ID: 950416682

View in Genome Browser
Species Human (GRCh38)
Location 3:12872918-12872940
Sequence GAAGCAGGCTGGGGCAAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 538
Summary {0: 1, 1: 1, 2: 9, 3: 44, 4: 483}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950416677_950416682 4 Left 950416677 3:12872891-12872913 CCAACAAAGAGCAGGAACGGGAA 0: 1
1: 0
2: 0
3: 14
4: 207
Right 950416682 3:12872918-12872940 GAAGCAGGCTGGGGCAAGCATGG 0: 1
1: 1
2: 9
3: 44
4: 483
950416672_950416682 10 Left 950416672 3:12872885-12872907 CCTTCCCCAACAAAGAGCAGGAA 0: 1
1: 0
2: 3
3: 35
4: 303
Right 950416682 3:12872918-12872940 GAAGCAGGCTGGGGCAAGCATGG 0: 1
1: 1
2: 9
3: 44
4: 483
950416674_950416682 6 Left 950416674 3:12872889-12872911 CCCCAACAAAGAGCAGGAACGGG 0: 1
1: 0
2: 0
3: 13
4: 105
Right 950416682 3:12872918-12872940 GAAGCAGGCTGGGGCAAGCATGG 0: 1
1: 1
2: 9
3: 44
4: 483
950416676_950416682 5 Left 950416676 3:12872890-12872912 CCCAACAAAGAGCAGGAACGGGA 0: 1
1: 0
2: 0
3: 14
4: 130
Right 950416682 3:12872918-12872940 GAAGCAGGCTGGGGCAAGCATGG 0: 1
1: 1
2: 9
3: 44
4: 483
950416670_950416682 28 Left 950416670 3:12872867-12872889 CCAGTCATATAAGATTCTCCTTC 0: 1
1: 1
2: 2
3: 9
4: 130
Right 950416682 3:12872918-12872940 GAAGCAGGCTGGGGCAAGCATGG 0: 1
1: 1
2: 9
3: 44
4: 483

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950416682 Original CRISPR GAAGCAGGCTGGGGCAAGCA TGG Intergenic
900354917 1:2256422-2256444 GAAGAACGCTGGAGCAAGGACGG - Intronic
900457361 1:2783735-2783757 GCAGCGGGCTCGGGCAAGGAGGG + Exonic
900589968 1:3455066-3455088 CGAGCGGGCGGGGGCAAGCAGGG - Intronic
900673265 1:3868922-3868944 GGAGCAGGCTGGGAAATGCAAGG - Intronic
900927126 1:5712754-5712776 GAAGCAGGCTGGGGATACGAGGG - Intergenic
900955322 1:5883168-5883190 CAAGCAGGCTGGGGCGAGGAAGG + Intronic
901048960 1:6416660-6416682 GAAGCAAGAGGTGGCAAGCATGG + Exonic
901783530 1:11609934-11609956 GAGGCAGGTTGGGGCAGGCCGGG - Intergenic
901903124 1:12384087-12384109 GAAGCAGAGTGGGGCAAGACTGG + Intronic
902331289 1:15732308-15732330 GAGGCAGGCTGGGGCCTCCAGGG - Intronic
902757352 1:18557690-18557712 GAAGCAGGCCGTGGTAACCATGG + Intergenic
902990412 1:20183744-20183766 AGAGCAGGGTGGGGCAGGCATGG + Intergenic
903258661 1:22119369-22119391 GGGGCAGGCTGGGGCAGGCTGGG + Exonic
903327744 1:22580880-22580902 AAAGCAGCCTGGGGCAGGCTAGG - Intronic
903498445 1:23788009-23788031 TAAGCAGTCTGGGGAGAGCATGG + Exonic
903818389 1:26081929-26081951 GAAGGGGGCTGGGGAAAGTAGGG - Intergenic
904474433 1:30755902-30755924 GCTGCAGGGTGGGCCAAGCAAGG + Intronic
904678219 1:32211651-32211673 GAACCAGACTGGGGCAGGAAGGG - Intronic
904809721 1:33155495-33155517 GAAGGAGGCTGGGGAGACCAAGG - Intronic
905212096 1:36381402-36381424 GGAGCAGCCTGGCACAAGCACGG - Intronic
906000622 1:42421376-42421398 GCAGAAGGCTGGGGGAAGGAGGG + Exonic
906061495 1:42952056-42952078 GGGGCAGGCAGGGGCAAGGATGG + Intronic
906405812 1:45541051-45541073 GAAGCAGGCCAGGCCAGGCATGG + Intergenic
907491299 1:54810565-54810587 GAAGCAGGATGGGGCGGGAAGGG - Intronic
908467425 1:64411323-64411345 CACCCAGGCTGGGGCATGCAGGG - Intergenic
909600351 1:77455363-77455385 GCAGCTTGCTGGGGCAAGCTGGG - Intronic
909973993 1:82023782-82023804 GAAGCTGGAAGGGGCAAGGAAGG + Intergenic
910617662 1:89217532-89217554 GAAGCAGGCTGGGGGTAGGGTGG + Intergenic
912726976 1:112067362-112067384 GGAGCAGACTGTGGAAAGCATGG + Intergenic
913194590 1:116445084-116445106 GAAGCAGGCAGAGGCAAGAAAGG + Intergenic
913520732 1:119643621-119643643 GAAGAAGGCTGGGGAGAGGAAGG - Intronic
914512995 1:148351304-148351326 GAAGCAGGCAAGGGGCAGCAGGG - Intergenic
914716296 1:150257573-150257595 GGAGCAGGCAGGGTCAAGGAAGG - Exonic
914749596 1:150525412-150525434 GACCCAGGCTGGTGCAATCATGG - Intergenic
916684760 1:167134481-167134503 GAAGCAGACTGTGGCAAGCATGG + Intergenic
917059883 1:171025844-171025866 GAAACAGGCAGGGGCAACCCAGG + Intronic
917836015 1:178942114-178942136 GAAACAGGATGGGGAAGGCAAGG - Intergenic
918694312 1:187524309-187524331 GAAGCAGGGTGGGGCATGCTGGG - Intergenic
920037648 1:203076190-203076212 GAAGCAGGAAGGGGCAAGCCAGG - Intronic
920044932 1:203127033-203127055 GAAGCAGGCTCAGGGAAGCAAGG - Intronic
920059639 1:203218437-203218459 AAGGGAGGCTGGGGCCAGCAAGG - Intronic
920071228 1:203304698-203304720 GAAGACGGCTGGGGGAAGGAGGG + Intergenic
920763606 1:208809864-208809886 GAAGCTGGACGAGGCAAGCAAGG + Intergenic
920844973 1:209585979-209586001 GAAGCAGGCAGGGGACTGCACGG + Intronic
921161970 1:212479236-212479258 GGAGCAGGAAGGGGAAAGCAAGG + Intergenic
921935203 1:220789146-220789168 GAAGCTGGCTGGGGCCGTCAGGG + Intronic
922109143 1:222540361-222540383 GAAGCAGAATGAGGTAAGCAAGG + Intronic
922194590 1:223348986-223349008 CAAGCAGAGAGGGGCAAGCAAGG + Intronic
922528582 1:226325594-226325616 GGAGCAGCCTGGGGAGAGCATGG - Intergenic
922627526 1:227064602-227064624 GAAAGAGGCTGGGGCTAACATGG + Intronic
