ID: 950416683

View in Genome Browser
Species Human (GRCh38)
Location 3:12872919-12872941
Sequence AAGCAGGCTGGGGCAAGCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 254}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950416677_950416683 5 Left 950416677 3:12872891-12872913 CCAACAAAGAGCAGGAACGGGAA 0: 1
1: 0
2: 0
3: 14
4: 207
Right 950416683 3:12872919-12872941 AAGCAGGCTGGGGCAAGCATGGG 0: 1
1: 0
2: 2
3: 27
4: 254
950416676_950416683 6 Left 950416676 3:12872890-12872912 CCCAACAAAGAGCAGGAACGGGA 0: 1
1: 0
2: 0
3: 14
4: 130
Right 950416683 3:12872919-12872941 AAGCAGGCTGGGGCAAGCATGGG 0: 1
1: 0
2: 2
3: 27
4: 254
950416670_950416683 29 Left 950416670 3:12872867-12872889 CCAGTCATATAAGATTCTCCTTC 0: 1
1: 1
2: 2
3: 9
4: 130
Right 950416683 3:12872919-12872941 AAGCAGGCTGGGGCAAGCATGGG 0: 1
1: 0
2: 2
3: 27
4: 254
950416674_950416683 7 Left 950416674 3:12872889-12872911 CCCCAACAAAGAGCAGGAACGGG 0: 1
1: 0
2: 0
3: 13
4: 105
Right 950416683 3:12872919-12872941 AAGCAGGCTGGGGCAAGCATGGG 0: 1
1: 0
2: 2
3: 27
4: 254
950416672_950416683 11 Left 950416672 3:12872885-12872907 CCTTCCCCAACAAAGAGCAGGAA 0: 1
1: 0
2: 3
3: 35
4: 303
Right 950416683 3:12872919-12872941 AAGCAGGCTGGGGCAAGCATGGG 0: 1
1: 0
2: 2
3: 27
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950416683 Original CRISPR AAGCAGGCTGGGGCAAGCAT GGG Intergenic
900255727 1:1697544-1697566 AAGCAGGGTGGGGCAGGTACAGG - Intronic
900332914 1:2145123-2145145 ACGCAGGCTGGTGCATGCGTTGG + Intronic
900589967 1:3455065-3455087 GAGCGGGCGGGGGCAAGCAGGGG - Intronic
900955323 1:5883169-5883191 AAGCAGGCTGGGGCGAGGAAGGG + Intronic
902990413 1:20183745-20183767 GAGCAGGGTGGGGCAGGCATGGG + Intergenic
903327743 1:22580879-22580901 AAGCAGCCTGGGGCAGGCTAGGG - Intronic
903498446 1:23788010-23788032 AAGCAGTCTGGGGAGAGCATGGG + Exonic
903716224 1:25369260-25369282 ATGCTGGGTGGGGCAAGCATTGG + Intronic
904210670 1:28885086-28885108 TATCAGGCTGGGGCAGGCACTGG + Intergenic
905097796 1:35489403-35489425 CAGTAAGCTGGGGCAATCATAGG - Intronic
906061496 1:42952057-42952079 GGGCAGGCAGGGGCAAGGATGGG + Intronic
906085980 1:43135224-43135246 AACCAGACTGGGGCAAGTGTTGG + Intergenic
906732084 1:48091485-48091507 CAGCAAGCTGGGGCAGTCATAGG + Intergenic
907387517 1:54135759-54135781 CAGGAGGCTGGGGCAGGCAGAGG + Intronic
912148851 1:106831225-106831247 AAGAAAGCTGGGACAAACATAGG + Intergenic
913194591 1:116445085-116445107 AAGCAGGCAGAGGCAAGAAAGGG + Intergenic
913526465 1:119698086-119698108 CAGTAAGCTGGGGCAATCATAGG + Intronic
915587530 1:156852250-156852272 AAACAGGGTGGGGCCAGCATTGG - Intronic
917048795 1:170894149-170894171 AGACAGTATGGGGCAAGCATAGG - Intergenic
918694311 1:187524308-187524330 AAGCAGGGTGGGGCATGCTGGGG - Intergenic
920044931 1:203127032-203127054 AAGCAGGCTCAGGGAAGCAAGGG - Intronic
