GGGAAGCAAAGAGCAGATTGGGG + Intergenic
904980996 1:34501565-34501587 GAGAAGCAAGCAGCAGCATGGGG - Intergenic
905095666 1:35468339-35468361 GTGAAGAAATAAGCAGGCTGAGG - Intronic
905221141 1:36448777-36448799 GGGAAACAGGAGGCAGGCAGTGG + Intronic
905359932 1:37412217-37412239 GGGATGCAGGAGGCTGGCTGGGG + Intergenic
905399746 1:37692627-37692649 GGGAAGCAAGAAACTGGGTAGGG - Exonic
905807965 1:40890580-40890602 GGTAGGCAAGAAGAAGGTTGGGG + Intergenic
905923780 1:41735884-41735906 AGGAAGCAAGCAGGAGGGTGGGG + Intronic
905929799 1:41779085-41779107 GGGCAGGAAGCAGCAAGCTGAGG - Intronic
906376342 1:45299675-45299697 GGGAAGCAAGAGGCAGGTGTGGG - Intronic
907109579 1:51914684-51914706 GGGAATCAAGTAGCATCCTGTGG - Exonic
907301266 1:53487805-53487827 GGGAAGACAGAAGCAGCTTGAGG - Intergenic
907456676 1:54580817-54580839 GGGAAGAGAGATGCAGGATGAGG + Intronic
907706024 1:56833515-56833537 GGGAACAAAGCAGCAGGCAGTGG + Intergenic
910465275 1:87492598-87492620 TGGAAGCCAGAAGGAGGATGGGG + Intergenic
911587304 1:99705345-99705367 AGGAAGAAAGAAGCAGGATGTGG + Intergenic
912494040 1:110079865-110079887 GGGAAGCAAGCAGGATGTTGGGG + Intergenic
912549536 1:110476010-110476032 GGGGAGGAAGAAGAAGGGTGGGG + Intergenic
912565944 1:110587477-110587499 AGGAATGAAGAAGGAGGCTGGGG + Intergenic
912643301 1:111368298-111368320 GGGATCCAGCAAGCAGGCTGGGG + Intergenic
912681874 1:111733988-111734010 GGGAAGCTAGGAGGAGGCTGAGG + Intronic
913024895 1:114828220-114828242 GGGAAGCCAGAAACAGGATGAGG + Intergenic
913197685 1:116471622-116471644 GGGAAGGATGGAGCAGGCTCTGG - Intergenic
913223592 1:116679386-116679408 TGGTGGCCAGAAGCAGGCTGGGG - Intergenic
913285777 1:117225124-117225146 CTGGAGCCAGAAGCAGGCTGGGG - Intergenic
914341763 1:146765996-146766018 GGGAAGCAACGAGGAGGCTGGGG + Intergenic
914360101 1:146927670-146927692 TGGAAGCCAGAAGGAGGATGGGG + Intergenic
914493646 1:148172226-148172248 TGGAAGCCAGAAGGAGGATGGGG - Intergenic
914920973 1:151847262-151847284 GGGAGGCAGGAGGCAGGCAGGGG + Exonic
915044678 1:153002206-153002228 GGAAAGCAAGTATCATGCTGTGG + Intronic
915079737 1:153343982-153344004 AGGAAGCTAAAAGCAGACTGGGG + Intronic
915213761 1:154327343-154327365 GGGAAGGCGGAAGCAGGCAGAGG + Intronic
915307741 1:154990366-154990388 GGGCAGCATGAAGCAGGCCCTGG + Exonic
915515011 1:156407651-156407673 TGGAAGGAAGGACCAGGCTGCGG - Intronic
915734691 1:158077402-158077424 GGGAAGCAAGAAGCGGGTGGGGG + Intronic
916003373 1:160637260-160637282 GGAAAGCAGGAAGGAGGATGAGG - Exonic
916163189 1:161940294-161940316 AGGAAGTAAGAAACAGGATGGGG - Intronic
916265077 1:162882427-162882449 GGGAGGCACGTAGCTGGCTGGGG + Intergenic
916508527 1:165450482-165450504 GGGAAGAAAGCAGGAGGATGAGG + Intergenic
916935080 1:169619348-169619370 GAGAAGCAAGAAGGAAGCAGAGG - Intronic
917018513 1:170561165-170561187 TGAAAGTAAGAAACAGGCTGAGG - Intergenic
917268111 1:173243304-173243326 GGGATGAAATAATCAGGCTGTGG - Intergenic
917627281 1:176859290-176859312 GGGGAGCAAGAAGAAGGGTGGGG - Intronic
919640075 1:200038673-200038695 GGGAAGCAAGAAGAAGGGATGGG - Intronic
919682952 1:200454276-200454298 GGGAAGGAAGAATGAGGCTGAGG - Intergenic
920171399 1:204074341-204074363 GGGTAGCAAGAAGCAGCCTGCGG - Intronic
920232648 1:204480806-204480828 GGGAAGAAAGAAGCATGGCGCGG - Intronic
920364542 1:205441106-205441128 AGGAAGAGAGAAGCAAGCTGGGG + Intronic
920610173 1:207428270-207428292 GGGAAGCTAAAAGCAGACTTGGG - Intergenic
920846050 1:209593909-209593931 GGGTAGGAAGAGGCAGGCAGGGG - Intronic
921029437 1:211324954-211324976 GAGAGGCAAGAAGCAGGCAATGG + Intergenic
922550391 1:226490179-226490201 GGGAAGCAAACAGCAGGCCTGGG + Intergenic
924689718 1:246334561-246334583 GGGAGGTAAGAAGCAGGGAGTGG + Intronic
1063142099 10:3264594-3264616 GGCCGGCAAGCAGCAGGCTGTGG - Intergenic
1063374269 10:5544447-5544469 GGCCAGCAAGTAGCAGGCTTGGG - Intergenic
1063548286 10:7002909-7002931 GGGATGCAAGATGCTGGCTAGGG - Intergenic
1064802001 10:19086931-19086953 GGGAAGCTAAAAGCAGACTTGGG - Intronic
1065229847 10:23586810-23586832 GGGAAGTAGGAATAAGGCTGGGG + Intergenic
1066546491 10:36505661-36505683 GGGAAGAAAGAAGATGGGTGAGG + Intergenic
1066987389 10:42479980-42480002 GGGAAGGAGGAAGGAGCCTGTGG + Intergenic
1067076660 10:43191169-43191191 GGAAAACAAGAAACAGGTTGAGG - Intergenic
1067703366 10:48589330-48589352 TTGAAGCCAGAAGCAGGCTGGGG - Intronic
1068118455 10:52760211-52760233 AGGAAGGAAGAAGAAAGCTGAGG - Intergenic
1068327903 10:55518649-55518671 GGGAAGCTAAAAGCAGACTCAGG + Intronic
1068726686 10:60311148-60311170 GGGGATAAAGAAGCAGGCAGAGG - Intronic
1068952288 10:62789677-62789699 AGGAAGCAAGACGCAGGGTAAGG - Intergenic
1069076025 10:64039300-64039322 GGCCAGCAAGGTGCAGGCTGTGG - Intergenic
1069379574 10:67829124-67829146 GGGAAGCAAAAAGCAGACTCGGG + Intronic
1069727132 10:70587332-70587354 AAGAAGCTAGAGGCAGGCTGTGG + Intergenic
1070154249 10:73824007-73824029 GGAAAGCAGGAGGCAGGCTCAGG + Intronic
1070520561 10:77249510-77249532 GGGAAGGAAGGTGCTGGCTGAGG + Intronic
1070552468 10:77501599-77501621 GGGGAGGAGGAATCAGGCTGGGG - Intronic
1070888214 10:79923047-79923069 GGGAGGCAAGGAGGGGGCTGAGG - Intergenic
1071086610 10:81874480-81874502 GGGACCCAACAAGCAGGCAGAGG - Intergenic
1071998277 10:91168293-91168315 GAGAAGAAAGAAGCAGGAGGGGG + Intronic
1072166168 10:92815072-92815094 AGGCAGCAGGAAGGAGGCTGGGG - Intergenic
1073048559 10:100654031-100654053 GGGGAGCGAGGACCAGGCTGGGG - Intergenic
1073336699 10:102714954-102714976 GGAGGGCAAGAAGCAGCCTGGGG + Intronic
1073444190 10:103571139-103571161 GGGGAGCAGGAAGCAGGAGGCGG - Intronic
1073610471 10:104938096-104938118 GTAAAGAAAGAAGCAAGCTGAGG - Intronic
1074049607 10:109869641-109869663 GTGAAGCAAGCATCAGCCTGAGG + Intronic
1074103227 10:110369987-110370009 GGAAAGAAAGGAGCTGGCTGTGG - Intergenic
1074123871 10:110512872-110512894 AGGAAGCTGGATGCAGGCTGGGG + Intergenic
1075083556 10:119399366-119399388 GCGAAGCAAGGTGCTGGCTGAGG + Intronic
1075520232 10:123139072-123139094 GGGAAGAAAGAAACAAGCTTAGG + Intergenic