924776174 1:247115545-247115567 CAGGTAGGCGGGGGCAAGCAGGG - Intergenic
1063588313 10:7372889-7372911 GACACAGGCTAGGGCAGGCAGGG - Intronic
1064379924 10:14832373-14832395 GCAGCATGCTGGGGCATCCAGGG + Intronic
1065980186 10:30887271-30887293 GAAGGAGCCAGGGGAAAGCATGG - Intronic
1067753462 10:48986594-48986616 GCAGCAGGCTGGGGTGAGGATGG + Intergenic
1069740426 10:70683708-70683730 TGAGCAGGCTGGAGCAGGCAGGG - Intronic
1069936252 10:71919257-71919279 GCAGCAGGGTGGGGAAGGCAAGG + Intergenic
1070728039 10:78805296-78805318 GAAGCAGGCTTGGGGAAGGCGGG - Intergenic
1071776367 10:88792717-88792739 GATGGAGGCTAAGGCAAGCAAGG - Intergenic
1072717885 10:97763423-97763445 GAGGCAGGCTGGCAGAAGCATGG + Intergenic
1073044431 10:100628526-100628548 CCTGCAGGCTGGGGCAAGGAAGG - Intergenic
1073579225 10:104648915-104648937 GCAGCAGAGTGGGGCCAGCAGGG + Intronic
1074079757 10:110158171-110158193 AAGGCATTCTGGGGCAAGCAAGG + Intergenic
1074268655 10:111930659-111930681 GGAGCAGGATGGGGCAAGGGTGG + Intergenic
1075009386 10:118854550-118854572 GAAGCAGCCTGGGGTATGGATGG - Intergenic
1075303325 10:121345006-121345028 GAAGAAGGCTTGAGCAAGGAGGG - Intergenic
1076252523 10:128995621-128995643 GCAGGAGGCTGAGGCAAGCTTGG - Intergenic
1077488124 11:2848362-2848384 GAAGCCCCCTGGGCCAAGCAGGG - Exonic
1077630948 11:3810659-3810681 GGAGCAGGCTGGGACAAGCAGGG + Intronic
1077767656 11:5178440-5178462 GAAGTCGGCTGAGGCCAGCATGG + Exonic
1078396167 11:10984069-10984091 GAGCCAGACTGGGGAAAGCAGGG - Intergenic
1078417317 11:11176466-11176488 GAATCAGGCTGAGGGAAGGAAGG + Intergenic
1078437279 11:11335833-11335855 GAAGCTGGCTGAGGCAAGGAAGG + Intronic
1078876437 11:15403321-15403343 GATGCAGGATGGGGAAAGAAGGG + Intergenic
1079075057 11:17379985-17380007 GAAGCAGTCTGGGGAGAGCATGG - Intergenic
1080833625 11:35919334-35919356 GAAGCAGCCCAGGGCAAACAAGG - Intergenic
1081529368 11:43947464-43947486 GAGGCAGGCTGGGGCCGGCTGGG + Intergenic
1081600793 11:44492331-44492353 GAAGCATGCTGGGAGAAGCTGGG - Intergenic
1081694101 11:45097725-45097747 CAAGCAGGCTACGGAAAGCATGG + Intronic
1081834673 11:46143839-46143861 GAAGTGGGGTGGGGCCAGCAAGG - Intergenic
1081953929 11:47072204-47072226 GAAGCTGGCTGTGGCAGCCAAGG + Intronic
1082728703 11:56768852-56768874 GAAGCAGCCAGAGGCAATCAAGG + Intergenic
1083172518 11:60931392-60931414 GAAGCGGGCCCGGGCAGGCAGGG + Intronic
1083319822 11:61838777-61838799 GAGGCAGGAGGGGACAAGCATGG - Intronic
1083489536 11:63005742-63005764 GAAGCTGGCAGAGGCAAGGAAGG + Intronic
1083544391 11:63538004-63538026 GAGCCAGGCTGGGGCCATCAGGG + Intronic
1083592861 11:63905414-63905436 GAGCCAGGCTGGGGCCAGCAAGG + Intronic
1083593475 11:63908344-63908366 GCAGGAGGCTGTGGCAAGCCCGG - Intronic
1083654295 11:64221636-64221658 TAAATAGGCTGGGCCAAGCATGG + Intronic
1083682941 11:64359572-64359594 GAGGCAGGGCGGGGCAGGCAAGG - Intronic
1084316192 11:68347243-68347265 GAAGCAGGGTGGGAGAAACATGG + Intronic
1084364047 11:68686112-68686134 GACACAGGCTTGGGCAGGCAGGG - Intronic
1084434307 11:69129871-69129893 GAAGCTGGCAGGGGCAAGGAAGG + Intergenic
1084599646 11:70137331-70137353 GGGGCAGGCAGGGGCAGGCAGGG - Intronic
1084599650 11:70137341-70137363 GGGGCAGGCAGGGGCAGGCAGGG - Intronic
1084599654 11:70137351-70137373 GAGGCAGGCAGGGGCAGGCAGGG - Intronic
1084760489 11:71267773-71267795 TATGCAGGCTGGAGCCAGCAGGG + Intergenic
1085052520 11:73387231-73387253 GGGGCAGGCTGTGGCAGGCATGG - Intronic
1085123165 11:73980346-73980368 CCAGGTGGCTGGGGCAAGCAGGG + Intronic
1087036733 11:93763830-93763852 GAAGCTTTCTGGGGAAAGCAGGG + Intronic
1088222620 11:107585908-107585930 TAAGAAGGCTGTGGCCAGCATGG - Intergenic
1088332783 11:108670514-108670536 GGAGCAGCCCGGGGGAAGCATGG + Intronic
1088838698 11:113603733-113603755 GTAGCAGGGTGGGGAAAGAAAGG + Intergenic
1088848933 11:113690006-113690028 GAAGCAGGCGGGGCCCAGTAAGG - Intronic
1089177840 11:116561202-116561224 GAGGGAGGATGGGGCAGGCAGGG - Intergenic
1089258109 11:117204632-117204654 GAAGCGGGCTGGGGGTAGCCTGG + Exonic
1089628220 11:119765160-119765182 GAAGGAGGCTGGGGCCAGAGTGG - Intergenic
1090420289 11:126570641-126570663 GGAGCAGGCTGGAGAAGGCAGGG - Intronic
1090655800 11:128844221-128844243 GACCCAGGCAGGGGCAACCAAGG + Intronic
1091140347 11:133229078-133229100 GAAGCAGGCCAGGGCATGAAAGG + Intronic
1091317892 11:134628284-134628306 GAAACAGTATGGGGCAGGCAGGG - Intergenic
1092229622 12:6769350-6769372 GAAGCAGGAGCGGGCAACCAGGG - Intronic
1093137810 12:15473009-15473031 GAAGCAGTCTAGGGGAATCATGG - Intronic
1093368726 12:18338074-18338096 GAAGAAGTGTGGGGAAAGCAGGG - Intronic
1094288502 12:28819665-28819687 GGAGCAGGCTCAAGCAAGCATGG + Intergenic
1095960859 12:47833467-47833489 GAAGCAGCCTGGAGCCAGCGAGG + Intergenic
1096195818 12:49648183-49648205 CAAGACGGCTGAGGCAAGCACGG - Exonic
1096623057 12:52876548-52876570 CAAGCAGGCTGGGGCAGGTTGGG - Intergenic
1096786723 12:54021183-54021205 GCGGCCGGCTGGGGCAAGCAGGG - Intronic
1096840337 12:54375960-54375982 GAGGCAGGCTGGGGTGAGCCGGG + Intronic