920059638 1:203218436-203218458 AGGGAGGCTGGGGCCAGCAAGGG - Intronic
920347891 1:205318335-205318357 AAGCACACTGAGGCAAGCCTGGG + Intronic
921205629 1:212846240-212846262 AAGCAGGATTGGGGCAGCATGGG - Intronic
921305584 1:213793220-213793242 AAGGAGGCTGGAGCAAGCCCAGG - Intergenic
922400515 1:225249488-225249510 TAGAGGGCTGGGGCAATCATAGG - Intronic
924248386 1:242107047-242107069 AAGGGACCTGGGGCAAGCATGGG + Intronic
1063362618 10:5470178-5470200 AAGCATGCGTGGGCAACCATGGG + Intergenic
1063959179 10:11292759-11292781 TAGCAGGGTGGGGCAGGCAGCGG - Intronic
1065372731 10:25005732-25005754 AACCAGGCTGGGGGAAGAATTGG - Intronic
1065819377 10:29511088-29511110 AAGCAGGCTAGGGCTGGAATGGG - Intronic
1065953470 10:30673326-30673348 AAGCAGGCTAGGGCTGGAATGGG + Intergenic
1066383271 10:34919659-34919681 AAGCAGGCTGGGGCCAGACATGG + Intergenic
1069001927 10:63276577-63276599 CAGGAGGCTGAGGCAGGCATGGG + Intronic
1069740425 10:70683707-70683729 GAGCAGGCTGGAGCAGGCAGGGG - Intronic
1069816627 10:71200170-71200192 CAGTATGCTGGGGCAATCATAGG - Intergenic
1070811537 10:79300578-79300600 ACTCAGGCTGGGGGAATCATTGG + Intronic
1071387294 10:85134249-85134271 TAGAAGGCTGGGGGAAGCAGAGG - Intergenic
1075058584 10:119238426-119238448 AAGAAGGCTGGGGAGACCATTGG - Intronic
1075162584 10:120037611-120037633 AAGAAGGCTGGGGCCAGTATTGG - Intergenic
1076158038 10:128218478-128218500 GAGCACGGTGGTGCAAGCATTGG - Intergenic
1077179314 11:1205086-1205108 AAGGAGGCTGGGGCCAGTGTAGG + Intergenic
1077630949 11:3810660-3810682 GAGCAGGCTGGGACAAGCAGGGG + Intronic
1078307306 11:10202983-10203005 AAGTAAGCTGGGGCAATTATAGG - Intronic
1080465006 11:32488273-32488295 AAACAGGCTGGGGCCAGGAAAGG - Intergenic
1080661631 11:34301017-34301039 GAGGAGGCTGGGGGAAGCAGAGG + Intronic
1083235842 11:61350269-61350291 AAGAAGTCTGGGCCCAGCATTGG + Exonic
1083319821 11:61838776-61838798 AGGCAGGAGGGGACAAGCATGGG - Intronic
1084218898 11:67666025-67666047 GAGGAGGCTGGGGCCAGCAGTGG - Intronic
1084472705 11:69372462-69372484 AAGCAGGTGGGGGCAAGATTTGG - Intergenic
1084599653 11:70137350-70137372 AGGCAGGCAGGGGCAGGCAGGGG - Intronic
1084755708 11:71237311-71237333 AAACAGGCTGGGGCTAGAATTGG - Intronic
1087055763 11:93934453-93934475 CAGCAGTCTGGGGTAACCATAGG - Intergenic
1091162669 11:133439216-133439238 ACGCTGCCTGGGGCTAGCATAGG - Intronic
1091883199 12:3996527-3996549 AAGCAGGCAGGGACATGCAAAGG + Intergenic
1094306204 12:29022456-29022478 GAGCAGGTTGGGGAAAGCTTCGG - Intergenic
1095506265 12:42902284-42902306 CAGCAAGCTGGGGCAGACATAGG + Intergenic
1096174025 12:49499722-49499744 CAGCAAGTTGGGGCAATCATAGG + Intronic
1096195817 12:49648182-49648204 AAGACGGCTGAGGCAAGCACGGG - Exonic
1096786722 12:54021182-54021204 CGGCCGGCTGGGGCAAGCAGGGG - Intronic