1075522831 10:123154413-123154435 GGGAAGCAAGGAGGCGGCGGCGG + Exonic
1075590589 10:123688303-123688325 AGGAACCAGGAAGCAGGCTCTGG - Exonic
1075923976 10:126235847-126235869 GGTAAGCAAGAAGCAGGGTGTGG + Intronic
1075935140 10:126333853-126333875 GAGAATTTAGAAGCAGGCTGTGG + Intronic
1076169964 10:128311117-128311139 GACAAGCCAGAAGGAGGCTGCGG + Intergenic
1076194782 10:128509770-128509792 GGGTTGGAAGATGCAGGCTGTGG - Intergenic
1076223587 10:128755417-128755439 AAGAAGCAAAAAGCAAGCTGAGG + Intergenic
1076235501 10:128861067-128861089 GGGAAGAAAGAAGCAGGAGCTGG - Intergenic
1076266040 10:129110608-129110630 TGGAGGCAAGGAGCAGGCAGAGG + Intergenic
1077224271 11:1433302-1433324 GTGAAGCAGGAGGGAGGCTGTGG - Intronic
1077460973 11:2709315-2709337 GTGCAGCAAGAAGCGGGCAGAGG + Intronic
1077515623 11:3000330-3000352 CGCAGGCATGAAGCAGGCTGTGG + Intergenic
1078067705 11:8089175-8089197 GGGAAGGAAGGAAAAGGCTGGGG + Intronic
1078185027 11:9044835-9044857 GGACAGCAAGAAGCAAGCTATGG - Intronic
1079398257 11:20084569-20084591 GGGAAGGAAGAAGGACACTGAGG + Intronic
1080314814 11:30936719-30936741 GGGAAGCTAAAAGCAGACTGGGG + Intronic
1080394155 11:31874718-31874740 GGGAAGCAGGCAGAAGGCAGAGG - Intronic
1080703503 11:34666484-34666506 GGGGAGAAAGAAGGGGGCTGAGG - Intergenic
1080766944 11:35305849-35305871 GGGCAGCAAGAAGCTGGGTATGG - Intronic
1080874148 11:36261359-36261381 GGAAAGAAAGAAGGAGGCTCAGG - Intergenic
1081565764 11:44260155-44260177 GGGAAGCTAGAAGGGGGCAGGGG - Intergenic
1082790388 11:57342860-57342882 GGGAGCCAAGGAGGAGGCTGGGG - Intronic
1082990725 11:59205289-59205311 AAGTAGCAAGAAGCCGGCTGAGG - Exonic
1082997213 11:59263754-59263776 GGGAGGCCAGGCGCAGGCTGTGG - Intergenic
1083096518 11:60256413-60256435 TCGAAGCAAGAGGCAGGTTGTGG - Intergenic
1083162598 11:60864280-60864302 GGGAAGCTAAAAGCAGACTCTGG + Intergenic
1083499099 11:63087283-63087305 GGGCAGGCAGAAGCAGGGTGGGG + Intronic
1083552127 11:63597957-63597979 GGGAAGCAAGAAGAATGTTGGGG + Intronic
1083756739 11:64796075-64796097 GGGAGGCAAGAAGGAGACAGTGG - Intronic
1083886891 11:65577311-65577333 GGGGAGTAAGCAGGAGGCTGGGG + Intronic
1083896991 11:65624962-65624984 GGGCAGCAGCCAGCAGGCTGCGG - Exonic
1083962341 11:66021354-66021376 CAGAAGGCAGAAGCAGGCTGGGG + Intronic
1084223031 11:67696578-67696600 GGGAAGCCTGAAGCAGGCACTGG - Intergenic
1084476148 11:69390837-69390859 GGGAAGGAAGAAGGAGCCAGCGG + Intergenic
1085446528 11:76604494-76604516 TGAAAGCAAGAGGCGGGCTGCGG - Intergenic
1085452323 11:76642078-76642100 GGGCAGGAAGGGGCAGGCTGGGG + Intergenic
1085869996 11:80338336-80338358 GGGAAGAAAGAAGAAAGGTGGGG - Intergenic
1086129119 11:83382838-83382860 GGGCAAGAAGAAGCAGGGTGGGG + Intergenic
1086283538 11:85219078-85219100 GGGAGGCAAGGAGCAGGCATGGG + Intronic
1086804072 11:91217485-91217507 GAGAGGCCAGGAGCAGGCTGAGG + Intergenic
1086837433 11:91642116-91642138 GGGTAGCAGCAAGCTGGCTGAGG + Intergenic
1086954399 11:92920782-92920804 GAGAATAAAGAAGCAGGATGAGG + Intergenic
1087635233 11:100694694-100694716 AGTCAGCAAGAAGCAGCCTGTGG - Intronic
1088678462 11:112219221-112219243 GGGAAGCTAAAAGCAGACTTTGG - Intronic
1088813487 11:113406736-113406758 GGGAAGCAGGAAGCTGGTGGGGG - Intergenic
1089294017 11:117457395-117457417 AGGAGGCAAGAAGAAGGCTGGGG + Intronic
1089450003 11:118587753-118587775 GGGAAGGAAGAATCAGTCTTGGG - Intronic
1089538539 11:119175298-119175320 GGGAGGGAAGGAGCAGGTTGGGG - Intronic
1089551808 11:119285183-119285205 AGGGAGCCAGAAGCAGCCTGTGG - Exonic
1089671901 11:120062487-120062509 GAGAAGCACGAAGCTGGCTCCGG + Intergenic
1090135195 11:124190610-124190632 GGGAAGCTAAAAGCAGACTCTGG + Intergenic
1090940577 11:131384608-131384630 GAGAGGCAAGAAGGAGGATGTGG + Intronic
1091057144 11:132429926-132429948 GAGGAGCTAGAAGCAGACTGAGG + Intronic
1091738257 12:2940994-2941016 AGGGAGGAAGAAGCAGGATGAGG - Exonic
1091744702 12:2983585-2983607 GGGAAGCAAGAGCCTGGCTTTGG - Intronic
1092634414 12:10426185-10426207 GGGAAGAAAGAAGCCGGTAGTGG - Intronic
1093341710 12:17983020-17983042 GGCAAGGCAGAAGCAGGCAGAGG + Intergenic
1094125363 12:27017451-27017473 GGGAAGCTAAAAGCAGACTCGGG - Intergenic
1094203868 12:27819936-27819958 GGGAAGCTAAAAGCAGACTCGGG - Intergenic
1094284035 12:28772404-28772426 GGGAAGCAAGAAGAAGAACGTGG + Intergenic
1095050963 12:37554106-37554128 GGGCTGCAAGAAGCTGGCGGAGG + Intergenic
1095141588 12:38669826-38669848 GGGAAGCTAAAAGCAGACTCGGG + Intronic
1095538887 12:43285316-43285338 GAGAAACAAGAAGGAGGTTGGGG - Intergenic
1096100975 12:48970354-48970376 GGGAACCAAGAAGGCGTCTGGGG + Intronic
1096323454 12:50636598-50636620 GGAAAGCAAACAGCAGACTGTGG - Intronic
1096584077 12:52608271-52608293 GGGAAGCCAGGACCAGGCTGGGG - Exonic
1096677517 12:53233598-53233620 GGGAAAGAAGAGGCATGCTGTGG + Intergenic
1096806272 12:54143043-54143065 AGGAAGGAAGAAGGAGGATGGGG + Intergenic
1097444950 12:59659397-59659419 GGGAAGCTAGGAGGAGGATGAGG - Intronic
1100287186 12:93178052-93178074 GGGAAGCTAAAAGCAGGCTTGGG + Intergenic
1100366523 12:93926172-93926194 GGGAAGCTAAAAGCAGACTGGGG + Intergenic
1100401782 12:94237050-94237072 GGGTAGCAAGAAGGAGGTTGTGG + Intronic
1100603650 12:96133310-96133332 GGGAAGCGGGAATGAGGCTGGGG + Intergenic
1100897538 12:99201007-99201029 AGGAAGCATGTAGCAGGCAGTGG + Intronic
1100981437 12:100165827-100165849 GGGAAGCAAGAAACAGTCACAGG + Intergenic
1101243926 12:102866530-102866552 GGCAAGGGAGAAGCAGGCTAGGG + Intronic
1101408753 12:104452423-104452445 GAGCAGCAAGAGGCAGGCAGGGG + Intergenic
1102709927 12:114916878-114916900 TGCAAGAAAGAAGGAGGCTGCGG - Intergenic
1103404652 12:120666830-120666852 GGGGAGCAAGCAGCAGCCAGAGG - Intronic
1104395314 12:128427513-128427535 GGGAGGGAAGAGGCAGGCTGTGG + Intronic
1104398451 12:128455463-128455485 GGGAACCAGTAAGCAGGATGGGG + Intronic
1104406412 12:128520948-128520970 GGGAAGCTAGAGGCAGACTCAGG - Intronic
1104886280 12:132110827-132110849 TGGGAGCAGGATGCAGGCTGTGG + Intronic
1104890464 12:132137167-132137189 GGGAAGCTAAAAGCAGACTGAGG - Exonic
1105023720 12:132835005-132835027 GGGAAGCAAGAGGCCGGGCGTGG - Intronic