1097705794 12:62866948-62866970 GAGGCAGGAGGGGGAAAGCATGG - Intronic
1098071354 12:66679109-66679131 GGAGGAGGCTGTGGCAGGCAGGG - Intronic
1098086806 12:66854258-66854280 GTTGCAGGATGGAGCAAGCAAGG + Intergenic
1098403671 12:70101215-70101237 GAAGAGGGTTGGGGAAAGCATGG + Intergenic
1098444283 12:70550388-70550410 GAGGCAGGCGGGAGAAAGCAGGG + Intronic
1098639343 12:72820825-72820847 GAAGCTGACTGGGCCACGCATGG - Intergenic
1100786121 12:98080364-98080386 GAAGCTGGAAGAGGCAAGCAAGG + Intergenic
1101515013 12:105426509-105426531 GGAGCAGGCTGGGGCAAGGTGGG + Intergenic
1101950122 12:109168074-109168096 GAAGGAGGCGAGGGCAGGCAAGG - Intronic
1102421665 12:112808193-112808215 GATGCAGGATGGGGCAGGGAAGG + Intronic
1103067690 12:117913664-117913686 GAAGCTGGAAGGGGCAAGGAAGG + Intronic
1103705301 12:122868047-122868069 GTTGCAGGCTGGGGCCGGCAGGG - Intronic
1103729251 12:123015647-123015669 GAAGAAAACTGGGGCAAACAAGG + Intronic
1104424971 12:128668753-128668775 GAAGCAAGCTGGAGAAGGCAAGG - Intronic
1105210570 13:18254544-18254566 GGACCAGGCTGGGCCAGGCAAGG - Intergenic
1106052346 13:26203557-26203579 GGAGCTGCCTGGGGGAAGCATGG - Intronic
1106230831 13:27820051-27820073 GAAACTGGCTGCGGCAAGCAAGG + Intergenic
1106557064 13:30818855-30818877 GAAGCTGGCTTAGGCATGCAAGG - Intergenic
1111317534 13:86582075-86582097 GATGCAGGCTGGGGGAAAGAAGG - Intergenic
1112219200 13:97470854-97470876 GAGGCAGGTTGGGGACAGCAGGG + Intergenic
1112726756 13:102313111-102313133 GAAAAAGGCAGGGCCAAGCAAGG + Intronic
1113743267 13:112725394-112725416 GAAGGAGGCTGGTGCATGCCCGG - Intronic
1113772426 13:112918564-112918586 GATGCAGCCTGGGGGATGCAGGG + Intronic
1115090700 14:29571114-29571136 GAGGCAGGCTGGGAAAAACAAGG + Intergenic
1117339458 14:54781175-54781197 GAAACAGGCTGGGGCATTCCAGG - Intronic
1117458830 14:55924893-55924915 AAAGCAGTCTGGGGCTAGCTTGG + Intergenic
1119367497 14:74106560-74106582 AAATCAGGCTGGGGTAGGCATGG - Intronic
1119429898 14:74559800-74559822 GGACCAGCCTGGGGCAAACATGG - Intronic
1120089492 14:80314438-80314460 TAAGCAAGCTGCTGCAAGCAAGG + Intronic
1121326304 14:93021797-93021819 CCAGCAGGCTGGGACAAGGATGG + Intronic
1121330676 14:93047595-93047617 GAAGCTGGCAGAGGCAAGGAAGG + Intronic
1122121860 14:99558774-99558796 GAAGCAGGAAGAGGCAAGGAAGG + Intronic
1122272120 14:100573064-100573086 GAGGCAGGGTGGGGCAGGAAAGG + Intronic
1122638513 14:103142437-103142459 GAGTCAGGCTGGGGGGAGCAGGG + Intergenic
1122677911 14:103432553-103432575 GAAGAAGGCTGAGGCAGGCCCGG + Intronic
1122687191 14:103514934-103514956 GAAGGAGGCCTGGGCAGGCAGGG + Intergenic
1122721842 14:103726659-103726681 CAAGCAGCCTGAGGCAGGCAGGG - Intronic
1122741156 14:103872204-103872226 GAAGGTGGCTGCGGCAGGCAAGG - Intergenic
1122869962 14:104633980-104634002 GAACCAGGCAGAGGCCAGCAAGG - Intergenic
1122959045 14:105086178-105086200 GAAACAGGCTGTGGGAAGCTGGG - Intergenic
1202930825 14_KI270725v1_random:31080-31102 GGCCCAGGCTGGGGCATGCAGGG - Intergenic
1124270692 15:28277854-28277876 GAGCCAGGGTGGGGCAAGCCTGG - Intronic
1125187775 15:36951839-36951861 GAAGCAGGAGGGGGAAAGGAGGG - Intronic
1128003476 15:64216409-64216431 GAAGCTGGCTGGGGCAAAAAGGG - Intronic
1128894931 15:71364231-71364253 GTAGCAGGCTGGGGCTCCCAGGG - Intronic
1129832038 15:78676929-78676951 GAAGCAGGCTGGGGGCTCCAGGG - Intronic
1130049071 15:80468247-80468269 GATGGAGGCTGGGACCAGCAGGG - Intronic
1130100396 15:80889329-80889351 GCACCAGGCTGGGGCATGGATGG - Intronic
1131623224 15:94089469-94089491 GAAGCAGGATGGGGCAGGTGGGG + Intergenic
1132720778 16:1314621-1314643 GAAGCAGGCTGGGCCTGGCCGGG + Intronic
1132728753 16:1350374-1350396 GGTGCAGGCTGGGGGCAGCACGG - Intronic
1133034376 16:3026818-3026840 GAAGGAGGCTGAGGCAAGTGGGG + Intronic
1133051799 16:3121101-3121123 GAGCCAGGCAGGGGCGAGCAGGG - Intergenic
1133390795 16:5408378-5408400 AAGGCAGGCTGGGGGCAGCATGG + Intergenic
1135649766 16:24195893-24195915 GAAGCAGGCAAGGGAAAACAAGG - Intronic
1135775865 16:25257442-25257464 GAAGCAGGCTGAGGAAAGGCTGG + Exonic
1136005259 16:27324911-27324933 AAAGCAGGCTGGGGAGAGCGGGG - Intronic
1136451972 16:30358616-30358638 GGAGCGGGCTGAGGCAGGCAGGG + Intronic
1136480132 16:30535953-30535975 GAAGCAGGTTGGGGTAAGAAAGG - Intronic
1136483991 16:30559405-30559427 GAAGCAGATTGGGGCAAGAAAGG - Intergenic
1138296006 16:55885683-55885705 GGAGCAGCCTGTGGGAAGCATGG + Intronic
1138299188 16:55912153-55912175 GAAGCAGGATTGGGCCACCAGGG + Intronic
1139432880 16:66920549-66920571 GAGGCAGCCTGGGGCAAGGTGGG - Intergenic
1140421969 16:74826849-74826871 GAAGCAGTTTAGGGAAAGCAAGG + Intergenic
1141157721 16:81609083-81609105 AAAGCAGACTGGGGCAGGCGTGG - Intronic
1141396384 16:83708732-83708754 GAAGGAGGCAGGGCCAAGCGCGG + Intronic
1141648617 16:85380481-85380503 GAAGCAGGGTGAGGCAAGGTGGG + Intergenic
1141985148 16:87575155-87575177 GGAGCAGGCAGGAGCAGGCAGGG - Intergenic
1142279128 16:89138532-89138554 GAAAGGGGCTGGGGCAAGCATGG - Intronic