1097158504 12:57029406-57029428 GAGCTGGGTGGGGCAAGCCTTGG - Intronic
1097705793 12:62866947-62866969 AGGCAGGAGGGGGAAAGCATGGG - Intronic
1098472155 12:70857855-70857877 AGTCAGGCTGGGGCAAGAAGAGG + Intronic
1099544785 12:83965037-83965059 AAGCAGTCTGGGAAGAGCATTGG - Intergenic
1100081583 12:90858574-90858596 GAGCAGGCTGGGGAAAACTTGGG - Intergenic
1100338599 12:93656448-93656470 AAGCAGGCTGTGGTAAGATTTGG + Intergenic
1101515014 12:105426510-105426532 GAGCAGGCTGGGGCAAGGTGGGG + Intergenic
1101538403 12:105641826-105641848 AGGCAGGCCAGGGCTAGCATAGG + Intergenic
1102404662 12:112662895-112662917 GACCAGGCTGGGGCAATCAGAGG + Intronic
1104034900 12:125091461-125091483 ATGCTGGCTGCGGCAAGCATTGG + Exonic
1104426216 12:128680383-128680405 CAGCAGGCTCAGGCAAGTATGGG + Intronic
1104668661 12:130665899-130665921 ATGCATGCTGGGGCACGTATGGG + Intronic
1104840727 12:131824092-131824114 AACCAGGCTGGGGCTGGCATAGG + Intergenic
1105448089 13:20474805-20474827 AAGGAGGCTGGGGCAAGTCCAGG - Intronic
1105531360 13:21223623-21223645 AAGCATGCTGGGGCAGGTGTGGG + Intergenic
1106946346 13:34831972-34831994 AAGCAGGTTGGTGCAAGCCCTGG + Intergenic
1107868102 13:44723207-44723229 TAGCAAGCTGGGGCAATCATAGG + Intergenic
1112817782 13:103293229-103293251 ATGCAGGCTGGGGCCAGGGTGGG - Intergenic
1113644992 13:111988397-111988419 AAGCACACTGGGGCAGGGATTGG - Intergenic
1115496775 14:34012599-34012621 AAGCAGGATGGGGCAGGAAGTGG + Intronic
1117043780 14:51791916-51791938 AAGAAGGCTGTGGCAAGAACTGG - Intergenic
1120853188 14:89189179-89189201 AGGAAGGCTGGGACAAGCAGAGG + Intronic
1121061941 14:90919251-90919273 CAGTAAGCTGGGGCAATCATAGG + Intronic
1123673744 15:22687908-22687930 CAGCAGGCTGAAGCAAGCAGAGG - Intergenic
1123739887 15:23226187-23226209 GAGCAGGCTGGGGCAGGGACAGG - Intergenic
1124291110 15:28455155-28455177 GAGCAGGCTGGGGCAGGGACAGG - Intergenic
1124325746 15:28760899-28760921 CAGCAGGCTGAAGCAAGCAGAGG - Intergenic
1126896047 15:53258254-53258276 AAGAAAGATGGGGTAAGCATTGG - Intergenic
1130406310 15:83605207-83605229 AAGCAGCCTGGGACAGGCACAGG - Intronic
1130408384 15:83623593-83623615 TCGCAGGCTGGGCCCAGCATCGG + Intergenic
1131109919 15:89758674-89758696 GAGCAAGCTGAGGCCAGCATGGG + Intergenic
1131506592 15:93025207-93025229 AAGCGGGTGGGGACAAGCATAGG + Exonic
1131878225 15:96833973-96833995 AAGAAGGATGGGGCATGCATTGG - Intergenic
1133390796 16:5408379-5408401 AGGCAGGCTGGGGGCAGCATGGG + Intergenic
1134877702 16:17716704-17716726 CAGCAGGCTGGGAGAAGCAATGG - Intergenic
1135775866 16:25257443-25257465 AAGCAGGCTGAGGAAAGGCTGGG + Exonic
1135924260 16:26678527-26678549 AAGCAGGAAGGGGCAAGGACAGG - Intergenic
1136480131 16:30535952-30535974 AAGCAGGTTGGGGTAAGAAAGGG - Intronic
1136483990 16:30559404-30559426 AAGCAGATTGGGGCAAGAAAGGG - Intergenic
1137544408 16:49390896-49390918 ATGAAGGTTGGGGCAATCATGGG + Intronic