1106483899 13:30156186-30156208 GGGAAGAGCGAAGGAGGCTGAGG + Intergenic
1107638174 13:42414355-42414377 GGGAAGAAAGAAGCTGGTAGTGG + Intergenic
1107805858 13:44153344-44153366 GAGAAGCTAGAAACATGCTGTGG + Intronic
1108314107 13:49221092-49221114 GGGCAGGAAGAAGTAGGCGGTGG - Exonic
1108363167 13:49686130-49686152 TGGAAGCAACAACCAGGCAGAGG + Intronic
1108925049 13:55731783-55731805 GGGAAGACAGAAGCAGGTAGTGG - Intergenic
1110228115 13:73141013-73141035 GGGAGGCAAGGTGCAGGATGGGG - Intergenic
1110275209 13:73634916-73634938 GAGGAGCCAGAAGGAGGCTGAGG - Intergenic
1110602219 13:77388047-77388069 GGGAAGCAGGTAGCACGATGTGG + Intergenic
1110844378 13:80177488-80177510 GGGAAGCAAGCTTCAGCCTGGGG - Intergenic
1110986567 13:81977960-81977982 GGGAAGCTAAAAGCAGACTTGGG + Intergenic
1112261605 13:97882628-97882650 GGGTAGAAAGAAGTGGGCTGTGG - Intergenic
1113088139 13:106589170-106589192 TGCAAGCAAGAAGAAAGCTGTGG - Intergenic
1113513747 13:110874860-110874882 GGGAGCCAAGAAACAGGCAGCGG - Intergenic
1113604544 13:111595981-111596003 AGGAAGCAGGAGCCAGGCTGTGG + Intronic
1113637080 13:111927001-111927023 GGGCAGCCAGGAGGAGGCTGGGG + Intergenic
1113902947 13:113806655-113806677 GGGAAGGATGAAGCTGCCTGTGG - Intronic
1114060285 14:19011439-19011461 AGGAAACAAGAAGCAGGTTCAGG + Intergenic
1114060377 14:19011970-19011992 AGGAAACAAGCAGCAGGCTCAGG + Intergenic
1114060699 14:19013949-19013971 AGGAAACAAGCAGCAGGCTCAGG + Intergenic
1114060802 14:19014580-19014602 AGGAAACAAGAAGCAGGTTCAGG + Intergenic
1114060892 14:19015107-19015129 AGGAAACAAGCAGCAGGCTCAGG + Intergenic
1114101364 14:19384872-19384894 AGGAAACAAGCAGCAGGCTCAGG - Intergenic
1114101453 14:19385399-19385421 AGGAAACAAGAAGCAGGTTCAGG - Intergenic
1114101555 14:19386033-19386055 AGGAAACAAGCAGCAGGCTCAGG - Intergenic
1114101976 14:19388636-19388658 AGGAAACAAGCAGCAGGCTCAGG - Intergenic
1114102064 14:19389167-19389189 AGGAAACAAGAAGCAGGTTCAGG - Intergenic
1114102258 14:19390311-19390333 AGGAAACAAGAAGCAGGTTCAGG - Intergenic
1114102464 14:19391572-19391594 AGGAAACAAGCAGCAGGCTCAGG - Intergenic
1114102555 14:19392104-19392126 AGGAAACAAGAAGCAGGTTCAGG - Intergenic
1114991551 14:28295779-28295801 GGGAAGAAATAAGGAGACTGAGG - Intergenic
1115788780 14:36856122-36856144 GGGAAGGGAAAAGCAGGGTGGGG + Intronic
1116397431 14:44463416-44463438 GGGAGGCCAAAAGCAGACTGAGG - Intergenic
1116922176 14:50590389-50590411 AGGAAGCAAGTAGCAGGAAGAGG - Intronic
1117402779 14:55372646-55372668 GCGAAGGAAGGAGCAAGCTGTGG - Intronic
1117765865 14:59082035-59082057 GGTCAGCAGGATGCAGGCTGAGG - Intergenic
1117845353 14:59905940-59905962 GAGAAGCAAGAAGGAGCGTGGGG - Intergenic
1119348186 14:73943485-73943507 GGGAAGGAAGAGGCAGGCATGGG - Intronic
1119392333 14:74299446-74299468 AGGAAGCAGGAAGCAAGCTGTGG - Intronic
1119740922 14:77013326-77013348 GGGAAGTCTGGAGCAGGCTGTGG - Intergenic
1119793592 14:77376535-77376557 GGGGAGCCAGAAGCAGGGGGCGG + Intronic
1121054731 14:90843320-90843342 CAGAAGCCAGAAGCAGCCTGTGG - Intergenic
1121139783 14:91531279-91531301 AGGAAGCAGGAAGCAGGAAGGGG + Intergenic
1121233004 14:92372171-92372193 GGGAGGCATGAACCAGACTGAGG + Intronic
1122320464 14:100852293-100852315 GGGAGGCAAGAAGAAGGGGGTGG + Intergenic
1122447538 14:101780965-101780987 GGAAAGCAAGGCTCAGGCTGTGG - Intronic
1122637045 14:103135021-103135043 CGGAGGCCTGAAGCAGGCTGGGG + Intronic
1122758899 14:104005595-104005617 AGCAAGCCAGAAGGAGGCTGAGG - Intronic
1122805013 14:104252195-104252217 GGGAAGCAAGACGAAGTCTGAGG - Intergenic
1122879586 14:104684212-104684234 GGCAACCGAGAAGGAGGCTGGGG + Intergenic
1124136091 15:27037588-27037610 GGGAAGCTAAAAGCAGACTCAGG - Intronic
1125724564 15:41861696-41861718 GGGGGGCAAGATGCAGGCTGGGG + Intronic
1125986122 15:44054272-44054294 GGGAAGAAAGCATCAGGGTGTGG + Intronic
1128185940 15:65643576-65643598 GGGAAGAAGGAACAAGGCTGAGG - Intronic
1128238371 15:66082778-66082800 GGGAAGAAAGAAGCATGATGAGG - Intronic
1128791242 15:70435503-70435525 GGAAGGTGAGAAGCAGGCTGAGG - Intergenic
1129651737 15:77495980-77496002 AGGAAGCCAGAAGCAGCCAGTGG - Intergenic
1129679269 15:77648849-77648871 GGGCAGCAGGGAGCAGACTGGGG - Intronic
1129857176 15:78832710-78832732 GGGCTGCAAGAAGCAGCCAGAGG + Intronic
1130765173 15:86862855-86862877 GGAAAGCAAGAAGGTGGATGTGG + Intronic
1130889049 15:88117873-88117895 GGGAAGGAAGCAGAAGCCTGAGG - Intronic
1131333478 15:91524480-91524502 GGGAAGCTAAAAGCAGACTCAGG + Intergenic
1132464470 16:71399-71421 GGGGACCAAGCAGCTGGCTGGGG - Intronic
1132830341 16:1924902-1924924 GGGTGGCTGGAAGCAGGCTGGGG - Intergenic
1133410834 16:5567463-5567485 GGGAAGCATGAAGCATCCAGCGG + Intergenic
1133468608 16:6052194-6052216 TGGAAGGAAGAAGCAGGTTATGG - Intronic
1134187463 16:12096025-12096047 GCCAAGCAAGCAGCTGGCTGCGG - Intronic
1135499240 16:22979378-22979400 GAGAAGTAAGAAACAGGGTGAGG - Intergenic
1135775863 16:25257433-25257455 GAGAAAAATGAAGCAGGCTGAGG + Exonic
1137019430 16:35409070-35409092 GGGAAGCTAAAAGCAGACTTGGG - Intergenic
1138246221 16:55468921-55468943 GGGAAGCAATGAGCAAGGTGGGG + Intronic
1139322643 16:66127799-66127821 GGGGAGGAAGAAGGAGGCAGAGG + Intergenic
1139440069 16:66962158-66962180 GGGTACCAGGAAGCTGGCTGGGG - Intronic
1139936086 16:70572192-70572214 GGGAGGAAGGAGGCAGGCTGTGG + Exonic
1139961637 16:70721403-70721425 GGGAAGGAAAAAGGAGGATGAGG + Intronic
1139992517 16:70951446-70951468 GGGAAGCAACGAGGAGGCTTGGG - Intronic
1140945959 16:79768689-79768711 GGGAAGAAGGAAGCTAGCTGGGG + Intergenic
1141370073 16:83478650-83478672 GAGAAGAAGGAAGCAGGCTTAGG - Intronic
1141606000 16:85153796-85153818 GAGAAGCAAAAGGCAGCCTGGGG + Intergenic
1141736302 16:85856236-85856258 GGGAAGCATGAATCATGCTGTGG + Intergenic
1141801478 16:86312374-86312396 GGGAAGGAGAAAGCAGGGTGGGG - Intergenic
1141898077 16:86971435-86971457 CGGAAGCAGGAAGCAGGAAGTGG + Intergenic
1142245317 16:88967635-88967657 GGGAAGGAAGGAGCAGGCCGGGG + Intronic
1142495825 17:305824-305846 GGGAAGGAAGAAAGGGGCTGGGG - Intronic