1142412576 16:89923940-89923962 GGAGCAGGCTGGGGAAATCGGGG - Intronic
1142982622 17:3680561-3680583 GAAGCCGGGTGGAGGAAGCAGGG - Intronic
1143020988 17:3917128-3917150 GAAGCAGGCTCGGAGAGGCAAGG - Intergenic
1143650853 17:8263673-8263695 GAAGCGGGCTGGGGCTGGCAGGG - Intronic
1143683074 17:8492018-8492040 GATGCAGGCTGGAGCAGGGAGGG + Intronic
1143736859 17:8916969-8916991 GAAGCAGGCTGGGTCAGCCCAGG - Intronic
1143747226 17:9003450-9003472 GGAGCAGGCTGGGGCTCGCCGGG - Intergenic
1145015190 17:19391908-19391930 GAGGCATCCTGGGGCTAGCAAGG - Intergenic
1147407685 17:40224534-40224556 GAAGCAGGCTGGGCCGGGCGCGG - Intronic
1147424516 17:40339649-40339671 GAGGCAGAGTGTGGCAAGCAAGG - Intronic
1147448709 17:40490560-40490582 GGAGCGGGCTGGGGCAGGCTGGG - Intronic
1148334597 17:46832779-46832801 GAAGCTGGCAGGGGCTGGCAGGG + Intronic
1148461218 17:47840096-47840118 GAACCAGGCTGGGGGAGGGATGG + Intronic
1150272197 17:63873725-63873747 GAAACAGGTGGGGTCAAGCAGGG - Exonic
1150275746 17:63896622-63896644 GAAACAGGTGGGGTCAAGCAGGG - Exonic
1150769222 17:68027289-68027311 AAAGAAGGCTGGGCCAGGCACGG + Intergenic
1150918579 17:69460430-69460452 AGATGAGGCTGGGGCAAGCAAGG + Intronic
1151521273 17:74632106-74632128 GAAGGAGGCTGGGTCCTGCAGGG - Intergenic
1152162473 17:78677393-78677415 GCAGCAGGCAGGGCCAGGCAGGG - Intronic
1152576615 17:81143969-81143991 GAAGCATGCAGGGGCAACCCTGG - Intronic
1152872709 17:82766422-82766444 GCAGCAGGGTGGGGCAAGCAGGG - Intronic
1153891900 18:9524765-9524787 GAGGCAGGCTGTGGCAGGCAGGG - Intronic
1155251242 18:23955370-23955392 GTAGCAGGCTGGGGAAGGCTAGG - Intergenic
1155511734 18:26584754-26584776 GATGGAGGCTGAGGCAAGAAAGG + Intronic
1156498093 18:37538991-37539013 GCAGCAGGGTGGGGCAGGGAGGG - Intronic
1157187392 18:45552350-45552372 GAAGGAGCCTGGGGCTGGCAGGG - Intronic
1157513466 18:48294986-48295008 GAAGCAGGATGCCCCAAGCAGGG - Intronic
1158852270 18:61506779-61506801 GAGGCAGGCTGGGGCAGTCTGGG + Intronic
1158960955 18:62587361-62587383 GAGACAGGCAGGGGCAGGCAGGG + Intronic
1159905035 18:74082290-74082312 GAAGCTGGCTGAGGCGAGCCTGG + Intronic
1159928528 18:74290533-74290555 AAATGAGGCTGGGCCAAGCACGG - Intronic
1160894297 19:1395519-1395541 CAAGCAGGCTGGGGACAGGACGG - Exonic
1161433239 19:4246531-4246553 GAAGGAGGCTGGGGAAGGAATGG + Intergenic
1162720099 19:12657176-12657198 GCAGCAGGGTGGGGCTAGAAGGG - Intronic
1163022919 19:14493129-14493151 CCAGCATGCTGGGGCAAGCCTGG - Intronic
1163297151 19:16419818-16419840 CGAGCAGGCTGGGGCCCGCAGGG - Intronic
1163861809 19:19746900-19746922 GTGGCAGGCAGGGGCCAGCAGGG - Intergenic
1164791019 19:30980825-30980847 TAAGAAAGCAGGGGCAAGCATGG - Intergenic
1164877330 19:31700703-31700725 GAGGCAGGCTGGGCCATGCCTGG + Intergenic
1165013431 19:32864574-32864596 GAAGCATGCAGGGGCACGCCAGG - Intronic
1165407113 19:35637702-35637724 GAAGCACGCTGTGGGGAGCAGGG + Intergenic
1166631233 19:44409863-44409885 GAAGCTGGGTGAGGCTAGCATGG - Intergenic
1166632113 19:44415978-44416000 GAAGCTGGGTGAGGCTAGCATGG - Intergenic
1166636934 19:44458730-44458752 GAAGCTGGGTGAGGCTAGCATGG + Intergenic
1167038059 19:47005797-47005819 GAAGCAGTCAGGGGTAAGTAAGG - Intergenic
1167178470 19:47882979-47883001 GAAGCAGTCTGAGCCATGCAAGG + Intronic
1168524612 19:57078959-57078981 GGGACAGGATGGGGCAAGCAAGG - Intergenic
1168651682 19:58096253-58096275 CAAGCAGGCTGTGGCAGGAAAGG - Intronic
925047805 2:787888-787910 GAAGCAGGTTGAGGCAGGCCTGG + Intergenic
925230108 2:2225650-2225672 GGAGCAGGAGGAGGCAAGCAGGG - Intronic
925777414 2:7348503-7348525 GAAGCAGGCTGAGTTAACCATGG - Intergenic
926263074 2:11285344-11285366 CAAGGAGGCTGGTGAAAGCATGG - Intronic
927077036 2:19589028-19589050 GAAGAATGCTGGGGCAAGGCAGG - Intergenic
927511952 2:23649543-23649565 TGAGCAGGCTGGGGCAGCCAGGG - Intronic
927883858 2:26706725-26706747 GAAGCAGGCAGGGGACAGCAGGG - Intronic
928124416 2:28605872-28605894 GATGCAGTCTGGGGCAAAGAAGG - Exonic
929563358 2:42969433-42969455 CAAGGAGGCTGGTGCAAGCTGGG + Intergenic
929946884 2:46378378-46378400 GATACAGGCTGTGGCCAGCAGGG - Intronic
930151092 2:48060909-48060931 GAGGCAGGGTGGGGAAGGCAAGG + Intergenic
930636396 2:53810424-53810446 TAAGCAGGCTGGCTCAAGTATGG - Intronic
931571241 2:63671264-63671286 GGAGCAGCCTGTGGGAAGCATGG - Intronic
931612314 2:64115323-64115345 AAAGCAGGTTTTGGCAAGCATGG + Intronic
931890103 2:66662025-66662047 CAAGCAGGCTGGGCCAGGCTGGG + Intergenic
932340486 2:70960166-70960188 CAAGCAGGCAGGGGCTGGCAGGG + Intronic
932379645 2:71270339-71270361 GAAGCAGTCTGGGCCGGGCACGG - Intergenic
932422591 2:71610481-71610503 GAAGCAAGGTGGGGCAAGGGAGG - Intronic
932461222 2:71883174-71883196 GAAGCTGGCTGGGGGTGGCAGGG + Intergenic
932659698 2:73641530-73641552 GAAGGTGGCTGGGGCATGCTCGG + Exonic
932766854 2:74475938-74475960 GAACCAAGCTGGGGAGAGCAAGG - Intronic
933557719 2:83851277-83851299 CAGGCAGGCTGGGGCATGCCTGG - Intergenic