1138190048 16:55007482-55007504 AAGCAGTATTGGGCAAGCTTTGG - Intergenic
1138209271 16:55149431-55149453 AACCAGGCTGGAGCCAGCCTTGG + Intergenic
1138251289 16:55503747-55503769 AAGCAGGCAGGGGCAGACAGTGG + Intronic
1139503883 16:67389467-67389489 ACTCAGCCTGGGCCAAGCATTGG - Intergenic
1140237947 16:73175409-73175431 AAGCAGGCAGGGGCCACCAGTGG - Intergenic
1140809969 16:78567609-78567631 TAGCAGGCTGCGGCGAGCTTGGG - Intronic
1140877874 16:79169744-79169766 AAGGAGGCTGTGGCAAGGTTGGG - Intronic
1141935177 16:87233735-87233757 AGGAAGGCTGAGGCAAGGATGGG + Intronic
1142253804 16:89004229-89004251 AAGCAGGCAGCGGGAAGCAGCGG + Intergenic
1143031519 17:3970575-3970597 AAGCAGGCTGGGGATTGCTTAGG - Intergenic
1143382416 17:6504524-6504546 AAGCAGGCAGGGGTAAACAATGG + Intronic
1143650852 17:8263672-8263694 AAGCGGGCTGGGGCTGGCAGGGG - Intronic
1143684655 17:8504206-8504228 AAGAAGGCTGGTGCACGCACTGG - Intronic
1145279619 17:21457958-21457980 CAGCAGGCAGGGGCAGGCACAGG + Intergenic
1145398260 17:22512534-22512556 CAGCAGGCAGGGGCAGGCACAGG - Intergenic
1145988130 17:29061239-29061261 AAGCAGACTGAGGAAAGCAGAGG + Intergenic
1146570456 17:33948211-33948233 AAGCAGGCTGGAGACAGCAGAGG - Intronic
1147964973 17:44189649-44189671 AAGGAGGCTGGTGCAGACATGGG + Intronic
1148013900 17:44507202-44507224 AGGCAGGCTGAGGCAAGAACAGG - Intergenic
1148109972 17:45138936-45138958 GGGCAGGCTGGGGCAAGCCCAGG - Intronic
1148873587 17:50673315-50673337 GAGCAGGCTGTGGCGAGCACAGG + Intronic
1150422359 17:65049593-65049615 AAGCATGCTAGGGAAAGCAAAGG + Intronic
1151175456 17:72284361-72284383 AAGCAGGATGGGGAAAGCCAAGG - Intergenic
1151953265 17:77366990-77367012 AAGCAGGCTGGGGGGATCACTGG + Intronic
1152576614 17:81143968-81143990 AAGCATGCAGGGGCAACCCTGGG - Intronic
1152577771 17:81150421-81150443 GAGTAGGATGGGGGAAGCATTGG - Intronic
1158475035 18:57772519-57772541 AAGCAGACTGAGGCAAGGCTGGG + Intronic
1160427764 18:78790157-78790179 AAGCAGGGTGGGGCCAAGATGGG - Intergenic
1161314721 19:3612519-3612541 AAACAGGCTGGGGCGAGCTAAGG + Intronic
1161433240 19:4246532-4246554 AAGGAGGCTGGGGAAGGAATGGG + Intergenic
1163022918 19:14493128-14493150 CAGCATGCTGGGGCAAGCCTGGG - Intronic
1163297150 19:16419817-16419839 GAGCAGGCTGGGGCCCGCAGGGG - Intronic
1164669712 19:30065480-30065502 AGGAAGGTTGGGGCAAGCCTCGG + Intergenic
1164791018 19:30980824-30980846 AAGAAAGCAGGGGCAAGCATGGG - Intergenic
1166393874 19:42424855-42424877 AAGCAGGCAGGGGGCAGCACTGG + Intronic
1167288973 19:48614387-48614409 AACCAGGCTGGGGGCAGCTTGGG - Intronic
1167618544 19:50549030-50549052 CAGCAGGCTGGGGCAGGCAGAGG + Intronic
1168651681 19:58096252-58096274 AAGCAGGCTGTGGCAGGAAAGGG - Intronic
1168703155 19:58453445-58453467 AAGCAGGCTAGAGCAAGCCCTGG - Intronic