1142567874 17:852389-852411 GGGGAGCAAGATGCCAGCTGTGG - Intronic
1142709958 17:1717635-1717657 GGTAAGCAAGGAGGAGGATGTGG - Intronic
1142950929 17:3479540-3479562 GGGAAGGTAGAAGGAGCCTGTGG - Intronic
1143051208 17:4127470-4127492 GGGAAGGAAAAAGCAGGGGGCGG + Intronic
1143197635 17:5088357-5088379 GGGGAGGAAGAGACAGGCTGGGG - Intronic
1143542810 17:7579726-7579748 GGTAAGGAGGAAGGAGGCTGAGG + Exonic
1143667298 17:8371213-8371235 GGGAATCGAGAAGAAAGCTGTGG + Intronic
1143786206 17:9257577-9257599 GGAAAGCAAGAGGCAGGGAGGGG + Intronic
1144423432 17:15118579-15118601 AGGAAGCGAGAAGCAAGGTGAGG - Intergenic
1144724982 17:17497155-17497177 TGGGAGAAAGGAGCAGGCTGAGG - Intergenic
1144813259 17:18015660-18015682 TGGAAGCATGAGGCTGGCTGAGG - Intronic
1145928294 17:28664548-28664570 GGGAAGCATGTAGAAGGCTCGGG - Intronic
1146399563 17:32492437-32492459 AGTGAGCAAGAAGCAAGCTGTGG - Intergenic
1146568576 17:33934256-33934278 GGTGAGCAAGGAGAAGGCTGTGG - Intronic
1146604496 17:34246598-34246620 GGGAAGGAAATAGAAGGCTGTGG + Intergenic
1147873526 17:43604522-43604544 GGGAAGCTAAAAGCAGACTCAGG + Intergenic
1148091255 17:45023753-45023775 GGCAGGCAATAAGCAGGATGTGG + Exonic
1149451813 17:56755577-56755599 AGGAGGCAAGTAGCGGGCTGAGG + Intergenic
1149623117 17:58060823-58060845 GGGAAGCAGCAAGCCGGCAGAGG + Intergenic
1150681689 17:67289802-67289824 TGGAAGGGAGCAGCAGGCTGGGG + Intergenic
1151102345 17:71570476-71570498 GTAAAGCAACAGGCAGGCTGGGG - Intergenic
1151510894 17:74559224-74559246 GGTAAGCAAACAGCAGGCTTCGG - Intergenic
1152290344 17:79436700-79436722 GGGAAGAAAGAAGAAAGCTCAGG + Intronic
1152456661 17:80421061-80421083 GGAAAGCAAGGGGCAGGCAGAGG + Intronic
1152528126 17:80901237-80901259 GGGAAGCACACAGCAGCCTGGGG + Intronic
1154139318 18:11809268-11809290 AGGAAGAAAGCAGGAGGCTGGGG + Intronic
1155159003 18:23180853-23180875 GGGATGCAAGAAGCAGGGGATGG + Intronic
1155638569 18:27984766-27984788 GGCAAGGAAGAGGCATGCTGAGG + Intronic
1156293870 18:35772999-35773021 GTGAAGCCAGATGCAGCCTGGGG - Intergenic
1156480112 18:37430950-37430972 GGGAGGGAAGAAGCAGGCAATGG - Intronic
1156527825 18:37783864-37783886 AGGAGGCAAGGAGAAGGCTGGGG - Intergenic
1156702609 18:39842715-39842737 GGGAAGGAAGAGGCAGGTTGAGG - Intergenic
1156731425 18:40197858-40197880 GGGAAGCTAAAAGCAGACTGAGG - Intergenic
1157257871 18:46154577-46154599 GGGAAGCAAGAAGTAGGGGATGG - Intergenic
1157479594 18:48044958-48044980 GGGGAGCCAGATGCAGGCTCAGG - Intronic
1157947558 18:51997927-51997949 GGGAAGGATGAAACAGGCAGTGG + Intergenic
1159480153 18:68980104-68980126 GGGAAGCAAGAACCAGGACCTGG - Intronic
1159516965 18:69470598-69470620 GGGAAGAAAGGGGCAGGGTGGGG - Intronic
1159886056 18:73908461-73908483 GGGAAGCACAGAACAGGCTGTGG + Intergenic
1160210112 18:76870801-76870823 GAGAAGCAGGAAGGTGGCTGGGG + Intronic
1160731356 19:643011-643033 GAGGAGCAAGGAGCAGGCAGAGG - Intronic
1160829084 19:1094607-1094629 GAGAAAGAAGAATCAGGCTGCGG + Intronic
1161550374 19:4909379-4909401 GGGAAGCGAGAAAGAGGGTGGGG - Intronic
1161778571 19:6277260-6277282 GGGAAGCTAGAATCAGACTTTGG + Intronic
1163057690 19:14733498-14733520 GGGAAGCTAAAAGCAGACTTGGG + Exonic
1163073469 19:14866213-14866235 GGGAAGCTAAAAGCAGACTTGGG + Intergenic
1163153525 19:15428246-15428268 GGGAAGCAAGGAGAGGGCCGCGG + Intronic
1163504774 19:17699125-17699147 GGGAATGAACAAGCAGGCAGAGG + Intergenic
1163664680 19:18597830-18597852 GGGAAGAGTGAGGCAGGCTGCGG + Intronic
1163664977 19:18598915-18598937 AGGGTGCAGGAAGCAGGCTGAGG + Intronic
1164630792 19:29760287-29760309 GGGCAGCAGGAGGCAGGCGGCGG + Intergenic
1164764562 19:30754162-30754184 GGGAGGCAGGGAGCAGCCTGTGG - Intergenic
1164842834 19:31406346-31406368 GGGAACCAAAAAGCAGGCAAGGG - Intergenic
1165603957 19:37082959-37082981 GGGAAGAAAGGAGCAGGTAGAGG - Intronic
1166706432 19:44910509-44910531 GGGGAGAAACAAGCAGGCCGGGG - Intergenic
1166717108 19:44975517-44975539 GGGTAGCTAGAAGCAGAATGTGG + Intronic
1166991516 19:46695650-46695672 GAGAACCAGGAAGGAGGCTGAGG + Intronic
1167234002 19:48302928-48302950 AAGAAGCAGGAGGCAGGCTGAGG + Intronic
1167611904 19:50511757-50511779 GGGGAGCTGGCAGCAGGCTGCGG + Exonic
1167774834 19:51548080-51548102 GGGAAGCTAAAAGCAGACTCAGG + Intergenic
1168387218 19:55974407-55974429 GGGAAGCTAAAAGCAGACTCAGG - Intronic
925251865 2:2445543-2445565 GGGAAGGAAGAGGAAGGCAGTGG - Intergenic
926635681 2:15176345-15176367 GGGGAGGAAGAAGGTGGCTGTGG + Intronic
926647659 2:15307027-15307049 GGGGAGGCAGAAGGAGGCTGAGG - Intronic
927441925 2:23124934-23124956 GGGAATGAAGAAGCAGGTGGTGG - Intergenic
927465618 2:23334265-23334287 AGGAAGCAAGAACCAGGCGGGGG + Intergenic
927575595 2:24199642-24199664 GGGAGGCAGGAAGGAGGCTTTGG + Intronic
927698037 2:25251140-25251162 GGGAAGGAAGAAGCGGGGGGGGG + Intronic
927874578 2:26647034-26647056 GGGCTGCAAGACTCAGGCTGAGG - Intergenic
927927203 2:27022187-27022209 GGAAAGCAAGAAGAAAGGTGAGG - Intronic
927971513 2:27308446-27308468 GGAAAGCGAGAAGCCGGCTGGGG + Intergenic
928096979 2:28410704-28410726 GGGATGAAAGAAGGGGGCTGAGG + Intronic
928377794 2:30790043-30790065 GGGAAGGGAGAAGCAGGCAGGGG + Intronic
929112475 2:38416902-38416924 AGGAAGCAAGAAGAAGTCTTTGG + Intergenic
929313535 2:40452021-40452043 GGGAAGCACAAAGCAGGCGGCGG + Intronic
929509567 2:42556142-42556164 GGGAAAAAAAAAGCAGCCTGAGG + Intronic
930095158 2:47561098-47561120 GGGAAGCCAGATGCTGGCTGAGG - Intronic
930223384 2:48767865-48767887 GGGCAGGCAGAAGCAGGGTGGGG - Intronic
930599178 2:53424196-53424218 GGGAAGCTAAAAGCAGACTCGGG - Intergenic
932270008 2:70401072-70401094 GGACAGCAGGAAGCAGGATGTGG - Intergenic
932366122 2:71154577-71154599 GGGAAATAAGAACCAGACTGGGG - Intergenic
932740150 2:74284984-74285006 GGAAAGTAACAAGCAGGCTGGGG - Intronic
933723052 2:85410351-85410373 GGGAAGTGAGAAGCCGGGTGGGG - Exonic
933728164 2:85437952-85437974 GGGATGCAAGCGGGAGGCTGGGG + Intergenic
934544169 2:95200887-95200909 GGGAAGGATTATGCAGGCTGAGG + Intergenic
934565129 2:95334745-95334767 GGGGACCAGGAAGCAGGGTGAGG + Intronic