933970945 2:87469295-87469317 GGAGCTGGCTGGGGCAGGCAGGG - Intergenic
934149411 2:89131015-89131037 GAACCAGGCTGAGACAATCAGGG - Intergenic
934217883 2:90051026-90051048 GAACCAGGCTGAGACAATCAGGG + Intergenic
934925926 2:98381736-98381758 GAAGGAGGCTGGGGAAGGCCTGG + Intronic
935201557 2:100861155-100861177 GAGCCAGGCTGGGCCAGGCATGG - Intronic
935744863 2:106181421-106181443 AAAGAAAGCTGGGGCAAGCGGGG + Intronic
936322781 2:111480894-111480916 GGAGCCGGCTGGGGCAGGCAGGG + Intergenic
936482434 2:112897199-112897221 GAAGTAGGCTGTGGTAAGAAAGG + Intergenic
936561147 2:113541168-113541190 GGAGGAGGCTGGGGCAAGTGTGG + Intergenic
937150243 2:119681362-119681384 CAGGCAAGCTGGGGCCAGCAGGG - Exonic
937994845 2:127685549-127685571 GCAGAACGCTGGGGCAATCATGG - Intergenic
938077523 2:128347612-128347634 AAAGCAGGGTTGGCCAAGCAGGG + Intergenic
938182264 2:129193699-129193721 GAAGCTGGAAGGGGCAAGGAAGG + Intergenic
938596583 2:132793371-132793393 GGAGCAGGCAGGGGCAAAGATGG + Intronic
939766899 2:146261995-146262017 TAGGCAGGCTGGGGAATGCATGG - Intergenic
940358931 2:152776552-152776574 GGAGCAGGTTGAAGCAAGCAGGG - Intergenic
941099572 2:161281618-161281640 GAAGCTGGGTGAGGCTAGCATGG - Intergenic
944354277 2:198767095-198767117 GCAGTAGGGTGGGACAAGCAGGG + Intergenic
945632387 2:212296769-212296791 GGACCAGGGTGAGGCAAGCAAGG + Intronic
946029824 2:216694998-216695020 GCAACAGGTTGGGGGAAGCAGGG + Exonic
946093174 2:217248617-217248639 ATAGCAGGCTGGGGCAGCCACGG - Intergenic
946310966 2:218882445-218882467 GATGCTGGATGGGGCAGGCAGGG - Intronic
947492947 2:230611493-230611515 GAATCAGGTTGGGGCGAGTATGG - Intergenic
947620598 2:231588188-231588210 GAAGGAGGGTGGGGGAAGGAGGG + Intergenic
947623032 2:231603270-231603292 GATCCAGGCTGGGCCAACCAGGG - Intergenic
947633612 2:231668843-231668865 GAATCAGGATGGGGCAAGTTGGG - Intergenic
948056115 2:235010316-235010338 GAAGCAGGCTGGGCCCAGCACGG - Intronic
948243455 2:236457787-236457809 GAAGCTGGCAGAGGCAAGGAAGG + Intronic
948389832 2:237604127-237604149 GAACCAGGCTCTGGCCAGCACGG + Intergenic
948432796 2:237930731-237930753 CAGGCAGGCTGGGGCACACATGG + Intergenic
949007272 2:241656747-241656769 GAAGCAGGCTGGGGCCAGCACGG - Intronic
1169523728 20:6400747-6400769 GAAGCAGGCATGGGAAAGCAAGG - Intergenic
1170009961 20:11712167-11712189 GAAGCAGGATGGGGCAGGGGAGG - Intergenic
1170590284 20:17766147-17766169 GGAGCAGAGTGGGGTAAGCAGGG + Intergenic
1171291708 20:23986235-23986257 GGACCAGGCTGGGCCAGGCAAGG - Intronic
1171870610 20:30521510-30521532 GAAGCTGGGTGAGGCTAGCATGG + Intergenic
1172781674 20:37440179-37440201 GCAGCAGGTTGGGGAAGGCAGGG - Intergenic
1173476708 20:43364856-43364878 GAGTCAGGCTGGGGAAAGCTGGG - Intergenic
1174290912 20:49507862-49507884 GGGGCAGGCTGGGGCAGGCTGGG + Exonic
1174774897 20:53334485-53334507 GAAGCAGGATGGGGGAGGCAGGG + Intronic
1174794511 20:53510942-53510964 GACGCAGGCTGGGGCATGAGGGG - Intergenic
1175481971 20:59318222-59318244 GAAGCAGCCTGGGGCATGCACGG + Intronic
1175741555 20:61423140-61423162 GAAGCACAATGGGGGAAGCAAGG + Intronic
1175820385 20:61905982-61906004 AAAGCCGGCTGGAGGAAGCATGG - Intronic
1175919520 20:62444098-62444120 GACTCATGCTGGGGCAAGCTGGG + Intergenic
1176092857 20:63326615-63326637 GAAGGAGGCTGGGGCCAGCCAGG + Intronic
1176592845 21:8659703-8659725 GGCCCAGGCTGGGGCACGCAGGG - Intergenic
1176903937 21:14477290-14477312 GAAGCAGGCTTTGGCAAGTAGGG + Intergenic
1177009479 21:15714953-15714975 AAAGCAGTCTGGGTCTAGCATGG + Intergenic
1177207212 21:18023577-18023599 GAGCCTGGCTGGGGCAGGCACGG + Intronic
1177440897 21:21122629-21122651 GAAGCTGGCTGGGCCATGGATGG + Intronic
1178544169 21:33479626-33479648 GACGCGGGCAGGGGCAAGAAGGG + Intronic
1178692762 21:34763443-34763465 GGAGCAGGCAGGGGCAAGTGGGG + Intergenic
1178918508 21:36722984-36723006 GAATAAGGATGGGGGAAGCACGG + Intronic
1179980024 21:44890995-44891017 GGAGGAGGCTGGGGGCAGCAGGG + Intronic
1180052130 21:45336031-45336053 GAGGCTGGCTCGGGCCAGCAGGG + Intergenic
1180275698 22:10636845-10636867 GGCCCAGGCTGGGGCACGCAGGG - Intergenic
1180641746 22:17304464-17304486 GAAGCAGCCTGGAGGAAGGAAGG - Intergenic
1180646403 22:17342633-17342655 GCAGCAGGCAGGGGCCAGGAGGG + Intergenic
1180765684 22:18344858-18344880 GGACCAGGCTGGGCCAGGCAAGG + Intergenic
1180780625 22:18517521-18517543 GGACCAGGCTGGGCCAGGCAAGG - Intronic
1180813345 22:18774841-18774863 GGACCAGGCTGGGCCAGGCAAGG - Intergenic
1180859050 22:19066656-19066678 GAAGCTGGCTGAGGCATGGAGGG + Intronic
1181040855 22:20192016-20192038 GAAGCAGGCTGCGGCCATCCTGG + Intergenic
1181199520 22:21209158-21209180 GGACCAGGCTGGGCCAGGCAAGG - Intronic
1181400241 22:22646700-22646722 GGACCAGGCTGGGCCAGGCAAGG + Intronic
1181403754 22:22667480-22667502 GAACCTGGCTGGGGCAACCAGGG + Intergenic
1181466481 22:23113260-23113282 GAAGGATGCTGGGACCAGCAGGG - Intronic
1181649125 22:24249090-24249112 GGACCAGGCTGGGCCAGGCAAGG - Intergenic
1181702214 22:24627798-24627820 GGACCAGGCTGGGCCAGGCAAGG + Intronic