927511951 2:23649542-23649564 GAGCAGGCTGGGGCAGCCAGGGG - Intronic
929563359 2:42969434-42969456 AAGGAGGCTGGTGCAAGCTGGGG + Intergenic
929881240 2:45839023-45839045 AAGCAGGCTGAGGCATACAGAGG + Intronic
930636395 2:53810423-53810445 AAGCAGGCTGGCTCAAGTATGGG - Intronic
931612315 2:64115324-64115346 AAGCAGGTTTTGGCAAGCATGGG + Intronic
931746647 2:65296866-65296888 TAGCAGGCTGGGCAAAGCACAGG + Intergenic
931890104 2:66662026-66662048 AAGCAGGCTGGGCCAGGCTGGGG + Intergenic
933856937 2:86423759-86423781 AAGTAAGCTGGGGTAATCATAGG - Intergenic
933981847 2:87556717-87556739 CAGGAGGCTGGGTCAGGCATGGG + Intergenic
934925927 2:98381737-98381759 AAGGAGGCTGGGGAAGGCCTGGG + Intronic
936311991 2:111394100-111394122 CAGGAGGCTGGGTCAGGCATGGG - Intergenic
937094436 2:119226214-119226236 AGGCAGGCTGGGGCAAGGGAAGG + Intronic
938070440 2:128305540-128305562 AAGGAGGCTGTGGCAAGGGTTGG + Intronic
938077524 2:128347613-128347635 AAGCAGGGTTGGCCAAGCAGGGG + Intergenic
939825637 2:147012099-147012121 AAGCAGGATGAGGCAAGAAATGG + Intergenic
941825858 2:169895696-169895718 GATCAGGCTGGGAAAAGCATGGG + Intronic
944614312 2:201444316-201444338 AAGCAGGCAGGGGCCAGACTAGG - Intronic
945051489 2:205828158-205828180 GAGCAGGCTGGGGCTAGCAGAGG + Intergenic
945691806 2:213045885-213045907 GAGCAGCCTGGGGCAAGAAAAGG + Intronic
946093173 2:217248616-217248638 TAGCAGGCTGGGGCAGCCACGGG - Intergenic
946266245 2:218544464-218544486 AAGCAGGCTTGAGAAAGAATTGG - Intronic
946419756 2:219558135-219558157 AGGGAGGCAAGGGCAAGCATGGG - Intronic
947325044 2:228964897-228964919 ATGCAGGCTGGTGCAAACAGAGG - Intronic
948056114 2:235010315-235010337 AAGCAGGCTGGGCCCAGCACGGG - Intronic
948134568 2:235627165-235627187 AAACAGCCTGGGGCCAGCACAGG - Intronic
948253399 2:236549260-236549282 GAGCAGGCTGGGGCTGGCAAAGG - Intergenic
948301374 2:236909624-236909646 CAGCAGGATGGGGCAGGTATGGG + Intergenic
948645939 2:239404599-239404621 AAGCAGGCAGGGACAAGGAGAGG + Intergenic
949007271 2:241656746-241656768 AAGCAGGCTGGGGCCAGCACGGG - Intronic
1169537814 20:6564754-6564776 AAGCAGGATGGGGCAAGGGAAGG - Intergenic
1173111673 20:40196787-40196809 AAGCAGCCTGAGGGAAGCCTGGG - Intergenic
1174506378 20:51020292-51020314 AAGCAGGCTTGGGGGAGCAGTGG + Intronic
1174641566 20:52049159-52049181 AAGCAGGCAGGGGAAATCCTAGG - Intergenic
1175304606 20:57967208-57967230 AGGCAGGCTGGGTCCAGAATTGG - Intergenic
1175481972 20:59318223-59318245 AAGCAGCCTGGGGCATGCACGGG + Intronic
1176138437 20:63535112-63535134 GGGCAGGCTGGGGCCAGCGTGGG - Intronic
1177412623 21:20750026-20750048 AACCAGGCTGGGGACAGTATGGG - Intergenic
1180594704 22:16965609-16965631 AGGCAAGCAGGGGCAGGCATGGG - Intronic
1181040856 22:20192017-20192039 AAGCAGGCTGCGGCCATCCTGGG + Intergenic
1182584271 22:31334816-31334838 AAGCAGGCTTTCGGAAGCATTGG + Intronic