934860491 2:97760409-97760431 TGGAAGCAGAAAGCCGGCTGCGG - Intronic
934907922 2:98221939-98221961 GTGAAAAAAGAAGCAAGCTGGGG + Intronic
935383583 2:102478585-102478607 GGAAAGCAGGAAGGAGGATGGGG + Intronic
935882582 2:107580437-107580459 AGGAAGAAAGGGGCAGGCTGTGG + Intergenic
936146143 2:109981683-109981705 GGGAAAGAAGAAAGAGGCTGAGG - Intergenic
936198547 2:110389796-110389818 GGGAAAGAAGAAAGAGGCTGAGG + Intergenic
936230404 2:110695362-110695384 GGGAAGCTAAAAGCAGACTCGGG + Intergenic
936838556 2:116740408-116740430 GGGAGCCAAAAAGCAAGCTGAGG + Intergenic
936867164 2:117087836-117087858 GGGAAGCTAAAAGCAGACTTGGG + Intergenic
936986726 2:118318200-118318222 TGCAAGCAAGAAGCAGTCTTTGG - Intergenic
937019038 2:118633595-118633617 TGGAAGCTGGAAGCAGGCTGTGG - Intergenic
938307789 2:130266672-130266694 GGGCAGCCAGGGGCAGGCTGAGG - Intergenic
938331284 2:130450248-130450270 AGGAAACAAGCAGCAGGCTCAGG - Intergenic
938331689 2:130452697-130452719 AGGAAACAAGCAGCAGGCTCAGG - Intergenic
938332236 2:130455965-130455987 AGGAAACAAGCAGCAGGCTCAGG - Intergenic
938358669 2:130671255-130671277 AGGAAACAAGCAGCAGGCTCAGG + Intergenic
938447548 2:131390169-131390191 GGGCAGCCAGGGGCAGGCTGAGG + Intergenic
938478137 2:131634655-131634677 AGGAAACAAGCAGCAGGCTCAGG + Intergenic
939204055 2:139077064-139077086 GAGAAGCTAAAAACAGGCTGTGG - Intergenic
939712157 2:145535844-145535866 GGTGAGCAAGAAACAGGCTCTGG - Intergenic
940168397 2:150800334-150800356 GGGAAGAAAGAAGCTGGCAGTGG - Intergenic
940292594 2:152091737-152091759 GGGAAACAAGCTGCAGGCAGTGG - Intronic
940497951 2:154457834-154457856 GGAAAGCAAGCTGCAGGCTCAGG - Intergenic
940691520 2:156925561-156925583 GAGAAGCAAGAAACAGAGTGAGG + Intergenic
941149008 2:161890611-161890633 GGAAAGCAAAATGCAAGCTGGGG - Intronic
941531773 2:166679263-166679285 GAGAAGAAAGAGGCAGGTTGTGG + Intergenic
941628405 2:167856492-167856514 AGGCTGCAAAAAGCAGGCTGAGG + Intergenic
941820509 2:169840115-169840137 GGGAAGCTAAAAGCAGACTCGGG - Intronic
944483988 2:200184290-200184312 GGAAAGCAAGAGACAGGCAGAGG - Intergenic
945998889 2:216464180-216464202 GGGAAGCAAAAAGCAAGTTGGGG + Intronic
946013445 2:216584907-216584929 GGTCAGCAAGGAGCAGGCAGTGG + Intergenic
946610546 2:221453384-221453406 GGGAAGCAAGGAGCATGTGGGGG - Intronic
947567349 2:231202886-231202908 GGGAAGCTAAAAGCAGACTTGGG + Intronic
947915560 2:233829910-233829932 GGACAGCAGGGAGCAGGCTGTGG - Intronic
947981993 2:234418529-234418551 ATGAAGAAAGAAGCAGGCAGGGG - Intergenic
948061170 2:235044266-235044288 GGGAAGTAAGCATCAGACTGTGG + Intronic
948998277 2:241595831-241595853 TGGGAGCAAGAACCAGGCAGAGG + Intronic
1168989768 20:2084738-2084760 GGGAAGGAAGAAGGTGGCTGTGG + Intergenic
1169120956 20:3095291-3095313 GGGAGGCCAGGGGCAGGCTGGGG - Intergenic
1169268691 20:4182877-4182899 GGTGAGGAAGAAGCAGGGTGGGG - Intronic
1169282286 20:4278090-4278112 GGAAAGCAAGCAGCAGGCACTGG + Intergenic
1169549630 20:6688839-6688861 GGGCAGAAAGAAGAAGGCTAGGG - Intergenic
1169840144 20:9926682-9926704 AGCAAGCAGGAAGGAGGCTGGGG - Intergenic
1169889253 20:10434757-10434779 TGGAACCCAGAAGCAGGATGGGG - Intergenic
1170122583 20:12926635-12926657 GGGAAGCTAAAAGCAGACTCAGG + Intergenic
1170600665 20:17839028-17839050 GAGAACCAAGTAGCATGCTGGGG + Intergenic
1171311825 20:24150887-24150909 GAGAAGCAGGAAGCAGGAGGAGG + Intergenic
1172304281 20:33870480-33870502 GGGATGCATGGAGGAGGCTGTGG + Intergenic
1172304301 20:33870562-33870584 GGGAAGCAGGAGGCTGGGTGTGG + Intergenic
1172593784 20:36135616-36135638 GGGAAGCAGGAAGGAGGCAGGGG - Intronic
1173132995 20:40411919-40411941 GAGAGGCTAGAAGCAGCCTGGGG + Intergenic
1174557659 20:51407277-51407299 TGGAAGAGAAAAGCAGGCTGGGG - Intronic
1175064385 20:56272675-56272697 GGGAAGCTAGGAGGAGGCTAAGG + Intergenic
1175285073 20:57832363-57832385 GTGAAGCAGGAAGGAGGCTGGGG + Intergenic
1175600885 20:60271902-60271924 AAGAAGCAAGATGCTGGCTGGGG + Intergenic
1175778690 20:61668779-61668801 GGGAAGCAAGAAGCGGTAAGTGG - Intronic
1175802778 20:61810579-61810601 GGGAGGCAGGAGGCAGGGTGAGG - Intronic
1176076456 20:63250551-63250573 GAGATGCAGGCAGCAGGCTGGGG - Intronic
1177324232 21:19563110-19563132 GGAAAGCAAGAACCATGCTCAGG - Intergenic
1178505387 21:33158479-33158501 CGGAACCCAGGAGCAGGCTGGGG + Intergenic
1178600959 21:33993825-33993847 GGGAGGCAGGTGGCAGGCTGAGG - Intergenic
1179587858 21:42385087-42385109 GGCAAGCAAGAAGGGGGGTGGGG - Intronic
1180180941 21:46118464-46118486 GGGATGCCAGATGCTGGCTGGGG - Intronic
1180478763 22:15734051-15734073 AGGAAACAAGAAGCAGGTTCAGG + Intergenic
1180478856 22:15734582-15734604 AGGAAACAAGCAGCAGGCTCAGG + Intergenic
1180479182 22:15736561-15736583 AGGAAACAAGCAGCAGGCTCAGG + Intergenic
1180479285 22:15737192-15737214 AGGAAACAAGAAGCAGGTTCAGG + Intergenic
1180479375 22:15737719-15737741 AGGAAACAAGCAGCAGGCTCAGG + Intergenic
1180835771 22:18928736-18928758 GGGATCCCCGAAGCAGGCTGAGG - Intronic
1180983491 22:19890697-19890719 AGAAAGCAAGAACCAAGCTGGGG - Intronic
1181546800 22:23606858-23606880 GAGAAGCCAGCAGGAGGCTGTGG - Intergenic
1181727219 22:24820023-24820045 GGGAAGCCAGACGCAAGCAGTGG + Intronic
1181811635 22:25406711-25406733 GGGAAGGAAGAGGCCAGCTGGGG + Intergenic
1182102968 22:27670690-27670712 GGGCAGAAAGAAGCAGGCTGGGG - Intergenic
1182263328 22:29092261-29092283 GAGAAGCAAGAATGATGCTGAGG + Intronic
1183223448 22:36532429-36532451 GGGAAGCTAGTAGAAGGTTGTGG - Intergenic
1183314076 22:37127688-37127710 GGGAGGGAAGGAGGAGGCTGGGG + Exonic
1183353105 22:37344466-37344488 GGGCAGCAAGACCCAGGCTCAGG + Intergenic
1183386808 22:37519567-37519589 GGGAAACAGGAAGCAGGGGGAGG - Intergenic
1183728078 22:39600480-39600502 GGGAAGCAAGGGACAGGGTGAGG - Intronic
1184416163 22:44352950-44352972 GGCAGGCAGGAAGAAGGCTGTGG - Intergenic
1184423897 22:44397721-44397743 GAGGAGCAAGACGCAGGCCGTGG + Intergenic
1203285860 22_KI270734v1_random:154035-154057 GGGATCCCCGAAGCAGGCTGAGG - Intergenic
949500059 3:4671201-4671223 GGTACGTAAGAGGCAGGCTGTGG + Intronic