1181951750 22:26558724-26558746 GGAACAGGGTGAGGCAAGCAGGG + Intronic
1182049340 22:27300958-27300980 GAGCCAGGCTAGGGCAGGCAGGG - Intergenic
1182089558 22:27584776-27584798 GAAGCAGGCGGAGGCGAGGAGGG + Intergenic
1182102964 22:27670681-27670703 GAAGCAGGCTGGGGAAGGGGAGG - Intergenic
1183312150 22:37116070-37116092 TAAGCAGGGTGAGGCAGGCAGGG + Intergenic
1183688527 22:39375561-39375583 GGACGAGGCTGGGGCAAGGATGG - Intronic
1184129338 22:42508540-42508562 GAGGCTGGCTGGGGCCATCACGG + Intergenic
1184488075 22:44793261-44793283 GAAGCAGGGTGGGGGATGGAAGG + Intronic
1184601567 22:45546880-45546902 GAAGCAGGCAGGAGCAGGGATGG + Intronic
1184677968 22:46053828-46053850 GCAGCAGGGTGGGGCAAACGCGG + Exonic
1184683881 22:46087262-46087284 GCAGCAGGCGGTGGCAAGGAGGG + Intronic
1185118817 22:48953396-48953418 GGAACAGGCTGGGCCAAGAAAGG - Intergenic
1203227306 22_KI270731v1_random:85748-85770 GGACCAGGCTGGGCCAGGCAAGG + Intergenic
1203263447 22_KI270734v1_random:523-545 GGACCAGGCTGGGCCAGGCAAGG - Intergenic
950416682 3:12872918-12872940 GAAGCAGGCTGGGGCAAGCATGG + Intergenic
950668634 3:14512150-14512172 GAGGCAGGAAGGGGCAGGCATGG + Intronic
950886168 3:16364877-16364899 GAAACAGCGTGGGGCACGCAGGG + Intronic
950896669 3:16458267-16458289 AAAGCCAGCAGGGGCAAGCATGG + Intronic
952087697 3:29846409-29846431 GATGAAGGCTGGGGAAAGAATGG + Intronic
952928068 3:38336420-38336442 GAAGCAGGAAGAGGCAAGGAAGG - Intergenic
952974127 3:38679785-38679807 GGACCAGGGTGAGGCAAGCATGG - Intergenic
953030415 3:39176278-39176300 GAAGGAGGCTGCTGCAACCATGG - Intergenic
953481368 3:43255180-43255202 GAAGCAGGCTGGGGCAGGGAAGG - Intergenic
953800509 3:46019228-46019250 GAAGCAGCCTGGGACAAAGAAGG + Exonic
953981081 3:47413304-47413326 GGTGCAGGCTGGGCCAGGCAGGG - Exonic
954046365 3:47934584-47934606 AAAGCAGACTGGGCCAGGCACGG - Intronic
954611669 3:51947579-51947601 GGAGCAGGCCGGGACAAGGAGGG + Intronic
954991971 3:54849369-54849391 GAAGGAGGAGGGGGAAAGCAGGG - Intronic
955077127 3:55624417-55624439 GAACATGGCTGGGGCATGCAGGG + Intronic
956465585 3:69517692-69517714 GAGGCTGGGTGGGGCATGCAGGG - Intronic
956661385 3:71601743-71601765 GGAGAAGGCTGTGGGAAGCATGG + Intergenic
956785295 3:72637344-72637366 GAAGGAAGCTGGGTTAAGCATGG - Intergenic
960747657 3:120908121-120908143 GAAGCAGGGCGGGGCAAGCTAGG + Exonic
960795090 3:121477213-121477235 GAAGCTGAATGGGGCAAGGAGGG - Intronic
961356670 3:126343928-126343950 GGGGCAGGCAGGGGCAGGCAGGG - Intronic
961372491 3:126440127-126440149 TAGGCAAGCTGGGGCATGCAGGG - Intronic
961547456 3:127645146-127645168 GATGCATGCTGGAGCAAGGAAGG - Intronic
961639629 3:128357161-128357183 GGAGCTGGGTGGGGCAGGCAAGG + Intronic
961713326 3:128843251-128843273 GAAGCAGGCTGGGGACAGGCTGG - Intergenic
961835497 3:129655015-129655037 GAAGCAGGAACTGGCAAGCATGG - Exonic
961903978 3:130243346-130243368 GAAGCAGAGTGGAGCAAGGAGGG - Intergenic
966721315 3:183064900-183064922 GTGGCAGGATGGGGAAAGCAAGG - Intronic
966878707 3:184337838-184337860 GAACCAGGCTGGGGCCAGACAGG + Intronic
966984260 3:185165248-185165270 GGAGAAGGGTGTGGCAAGCAGGG - Intergenic
967978392 3:195048330-195048352 GAAGCAGGCAGGGGACAGCTTGG + Intergenic
968226557 3:196976028-196976050 GAACCCTGCTGGGGCAAGAAGGG + Intergenic
968552621 4:1231454-1231476 AGAGCAGGCTGGGGAAAGCTGGG + Intronic
968975835 4:3821664-3821686 GACACAGACTGGGGCAGGCACGG + Intergenic
969032384 4:4225665-4225687 GATGCAGGGTGGGGCAAAGAGGG - Intronic
969871487 4:10107609-10107631 GAAGGGGTCTGGGGCCAGCAAGG - Intronic
971201227 4:24511115-24511137 GAAGCAAACCGGGGCAAGCTTGG + Intergenic
971323026 4:25620687-25620709 GAAGAAGGCTGGGCCAGGCACGG - Intergenic
972737438 4:41857223-41857245 CATGCAGGCTGGAGCAGGCATGG + Intergenic
973381097 4:49321627-49321649 GAAGCTGGGTGAGGCTAGCATGG - Intergenic
975637568 4:76465371-76465393 GTAGCAGCCTGGGGTGAGCATGG - Intronic
975998266 4:80341064-80341086 GAAGCAGTCTGGGCCAGGCACGG - Intronic
976471202 4:85430852-85430874 GAAGCGGGGTGGGGAAAGGAAGG + Intergenic
976485273 4:85595041-85595063 AAAGTAGGCTGGGGTAAGCATGG - Intronic
977532261 4:98214267-98214289 GAAGCTGGGAGAGGCAAGCAAGG - Intergenic
977911548 4:102543088-102543110 AAAGCAGGCAGGGACAAGCTTGG - Intronic
978649206 4:110980255-110980277 CAAGCAGGCTGGGACAAGCAGGG - Intergenic
979200083 4:117967087-117967109 GAAGCTGGATGAGGCAAGGAAGG + Intergenic
979560541 4:122096710-122096732 GAAGCAGCCTGTGGGAAGCATGG + Intergenic
981488764 4:145317700-145317722 GAAGCAGGATGGGGCAGGGTGGG - Intergenic
982027170 4:151262517-151262539 GAAGCACACTGGGGAAGGCAAGG - Intronic
983295714 4:165866505-165866527 GAGGCAGGGTTGGGCCAGCAGGG - Intergenic
985018044 4:185657807-185657829 GAAGAAGGCTGAGGGAAGAATGG + Intronic
986054870 5:4126907-4126929 AATGCAGGCTGTGGCATGCATGG + Intergenic
986736137 5:10668760-10668782 GAGGCAGGCTGGGGCGATCATGG + Intergenic
987169616 5:15240582-15240604 GCAGAAGTCTGGGGCAAGGATGG + Intergenic