1182638770 22:31750254-31750276 AGGGAGGCTGGGGCTAGCAGAGG - Intergenic
1183312151 22:37116071-37116093 AAGCAGGGTGAGGCAGGCAGGGG + Intergenic
949233042 3:1773983-1774005 CAGAAGGCTGGGGCAGCCATTGG - Intergenic
950416683 3:12872919-12872941 AAGCAGGCTGGGGCAAGCATGGG + Intergenic
950483582 3:13259731-13259753 AAGCAGGTGGAGGTAAGCATTGG - Intergenic
952087698 3:29846410-29846432 ATGAAGGCTGGGGAAAGAATGGG + Intronic
952112073 3:30135604-30135626 ATGAAGCCTGGGGCAAGCAATGG - Intergenic
952826639 3:37530110-37530132 AAGCAAGGTGGGGCAGGCAAAGG + Intronic
952843747 3:37669417-37669439 AACCAGGCTGGGGCAGGGACAGG - Intronic
952925517 3:38316765-38316787 AGGCAGGCAGGGGCAAGGAAAGG - Intronic
952972053 3:38657572-38657594 AAGCAGGCAGGGACAGGAATGGG + Intergenic
953030414 3:39176277-39176299 AAGGAGGCTGCTGCAACCATGGG - Intergenic
957350427 3:79017777-79017799 AAACAGGCGGTTGCAAGCATCGG - Intronic
957760487 3:84548885-84548907 CAGCAGTCTGTGGCAAGAATGGG + Intergenic
960379310 3:116939839-116939861 AACCAGGCTGGTGCAAGCAATGG - Intronic
960747658 3:120908122-120908144 AAGCAGGGCGGGGCAAGCTAGGG + Exonic
961450463 3:127000103-127000125 AAGCAGGGGGCGGCATGCATGGG + Intronic
961516020 3:127436899-127436921 AATCAGGATGGTGCATGCATTGG + Intergenic
961658455 3:128455981-128456003 GAGGAGGCTGGGGCAGGGATCGG + Intergenic
961713325 3:128843250-128843272 AAGCAGGCTGGGGACAGGCTGGG - Intergenic
962201381 3:133403600-133403622 GATCAGGCTGGAGCAAGCAGTGG + Intronic
963087571 3:141452575-141452597 AAGCAGGTTGGGACAAGAAGAGG + Intergenic
964913271 3:161808404-161808426 AAGCAGGCTGGGAAATGCAGAGG - Intergenic
966267268 3:178061533-178061555 AAGCATGGTGGGGACAGCATGGG - Intergenic
966801943 3:183772347-183772369 AAGCAGGCTGTGGCGATCAGTGG + Exonic
969586323 4:8096134-8096156 AAGGAAGCTGGGGCAATCACAGG + Intronic
969870694 4:10102742-10102764 ACGCAGGATGGTACAAGCATAGG + Intronic
970454305 4:16206987-16207009 AAGCAGGGTGTGACAAGCCTCGG + Intronic
972737439 4:41857224-41857246 ATGCAGGCTGGAGCAGGCATGGG + Intergenic
975809315 4:78149818-78149840 AAGCAGGCTGGTGAGAGCCTGGG + Intronic
977127459 4:93187907-93187929 AGGCACACTGGGTCAAGCATCGG + Intronic
978649205 4:110980254-110980276 AAGCAGGCTGGGACAAGCAGGGG - Intergenic
981190540 4:141857273-141857295 AGGCAGGTTGGGGCAAAGATAGG - Intergenic
983120928 4:163883840-163883862 ATGCAGGCTAGGGCAAGAAACGG - Intronic
984232547 4:177116091-177116113 AGGCAGGCTGTGGCTAGAATAGG + Intergenic
985766083 5:1780205-1780227 AGGGAAGCTGGGGCCAGCATCGG - Intergenic
986414488 5:7515054-7515076 AGGCAGGCTGCAGAAAGCATAGG - Intronic
989351478 5:40492345-40492367 AAGCAGGCTGGGGCCAGGCACGG + Intergenic
989408276 5:41086780-41086802 AAGTAAGCTTGGGCAATCATTGG + Intergenic
990676909 5:58196878-58196900 AGGCAGGCTGGGGAAAGAAAGGG + Intergenic
991226392 5:64277954-64277976 AAGAGGGCTGGGGAAAGTATTGG + Intronic