950053288 3:10007938-10007960 AGGAAGCAAGAAGCAGGCTCAGG + Intronic
950068693 3:10134849-10134871 GGGAAGCTAAAAGCAGACTCAGG + Intergenic
950304930 3:11910223-11910245 AGGAAGCAAGAAGCAGGCTCAGG + Intergenic
950414612 3:12861782-12861804 AGGAAGCAGGAAGCAGGCTGGGG + Intronic
950414940 3:12863771-12863793 AGGAAGTAAGAAGTGGGCTGGGG + Intronic
950416681 3:12872909-12872931 GGGAAGCAAGAAGCAGGCTGGGG + Intergenic
950425554 3:12923115-12923137 GGCAAGCAGGGAGCAGGCAGAGG + Intronic
950466030 3:13154142-13154164 AGGAAGCAAGAAGTGGGCTGGGG - Intergenic
950610088 3:14121059-14121081 GGGAAGCTAAAAGCAGTCTTGGG - Intronic
950945943 3:16946222-16946244 GAGAAGCAAAAAGGAGGCAGCGG + Intronic
951053663 3:18122857-18122879 AGGAAGCAAGAGGAAGGTTGAGG - Intronic
951534010 3:23725385-23725407 GGTAAGCAAGGACCAGGCTGGGG + Intergenic
951845196 3:27077520-27077542 GAGAAGCTAGAAGCTGACTGGGG + Intergenic
952898292 3:38093796-38093818 GGTAAGCAAGAAGAAGGGTTGGG - Intronic
952968222 3:38634090-38634112 GGGGAGCAAGGAGCAGTGTGAGG - Intronic
953008978 3:39005822-39005844 GGGAGGCAGGAAGCAGAATGAGG - Intergenic
953274577 3:41482249-41482271 GGGAAGGAAACAGCTGGCTGTGG - Intronic
953577909 3:44128055-44128077 GGGAAGGAAGCACCAGGCAGGGG + Intergenic
955746962 3:62149625-62149647 GGGAGGAAAGAAAGAGGCTGAGG - Intronic
956111246 3:65871627-65871649 GGGAAGGAACACGCAGGCTCAGG + Intronic
956344430 3:68262420-68262442 GGGAAGGAAGAAGGAGGCATGGG - Intronic
958715406 3:97774343-97774365 GGGATTCTAGAAGCAGGCGGGGG + Intronic
959674481 3:109019255-109019277 GAGATGCAAGCAGCAGGATGTGG - Intronic
959688172 3:109170189-109170211 GGGAAGGAGTAAGCAGGCTTAGG + Intergenic
960488501 3:118281738-118281760 GTAAAGCAAGAAGAAGCCTGTGG + Intergenic
960513478 3:118577663-118577685 GGGAAACAAAAAGAAAGCTGAGG + Intergenic
961359455 3:126357668-126357690 GGGAAGCAAGGAGGTGGCTGCGG - Intergenic
961362478 3:126376647-126376669 GGGAGTGAAGAAGCCGGCTGGGG - Intergenic
961496488 3:127296036-127296058 GAGAAGCAACAAAGAGGCTGAGG + Intergenic
961713329 3:128843260-128843282 AGAAAGCCGGAAGCAGGCTGGGG - Intergenic
961713640 3:128844981-128845003 AGGAAGCCAGAAGCGGGTTGGGG - Intergenic
961786169 3:129348104-129348126 AGGAAGCAAGAGGCGGGCTGGGG + Intergenic
961796614 3:129413490-129413512 GGGAAGCTAAAAGCAGACTTGGG + Intronic
961905560 3:130259602-130259624 GGGCAGGAACAAGCAGGCTCTGG - Intergenic
962664723 3:137642505-137642527 GGGAAGCACCAAGCTGGGTGCGG - Intergenic
963776840 3:149448470-149448492 GGGAAGGAAGAAGCAGGGAGGGG - Intergenic
963893513 3:150661247-150661269 GGGAAGCAGGATGGAGTCTGAGG + Intronic
966656592 3:182365057-182365079 TGGAAACAAGAATCAGGCTTGGG + Intergenic
966809174 3:183828103-183828125 GGGAGGCCAGAACCTGGCTGTGG - Intergenic
966862924 3:184240765-184240787 TGGAACCAAGGAGCAGTCTGTGG - Intronic
967305641 3:188056466-188056488 GGGAAGGAAGAAATAGCCTGAGG - Intergenic
968272692 3:197416649-197416671 ATGAAGCAAGACGCAGTCTGGGG + Intergenic
968459762 4:718704-718726 GGGAGTCAAGGACCAGGCTGGGG + Intronic
968571755 4:1346002-1346024 GTGAAGCAAGAGGCAGGGTGAGG + Intergenic
968598128 4:1495798-1495820 GGGTCGCAAGGACCAGGCTGTGG - Intergenic
969173183 4:5380088-5380110 GAGAAGCAAGCAGTGGGCTGGGG - Intronic
969423275 4:7109424-7109446 GGGAAGACAGGAGCAGGCTTGGG - Intergenic
969534456 4:7747296-7747318 GGGAAGGAAGGAGCAGGCCTGGG + Intergenic
969858334 4:10017712-10017734 GGCAGACAGGAAGCAGGCTGAGG - Intronic
969869581 4:10096232-10096254 TGGTAGCTAGAAGCCGGCTGTGG - Intronic
970410310 4:15799998-15800020 GGGAAGCTAAAAGCAGACTCGGG + Intronic
970724963 4:19032802-19032824 GGGAAGAAAGAAGCCAGCAGTGG + Intergenic
971800413 4:31282900-31282922 GGGAAGGTAGAAGGAGGTTGAGG + Intergenic
974074587 4:57157117-57157139 GGGAAGCAAGAACTGGGCAGAGG + Intergenic
974328939 4:60451213-60451235 GGGAAGAAAGAAGCTGGTAGTGG - Intergenic
974863526 4:67552344-67552366 GGGAAGCTAAAAGCAGACTCGGG - Intergenic
975601669 4:76106609-76106631 GGGAAGCTAAAAGCAGACTTGGG - Intronic
976566910 4:86561780-86561802 GGGAGACAAGAAGCAGACAGAGG + Intronic
976834657 4:89357568-89357590 GGGAAGAGAGAAGCAGGATTGGG - Intergenic
979421312 4:120508955-120508977 GGGAAAGCAGAAGCAGGGTGGGG + Intergenic
979612216 4:122701516-122701538 GGTAAGCAAGGAGCAGGAAGTGG + Intergenic
979703352 4:123692179-123692201 GGTAAGCCAGAGGCAGTCTGAGG - Intergenic
979737058 4:124100292-124100314 GGGAAGCAAGAAATAGGATAAGG + Intergenic
982901440 4:161009128-161009150 GGGAACCAGGAAGCTGGCTTAGG - Intergenic
983313758 4:166099432-166099454 GTGGAGGAAGAAGCAGACTGTGG + Exonic
983627671 4:169818760-169818782 GGGAAGGAAGAAGTAAGGTGGGG - Intergenic
983941508 4:173538362-173538384 GGGAACCGAGAAGAGGGCTGGGG - Intergenic
985358609 4:189147721-189147743 GGGAAGCAGCCAGCACGCTGTGG + Intergenic
986750888 5:10787040-10787062 GGGAAGCCAGAAGCAGGAAGTGG - Intergenic
987871071 5:23617511-23617533 GGGAAGCTAAAAGCAGGCTTGGG - Intergenic
987944974 5:24594595-24594617 GTGAAGCAAGAAGGACCCTGTGG - Intronic
989195432 5:38711912-38711934 GGGAAGGTAGAAGCAGGGTCTGG + Intergenic
991367749 5:65886792-65886814 GAGAAGGAAGAATCAGGCAGAGG + Intergenic
992093860 5:73342430-73342452 AGCAAGGAAGTAGCAGGCTGCGG - Intergenic
992676560 5:79111777-79111799 GGGTATAAAGAGGCAGGCTGCGG + Exonic
993794545 5:92249896-92249918 GGGAAGAAAGAAAGAGCCTGAGG + Intergenic
994800401 5:104366569-104366591 GGAGAGCAAGAAGCAGTCTCTGG - Intergenic
995725925 5:115180181-115180203 GGAAAGCAAGAAGCGGGCTTGGG + Intronic
996469684 5:123845251-123845273 GGAAACCCAGAATCAGGCTGGGG - Intergenic
997975683 5:138440197-138440219 GGGAAGAAGGGAGCAGGGTGGGG - Intronic
998182295 5:139954037-139954059 GGGAGGCAAGGGGCAGGGTGTGG + Intronic
998258730 5:140611310-140611332 GGGAAGCTAAAAGCAGACTGGGG - Intergenic
998368763 5:141647894-141647916 GGGGATCAAGAAGCAGGGGGAGG + Intronic
998811316 5:145969375-145969397 GGGAAGTAAGAAGAAAGGTGAGG + Intronic
998955048 5:147430192-147430214 GGGAAGAAAAAAGAAGGATGGGG + Intronic
999167196 5:149559989-149560011 TGGAAGCAAGCAGCAGGGGGTGG + Intronic