987179111 5:15347860-15347882 GAAGCTGGAAGAGGCAAGCAAGG + Intergenic
988229668 5:28459065-28459087 AAAGTAGGCTGGGGCAAGATAGG + Intergenic
988270144 5:29003358-29003380 CAAGAAGGCTGTGGCCAGCATGG + Intergenic
990060915 5:51647246-51647268 GCAGTAGGCTTGGGGAAGCAAGG - Intergenic
990676908 5:58196877-58196899 TAGGCAGGCTGGGGAAAGAAAGG + Intergenic
991612643 5:68465021-68465043 GAATCAGGCTTGGGAAAGAAGGG + Intergenic
992937163 5:81719732-81719754 GAAGGAGACAGGGGAAAGCATGG + Intronic
996057923 5:119000957-119000979 GAGGCAGGGTGGGGAAGGCAAGG + Intergenic
997363369 5:133309605-133309627 GCTGCAGACTGTGGCAAGCATGG + Intronic
997647984 5:135493756-135493778 CAAGCAGGCCAGGGCAGGCACGG + Intergenic
997989071 5:138528854-138528876 CAAGCAGACTGGGCCAGGCATGG + Intronic
998007257 5:138665319-138665341 GAGGCAGCCCTGGGCAAGCAAGG + Intronic
999211983 5:149897627-149897649 GAAGCATGGTGTGGCAATCACGG + Intronic
1000397102 5:160787467-160787489 GAAGCAGCCTGGGTCCAGCTAGG + Intronic
1001294107 5:170486786-170486808 AAAGCTGGCTGGGGCAGGCAGGG - Intronic
1002073708 5:176695952-176695974 GAAGCAGGATGGGGCCAGCCCGG + Intergenic
1002882830 6:1268000-1268022 GGAGGAGGCTGGGGAAAGCTAGG - Intergenic
1002995155 6:2275970-2275992 AAAACAGGCTGGGGCCAGCTTGG + Intergenic
1003483786 6:6556987-6557009 GTAGTAGGCTGGAGCAACCAGGG - Intergenic
1003484687 6:6565218-6565240 AAAGCTGGCTGGGGGAAGGAAGG - Intergenic
1003735918 6:8877597-8877619 AAAGCAGGCTGGAGAAAGAATGG - Intergenic
1004425813 6:15506283-15506305 GCAGCAGGCTTGGGCACTCAGGG + Intronic
1004989842 6:21124957-21124979 GTAGCATACTGGGGAAAGCATGG - Intronic
1005174379 6:23027238-23027260 GAAGCAGAGGAGGGCAAGCAAGG + Intergenic
1005854894 6:29853171-29853193 GGACCAGGCTGGAGCAAGCATGG - Intergenic
1005991054 6:30902383-30902405 GAAGCAGGTTTGGACAAGCAGGG - Intergenic
1006101043 6:31686637-31686659 TAAGCAGGAGGGGGCAACCATGG + Intergenic
1006720620 6:36147733-36147755 GAGGCAGGGAGGGGCCAGCAAGG - Intergenic
1006770823 6:36551163-36551185 GGACCAGGCTAAGGCAAGCAAGG - Intergenic
1007100530 6:39243200-39243222 GATGGAGGCTGGGGACAGCAGGG + Intergenic
1007276538 6:40678418-40678440 GAAGCAGCCGGGGAGAAGCATGG + Intergenic
1007278321 6:40691752-40691774 GAGGCAGGTTGGGGCCAGCTTGG - Intergenic
1007290533 6:40782856-40782878 GGACCAGGGTGAGGCAAGCAAGG - Intergenic
1007695914 6:43734225-43734247 GGGACAGGCTGGGGCAAGCCAGG + Intergenic
1007745100 6:44038840-44038862 GGAGCAGCCTGGGGCAAGAGGGG - Intergenic
1009981764 6:70734552-70734574 GCAGCAGGCTGTGGCCAGCACGG - Intronic
1010091724 6:71990677-71990699 GAAGCAGTCTGGGAAAAGCTGGG + Intronic
1011921570 6:92583464-92583486 GAGGCAGGCAGGGGAATGCAGGG + Intergenic
1012172075 6:96029359-96029381 GAAGCAGGGTGGGGACAGGAGGG + Intronic
1012926434 6:105272865-105272887 GAAGCAGGCAGGGGGAGGCACGG - Intergenic
1013481560 6:110557470-110557492 GAAGCAGGTCGGCCCAAGCATGG - Intergenic
1015353704 6:132252313-132252335 GAGGCAGGCTGGGGCATGCCCGG + Intergenic
1015926325 6:138313314-138313336 GAAGGAGGCTGGGACCAGGAGGG - Intronic
1016389141 6:143557703-143557725 GAAGGAGGGTGGGGTACGCAAGG - Intronic
1017645257 6:156534133-156534155 GGAGGAGGCTGGGGCAGGAAAGG - Intergenic
1018662832 6:166104323-166104345 GAAGAAGCCTGGGGATAGCATGG - Intergenic
1019177021 6:170165217-170165239 GGAGCAGGCGGTGGCCAGCAGGG - Intergenic
1019496206 7:1341689-1341711 GATCCAGGCAGGGGCAAGCAGGG + Intergenic
1019703799 7:2487990-2488012 GAAACAGTCTGGGGGAAGGAGGG + Intergenic
1019995435 7:4721383-4721405 GAAACAGGCTGGGGGTCGCAGGG - Intronic
1021850153 7:24800356-24800378 GAATGAGGATGGGGAAAGCAGGG - Intronic
1022201651 7:28123088-28123110 GAGGGAGGGTGGGGCATGCAGGG - Intronic
1022945836 7:35282581-35282603 GTAGCAGCCTGGGGGAAGCATGG + Intergenic
1023830821 7:44038178-44038200 GTAGGAGGCTAGGGCAAACAGGG - Intergenic
1024058698 7:45682639-45682661 GAAGGAGGATGGGGAAAACAGGG - Intronic
1024408400 7:49009762-49009784 GAAGCAGGAAGAGGCAAGGAAGG + Intergenic
1026177494 7:68010602-68010624 TAAGCTGGCTGGGGCACACATGG - Intergenic
1026518423 7:71093530-71093552 GAAGACGGCTGGGGGCAGCATGG + Intergenic
1026831224 7:73611400-73611422 GAAGTTGGCTGGGGCAGGAAGGG - Intronic
1027374559 7:77537259-77537281 GAAGGAGGATGGAGCAAGCTGGG + Exonic
1028165557 7:87534573-87534595 GAAGCAGGCTTGGGGGAGAATGG - Intronic
1029741157 7:102492494-102492516 GTAGGAGGCTAGGGCAAACAGGG - Intronic
1029759149 7:102591664-102591686 GTAGGAGGCTAGGGCAAACAGGG - Intronic
1030317861 7:108134735-108134757 AAAGCAGGCAGTGGCCAGCATGG - Intergenic
1030872480 7:114774392-114774414 GAGACAGGCAGGGGAAAGCATGG + Intergenic
1030892487 7:115016340-115016362 GAAGCAGTCTTGGCCAGGCACGG + Exonic
1031676590 7:124618635-124618657 GATGCAGGCTGGGGGAAAGAAGG - Intergenic
1031973299 7:128078777-128078799 GGAGCAGGGTGGGGCTAGGATGG + Intronic
1032115692 7:129115297-129115319 GAAACAGACTTGGGCCAGCATGG - Intergenic
1032201579 7:129826002-129826024 TGAGCAGGCAGGGGCGAGCAGGG - Intergenic
1032536252 7:132667084-132667106 GATGGAGGCTGGAGCAGGCATGG - Intronic
1033097300 7:138442494-138442516 GGAGCAGGCTGAAGCAAGAAAGG - Intergenic
1033457971 7:141519394-141519416 GAGGCAGGCTGAGGGAAACAGGG - Intergenic
1033540574 7:142352430-142352452 GGAGGAGGCTGGGGCATGAATGG + Intergenic
1033551841 7:142454738-142454760 GGAGGAGGCTGGGGCATGAATGG + Intergenic
1035769722 8:2137441-2137463 GAAGCAGGGTGGGGCCAGGCAGG + Intronic
1037358206 8:18045383-18045405 GCAGTAGGCTGGGGCAAGCAGGG + Intergenic
1037533338 8:19801560-19801582 CAAGCAGACTGGGCCAGGCATGG + Intergenic
1038938430 8:32277924-32277946 GGAGCAGCCTGTGGGAAGCATGG - Intronic
1040072030 8:43196375-43196397 GAGGCAGGGTGGGGGAGGCAGGG - Intronic
1040277678 8:46022251-46022273 CATGCAGCCTGGGTCAAGCAGGG + Intergenic
1041499867 8:58528939-58528961 GAAGCAGGATGGGGAAAGACTGG - Intergenic
1041977390 8:63815766-63815788 GCAGCAGGCTGGGGAGACCAGGG - Intergenic
1042009304 8:64222078-64222100 GAAGCAGGCTGTGGAGACCAAGG + Intergenic
1046148232 8:110189639-110189661 GATGCTGGCTGTGGCAGGCAGGG + Intergenic
1046752590 8:117941043-117941065 GAAGCAGGATGGGGCAGGGCAGG - Intronic
1047668205 8:127115731-127115753 GAAACAGTCTGGGCAAAGCAGGG - Intergenic
1047718243 8:127615569-127615591 GAAGAAGGCTGAGGCAAGATGGG - Intergenic
1048468784 8:134688889-134688911 GAAGCAGAGTGGGGAAACCATGG - Intronic
1048736223 8:137504904-137504926 GAATGAGGCTGGGGCAGGCGCGG - Intergenic
1049044731 8:140140462-140140484 CAAGCATACTGGGGAAAGCAAGG - Intronic
1049334603 8:142076522-142076544 GAAGGAGCCGGGGGCAGGCATGG - Intergenic
1049415228 8:142491975-142491997 GGAGCAGGCAGAGGCAGGCAGGG + Intronic
1049468686 8:142765366-142765388 GAAGCAGCCTTGGGCAAGGGTGG + Intronic
1049665159 8:143839707-143839729 GGAGCGGGCTGGGGCAGCCACGG - Intronic
1049891535 9:74165-74187 GGAGGAGGCTGGGGCAAGTGTGG - Intergenic
1052024666 9:23561232-23561254 GAGGGAGGCTGGGGGAAGAAGGG + Intergenic
1052861826 9:33442262-33442284 GAGGCAGGCTGGGGTGAGCTGGG + Intronic
1053375670 9:37604059-37604081 GAACTTGGCTGGGGCAGGCATGG + Intronic
1053692230 9:40592372-40592394 GGCCCAGGCTGGGGCACGCAGGG - Intergenic
1054272570 9:63045113-63045135 GGCCCAGGCTGGGGCACGCAGGG + Intergenic
1054303488 9:63393338-63393360 GGCCCAGGCTGGGGCACGCAGGG - Intergenic
1054402267 9:64719848-64719870 GACCCAGGCTGGGGCACGCAGGG - Intergenic
1054435870 9:65204163-65204185 GGCCCAGGCTGGGGCACGCAGGG - Intergenic
1054494522 9:65817524-65817546 GGCCCAGGCTGGGGCACGCAGGG + Intergenic
1055048183 9:71952651-71952673 AAGGCAGGCTGGGCCAGGCATGG - Intronic
1056983746 9:91341831-91341853 GATGGAGGCTGGGGGAAGCAGGG + Intronic
1057367556 9:94437343-94437365 GCAGCAGGGTGGGGAGAGCAGGG - Intronic
1057485208 9:95477473-95477495 GAGGCTGGCTGGGCCAAGCCTGG + Intronic
1057655772 9:96950710-96950732 GCAGCAGGGTGGGGAGAGCAGGG + Intronic
1057848947 9:98549680-98549702 GCTACAGACTGGGGCAAGCAGGG - Intronic
1058755605 9:108080357-108080379 GAAGCATGCTGGGCCAAACCCGG - Intergenic
1060108241 9:120888264-120888286 GAAGGAGGCTGGGCCAGGCGCGG - Intronic
1060545422 9:124456424-124456446 GAAGGAGGCTGGGGCAGGCAGGG + Intronic
1061685850 9:132277241-132277263 GATGTGGGCTGGGGCAAGTAAGG + Intronic
1062031682 9:134364765-134364787 GGGGCAGGCTGGGCAAAGCATGG - Intronic
1062372480 9:136247226-136247248 GGAGCAAGCTGGGGGAAGCGTGG + Intergenic
1062454067 9:136627536-136627558 GAAGCACGCTAGGACAGGCAGGG - Intergenic
1062578989 9:137221443-137221465 GAGGCAGGCGGGGGCAGGGAGGG + Intronic
1203568664 Un_KI270744v1:111830-111852 GAAGCTGGGTGAGGCTAGCATGG + Intergenic
1203622891 Un_KI270749v1:138509-138531 GGCCCAGGCTGGGGCATGCAGGG - Intergenic
1185845622 X:3435095-3435117 TAAGCAGGCAGGGTCAATCAGGG + Intergenic
1186278940 X:7971789-7971811 GAAGCAGGATGGGGCCAGTTAGG + Intergenic
1186464056 X:9770723-9770745 AAAGCAGGGTGAGGCAAGGAAGG - Intronic
1187039665 X:15580284-15580306 GAAGCAGGCTGGGACAAAGGAGG - Intronic
1187414771 X:19083652-19083674 GATGCACGCTGGGGAAAGAATGG + Intronic
1188555200 X:31404019-31404041 GAAGAAGGCTGGGGGTAGGAAGG - Intronic
1188897869 X:35692003-35692025 CAAGCATGCTGGAGCAAGCTAGG + Intergenic
1189216611 X:39330611-39330633 GAAGCAGGGAGGGCCAGGCATGG + Intergenic
1189501348 X:41562768-41562790 AAAGAAGGCTGGGCCAGGCATGG + Intronic
1190248756 X:48707156-48707178 GAAGAATGCTGGGGGAGGCAGGG - Intronic
1195829514 X:109040321-109040343 GAAAAGGGGTGGGGCAAGCAGGG + Intergenic
1197346052 X:125326683-125326705 GAAGAGGGTTGGGGCCAGCAGGG + Intergenic
1199474159 X:148227720-148227742 GAAGCTGGAAGGGGCAAGGAAGG - Intergenic
1199690662 X:150306747-150306769 GAATGAGGCAGGGGCTAGCAAGG + Intergenic
1199760623 X:150901646-150901668 GAGGCAGGCTTGGGCAAGAGTGG - Intergenic
1200063069 X:153492151-153492173 GGAGGAGGCAGGGGGAAGCAGGG - Intronic
1200818811 Y:7561269-7561291 TAAGCAGGCAGGGTCAATCAGGG - Intergenic
1200834549 Y:7720315-7720337 GAAACAGTGTGGGGCATGCAGGG + Intergenic