1000294826 5:159903898-159903920 GGGAGGCTAAAAGTAGGCTGGGG + Intergenic
1000417565 5:160998541-160998563 GGGCAAGAAGAAGCAGGGTGAGG - Intergenic
1001071724 5:168591270-168591292 TGGAAGCCAAAAGCAGTCTGGGG - Intergenic
1001196047 5:169674481-169674503 GGGAAGAAAGAGGATGGCTGGGG - Intronic
1001320723 5:170678836-170678858 GGGAAGGAAGCAGCAGGGAGAGG + Intronic
1001480569 5:172086494-172086516 GGCAAGCAAAGAGAAGGCTGAGG + Intronic
1001516797 5:172361440-172361462 GGGCAGCAAGAAGAAGGGAGAGG - Intronic
1001761725 5:174213490-174213512 GGGAAGAAAGAAGGAAGCTGGGG - Intronic
1001961593 5:175883219-175883241 GAGAAGCAAAAAGGCGGCTGTGG + Exonic
1002021674 5:176367631-176367653 GGGAAACAGAAAGAAGGCTGGGG - Intronic
1002289243 5:178188523-178188545 GGGAAGGCAGAAGCAAGCAGAGG + Intergenic
1002434988 5:179225738-179225760 GGGAAGCCAGAAGGAGGATGGGG - Intronic
1002524065 5:179806088-179806110 GGGCAGCAGGCAGCAGGGTGGGG + Intronic
1002764635 6:228316-228338 GGGAAGGAAGAAACAGGCAATGG + Intergenic
1003277891 6:4667841-4667863 GGGAAGAGAGAAGAAGGCTAGGG - Intergenic
1003693968 6:8383702-8383724 GGGAAGCAAGAAGCACTCATAGG + Intergenic
1005270255 6:24156157-24156179 TGGAAGGAAGAAGCAGGCTCTGG - Intergenic
1005492986 6:26363956-26363978 ATGAAGTCAGAAGCAGGCTGGGG - Intergenic
1005502261 6:26439280-26439302 ATGAAGTCAGAAGCAGGCTGGGG - Intergenic
1006105253 6:31712566-31712588 GGGATGAAAGAGGCATGCTGAGG + Intronic
1006244170 6:32715785-32715807 GGGAAGCTAAAAGCAGACTCTGG - Intergenic
1006775628 6:36590335-36590357 AGGAGGGAAGAAGCAGCCTGAGG - Intergenic
1007019712 6:38507171-38507193 AGGAAGTAAGCAGCAAGCTGTGG - Intronic
1007090588 6:39182154-39182176 GGAAAGGAAGAAGCAGTCTCTGG - Intergenic
1007221763 6:40284359-40284381 GGGAAACAAGCAGGAGGCTGAGG - Intergenic
1007384707 6:41512813-41512835 GGAAGGGAAGAGGCAGGCTGAGG - Intergenic
1007431296 6:41779031-41779053 TGGAAGGAAGAAGCAGGCTCAGG + Intronic
1007756352 6:44102158-44102180 GGGCAGGAAGAAGCTGGGTGGGG - Intergenic
1007841578 6:44720439-44720461 GGGCAGCCAGAAACAGGGTGGGG + Intergenic
1008044199 6:46835148-46835170 TGGGAGATAGAAGCAGGCTGGGG + Intronic
1008780953 6:55104081-55104103 GGCAGGCATAAAGCAGGCTGAGG + Intergenic
1011429419 6:87269309-87269331 TGGAAGCCAGAAGAAGGTTGAGG + Intergenic
1012545631 6:100415972-100415994 GGGAAGCTAAAAGCAGACTCAGG + Intronic
1013250078 6:108325115-108325137 TGCAAGCAAGAAGCAGGCACTGG + Intronic
1013479276 6:110539269-110539291 AGGAGGGAAGAAGCAGGATGTGG - Intergenic
1015160888 6:130151181-130151203 GGGAGGCAAGCAGCATGCGGAGG - Intronic
1015163962 6:130182614-130182636 GGGAAGAAAGAAGGAGGGAGGGG + Intronic
1015797056 6:137023590-137023612 GTGCACCAAGATGCAGGCTGTGG + Intronic
1017262506 6:152403288-152403310 GGGAACCATGAAGCAGGCCAGGG - Intronic
1017731791 6:157323543-157323565 TGGAAGCGAGAACCAGGCGGAGG + Exonic
1018095997 6:160387374-160387396 GTAAAGCCAGAAGCAGGCTCTGG - Intronic
1018432186 6:163730994-163731016 AGGAAGCAGGAGGGAGGCTGAGG + Intergenic
1018864561 6:167736815-167736837 GGGAAGGAAGGCACAGGCTGTGG - Intergenic
1018986383 6:168640352-168640374 AGGAAGCATGGGGCAGGCTGCGG + Intronic
1019463518 7:1173908-1173930 GGGAAGCAGGAGGCACACTGGGG - Intergenic
1019780294 7:2935805-2935827 GGGAGGCCAGCAGCTGGCTGTGG + Intronic
1020147490 7:5655676-5655698 GGCAAGCAAACACCAGGCTGGGG + Intronic
1020687078 7:11309399-11309421 GGCAAGCAATAAGGAGGATGGGG + Intergenic
1021081887 7:16374390-16374412 GGGAAGAAAGAAGCTGGTAGTGG - Intronic
1021378178 7:19934753-19934775 GGGAGCAAAGAAGCAGGGTGGGG - Intergenic
1022480545 7:30740597-30740619 GGGCAGGAAGCAGCAGGCGGAGG - Intronic
1022627735 7:32055277-32055299 GGAAAGCAATGAGAAGGCTGGGG + Intronic
1022708669 7:32831386-32831408 GGGAAGCAAGGAGTGGGGTGAGG + Intergenic
1023309399 7:38868391-38868413 GGGAAGCAAGCGGGAGGATGAGG + Intronic
1023912907 7:44568078-44568100 GGGCAGGAGGCAGCAGGCTGGGG - Intronic
1024051240 7:45624741-45624763 GGGAAGCAAGGAGCAGGCCCAGG - Intronic
1024097132 7:45991243-45991265 TGGGGGCCAGAAGCAGGCTGAGG + Intergenic
1025014289 7:55426583-55426605 TGGAAGCATGAAGGAGGCTGTGG + Intronic
1025770395 7:64499903-64499925 GGGAAGCTAAAAGCAGACTGGGG + Intergenic
1026125321 7:67574393-67574415 GGGAAGCTAAAAGCAGACTTGGG + Intergenic
1026865602 7:73822384-73822406 GGGGAGCAGGAGGCAGGGTGGGG - Intronic
1027906322 7:84187422-84187444 AGGAATCAGGAACCAGGCTGAGG - Intronic
1028302485 7:89217909-89217931 GGGTGGCAAGAAGAAGGATGAGG + Intronic
1028480583 7:91300418-91300440 GGGAAGCAAAAGCCAGACTGGGG - Intergenic
1028503564 7:91546712-91546734 GAGAGGCACGAAGCAGGCTGAGG + Intergenic
1028635749 7:92987375-92987397 GGGGAGCAAGTAACAGACTGTGG + Intergenic
1029156473 7:98521084-98521106 GGGAGGATAAAAGCAGGCTGTGG + Intergenic
1029791291 7:102845675-102845697 GGGAAGTAACAGGGAGGCTGGGG - Intronic
1030891917 7:115008796-115008818 AGCAAGCTAGAAGCAGGCTGTGG - Intronic
1031360889 7:120846998-120847020 GAGAAGGAAAAAGCAGGCAGGGG + Intronic
1032460019 7:132103337-132103359 GGGAGGAAAGAAGGAGGCTGAGG + Intergenic
1032538696 7:132685672-132685694 GGGACTCAAGAAGCAGGAGGGGG - Intronic
1032762184 7:134953766-134953788 GGGAAGCCAGCATCTGGCTGAGG - Intronic
1032798685 7:135300723-135300745 GGGAAGCTAAAAGCAGACTTGGG + Intergenic
1032992482 7:137409452-137409474 GGGAAGCATGAAGCAGGGGATGG + Intronic
1033375189 7:140754004-140754026 GAGAAACCAAAAGCAGGCTGTGG + Intronic
1033674011 7:143519898-143519920 GAGAAGCAAGAAGCACTCTAGGG - Intergenic
1034547275 7:151797208-151797230 GGGTGGCAAGAAGCTGACTGTGG - Intronic
1034656220 7:152731467-152731489 GGCAAGAACCAAGCAGGCTGAGG - Intergenic
1035297257 7:157874178-157874200 GGGAGGCCAGAGGCAGACTGAGG - Intronic
1035735337 8:1883270-1883292 CGGCAACAAGCAGCAGGCTGGGG + Intronic
1036678507 8:10853654-10853676 AGGAAGCAGGAAGCAGGATGAGG + Intergenic
1036696633 8:10979339-10979361 AGGAAGCAAGCAGAAGGCTCGGG + Intronic
1038536600 8:28358030-28358052 GGTAAGCATGCTGCAGGCTGTGG + Intronic
1038710244 8:29937423-29937445 AGGAAGGAAGAAGCATGCTTTGG - Intergenic
1038795239 8:30703785-30703807 GGGAAGGAAGAAGGAGGAGGAGG + Intronic
1039745260 8:40419842-40419864 GGGAAGGAAGAAGGAATCTGGGG + Intergenic
1039770155 8:40678049-40678071 TGGAAACACGAATCAGGCTGTGG - Intronic
1040111523 8:43568993-43569015 GGGAAGCTTGAGGCAGGCCGGGG - Intergenic
1040466223 8:47697734-47697756 GAGCGGCAAGAAGAAGGCTGGGG - Intronic
1040561632 8:48527949-48527971 GGGAAGGAAGGAACAGGATGGGG - Intergenic
1040760536 8:50836675-50836697 AGGAGGGAAGAAGCAGGCAGTGG - Intergenic
1040920193 8:52607584-52607606 GGGAAGCTAAAAGCAGACTCAGG - Intergenic
1041179336 8:55231536-55231558 GGGAAGGATGGGGCAGGCTGGGG - Intronic
1041864981 8:62561987-62562009 TGGAAGCAAGAATGAGGGTGTGG + Intronic
1042958917 8:74281837-74281859 GGGAAGGAAGAGGCTGGCAGTGG - Intronic
1046057729 8:109098434-109098456 GGCAATCAAGAGGCAGGGTGTGG - Intronic
1046103280 8:109639029-109639051 GGAAAGCAAGAGGGAGGCAGTGG + Intronic
1046119807 8:109831669-109831691 GGGAAGAAAGAAGCCAGCAGGGG - Intergenic
1047428026 8:124764489-124764511 GGCAAGCAAGAAGCAGAGTTGGG + Intergenic
1047504365 8:125467091-125467113 CAGAAGCAGGAAGGAGGCTGGGG - Intergenic
1049231605 8:141487790-141487812 GGAAGGCAGGAAGCAGGTTGGGG - Intergenic
1049272051 8:141701106-141701128 GGGAAGTGAGGAGCAGGCTATGG + Intergenic
1049410659 8:142472436-142472458 GAGGAGCAGCAAGCAGGCTGGGG - Intronic
1050114651 9:2251237-2251259 AGGGTGCAAGAAACAGGCTGAGG + Intergenic
1051088696 9:13381237-13381259 GGGAAGCAGGGAGCAGGAAGGGG - Intergenic
1051792135 9:20817376-20817398 GGCAAGTAAGAAGCAGGGGGTGG - Intronic
1052584667 9:30411326-30411348 GGGAAAAAAAAATCAGGCTGCGG + Intergenic
1052882073 9:33607523-33607545 GGGAAGCCTGAGGAAGGCTGTGG + Intergenic
1053174482 9:35912126-35912148 GAGAAGGAAGAAGCAGGATTGGG + Intergenic
1053494239 9:38538238-38538260 GGGAAGCCTGAGGAAGGCTGTGG - Intergenic
1054747392 9:68868637-68868659 GGGAACAAAGAAGCAGACTGAGG - Intronic
1055068003 9:72138099-72138121 GGGAAGCCAAAAGCAGACTCGGG - Intronic
1055832662 9:80400705-80400727 GGCAAACAAGAAGAAGGCGGAGG - Intergenic
1056038095 9:82630527-82630549 GGGAAGCTAAAAGCAGACTCAGG + Intergenic
1056390931 9:86140928-86140950 GGGAGGCAAGAGGCTGGGTGCGG - Intergenic
1056556747 9:87695692-87695714 AAGAAGCAAGAAGCATGCAGGGG - Intronic
1056796349 9:89661431-89661453 GGGCAGAAAGAAGGAAGCTGAGG + Intergenic
1056881225 9:90395822-90395844 GGGAAACAAGCATCAGACTGAGG - Intergenic
1056935115 9:90910562-90910584 GGGGAGCAGGAATGAGGCTGGGG + Intergenic
1058453947 9:105121913-105121935 GGGAAGCTAAAAGCAGACTCAGG - Intergenic
1058816022 9:108683513-108683535 GGGAAGCAAAATGCTAGCTGTGG - Intergenic
1059391871 9:114004349-114004371 GGGAGCCAAGGACCAGGCTGAGG - Intronic
1059407271 9:114108930-114108952 GGGAAGAGAGATGGAGGCTGAGG - Intergenic
1059407622 9:114111485-114111507 AGAAAGAAAGAAGCTGGCTGTGG - Intergenic
1060309564 9:122447147-122447169 GGGAAGCTAAAAGCAGACTCAGG + Intergenic
1060980279 9:127787868-127787890 AGGAAGAAAGAAGCTGGTTGTGG + Intronic
1061138498 9:128750548-128750570 GGGACGCAAGAAGCAGGAAAGGG + Intronic
1061223646 9:129267347-129267369 TGGAAGCAGGAAGGTGGCTGAGG + Intergenic
1061563708 9:131423300-131423322 GTGAAGCAGGAAGCCGGCTGAGG - Intronic
1061907749 9:133707571-133707593 GGGAGGCAAGAGGGAGGCTCAGG - Intronic
1061935627 9:133856100-133856122 GGCAAACAGAAAGCAGGCTGGGG + Intronic
1062070769 9:134553962-134553984 GGGGAGGAAGAGGAAGGCTGGGG + Intergenic
1062082341 9:134630654-134630676 AGGACCCTAGAAGCAGGCTGAGG - Intergenic
1062416207 9:136451540-136451562 GGGAGGCAGGAAGGGGGCTGGGG + Intronic
1062725940 9:138073638-138073660 GGGAAGCAAGACGGAGGAAGGGG - Intronic
1185850003 X:3476336-3476358 GGGAAGAAAGAAGAAGGAGGAGG + Intergenic
1186063712 X:5739039-5739061 GGGAAGCTAAAAGCAGACTCAGG + Intergenic
1187299271 X:18031953-18031975 GGGAAGCAGGAGGCAGGAAGAGG + Intergenic
1188274107 X:28178702-28178724 TGGAAGCCAGGAGCAGCCTGTGG - Intergenic
1188678726 X:32975660-32975682 AGGAAGCAAGAAGAAGGAAGAGG - Intronic
1188775750 X:34216235-34216257 GGGAAGAAAGAAGCCGGTAGTGG - Intergenic
1189109762 X:38276679-38276701 GGAAAGCAAGAAGAAAACTGTGG - Intronic
1189703254 X:43733533-43733555 GGCAGGCAAGAGGGAGGCTGTGG - Intronic
1190007501 X:46754703-46754725 AGGAAGCGAGAAGCAGGTGGTGG + Intronic
1190122772 X:47676193-47676215 GGGAAGCTAAAAGTAGACTGGGG + Intergenic
1190905524 X:54723394-54723416 GGGAAGCCAAAAACAAGCTGTGG - Intergenic
1192691732 X:73372512-73372534 GGAAAGAAACAAGCAGCCTGAGG - Intergenic
1193837763 X:86366787-86366809 GGGAAGCAAAAAGGGGGGTGGGG - Intronic
1193975684 X:88115420-88115442 GGGAAGAAAGAAGCCGGTAGTGG - Intergenic
1194974588 X:100380732-100380754 TTGAAGCAGAAAGCAGGCTGTGG - Intronic
1195894561 X:109732866-109732888 CGGCAGGAAGAGGCAGGCTGGGG + Intronic
1196102507 X:111862267-111862289 GGGAAGAAAGAATCAGGCCTTGG - Intronic
1196178745 X:112667941-112667963 GGGGAGCAAGAGTCAGGCAGGGG + Intronic
1196990243 X:121320826-121320848 GGCAAGGAAGAGGTAGGCTGAGG - Intergenic
1197746994 X:129938279-129938301 GGGAGGCAGGAAGCAGACAGCGG - Intergenic
1197926075 X:131647846-131647868 GGGAAGGAAGGAGCAGAATGCGG - Intergenic
1198404597 X:136300163-136300185 GGGAAGCTAAAAGCAGACTTGGG - Intergenic
1198438603 X:136640235-136640257 GAGATGCAGAAAGCAGGCTGAGG + Intergenic
1198932210 X:141873284-141873306 GGGAAGCTAAAAGCAGACTCAGG - Intronic
1198963861 X:142207784-142207806 GGGAAGAAAGAGGTGGGCTGGGG - Intergenic
1199311813 X:146329655-146329677 GGGAAACTAAAAGCAGACTGGGG - Intergenic
1201579317 Y:15494350-15494372 GGGAAAGGAGAACCAGGCTGGGG + Intergenic
1201648146 Y:16258267-16258289 GGGAAGCTAAAAGCAGTCTTGGG - Intergenic
1201654664 Y:16327034-16327056 GGGAAGCTAAAAGCAGTCTTGGG + Intergenic
1202106224 Y:21369710-21369732 GGGAAGCTAAAAGCAGACTGGGG + Intergenic
1202194085 Y:22278021-22278043 GGGAAGCTAAAAGCAGACTGGGG + Intergenic
1202201390 Y:22354124-22354146 GGGAAGCTAAAAGCAGACTGGGG - Intronic
1202362570 Y:24127494-24127516 GAGGAGCAAGAGGAAGGCTGAGG + Intergenic
1202508276 Y:25544511-25544533 GAGGAGCAAGAGGAAGGCTGAGG + Intergenic