992073501 5:73170388-73170410 AAGCAGGCTGGGGGAACAAAAGG + Intergenic
993085905 5:83363533-83363555 AGGCAGGCTGGGAATAGCATCGG - Intergenic
994589680 5:101758288-101758310 AAGTAGGCTGAGGCAGCCATAGG - Intergenic
994818105 5:104611160-104611182 AAGCAGTTTGGGTCAAGAATGGG - Intergenic
998725169 5:145004286-145004308 AACAATGGTGGGGCAAGCATAGG - Intergenic
1003735917 6:8877596-8877618 AAGCAGGCTGGAGAAAGAATGGG - Intergenic
1004175346 6:13335149-13335171 AAGGAGCGTGGGCCAAGCATGGG + Intergenic
1006101044 6:31686638-31686660 AAGCAGGAGGGGGCAACCATGGG + Intergenic
1007278320 6:40691751-40691773 AGGCAGGTTGGGGCCAGCTTGGG - Intergenic
1007664948 6:43508575-43508597 ATCCAGGCTGGGGCAGGCAGAGG - Intronic
1008555474 6:52669688-52669710 GAGGAGGCTGGGGTAAGGATGGG + Intergenic
1009981763 6:70734551-70734573 CAGCAGGCTGTGGCCAGCACGGG - Intronic
1010355858 6:74932402-74932424 AAGCTGGCTGTGACAAGCAGAGG + Intergenic
1011805313 6:91065423-91065445 AAATAAGCTGGGGCAATCATAGG + Intergenic
1012412235 6:98971592-98971614 ATGTAGGCTGTTGCAAGCATAGG + Intergenic
1012926433 6:105272864-105272886 AAGCAGGCAGGGGGAGGCACGGG - Intergenic
1013402800 6:109815334-109815356 AAGCAGGGAGAGGCAGGCATGGG - Intronic
1013481162 6:110553892-110553914 CAGCAAGCTGGGGCAATCACAGG + Intergenic
1013481559 6:110557469-110557491 AAGCAGGTCGGCCCAAGCATGGG - Intergenic
1013798719 6:113915093-113915115 AAGTAAGCTGGAGCAATCATAGG + Intergenic
1014032605 6:116723072-116723094 AAGCAGGCTGGAGCAGGACTTGG + Intronic
1014314974 6:119852390-119852412 ATGCAGGAGGGGGGAAGCATTGG - Intergenic
1015137209 6:129886622-129886644 ACCCAGGCTGGTGCAATCATAGG - Intergenic
1018662831 6:166104322-166104344 AAGAAGCCTGGGGATAGCATGGG - Intergenic
1022326980 7:29341298-29341320 AACAAGGATGTGGCAAGCATGGG + Intronic
1023912988 7:44568532-44568554 AAACAGCCTGGGGCCACCATAGG - Intronic
1024460822 7:49657559-49657581 AAAGAGGCTGGGGTAAGGATGGG + Intergenic
1027134732 7:75616221-75616243 AAGCAGGCTGAGGCCAGGTTTGG - Intronic
1028076432 7:86521906-86521928 CAGTATGCTGGGGCAATCATAGG - Intergenic
1028501848 7:91527728-91527750 CAGCAGGTTGGGGCAGGGATAGG - Intergenic
1028647987 7:93119708-93119730 CAACAGGTTGGGGCAGGCATAGG - Intergenic
1030644660 7:112046770-112046792 GAGTAAGCTGGGGCAATCATAGG - Intronic
1031973300 7:128078778-128078800 GAGCAGGGTGGGGCTAGGATGGG + Intronic
1032419764 7:131768702-131768724 AAGAAAGCTGGGGCTAGCCTGGG - Intergenic
1033250315 7:139753012-139753034 AGGTAGGCTTGGGCAAGCACAGG + Intronic
1033540575 7:142352431-142352453 GAGGAGGCTGGGGCATGAATGGG + Intergenic
1033551842 7:142454739-142454761 GAGGAGGCTGGGGCATGAATGGG + Intergenic
1034948292 7:155278777-155278799 AAATAGGCTGGGGCAAGCTAAGG - Intergenic
1034964038 7:155380734-155380756 CAGCAGGCTGGGGCCAGGCTGGG - Intergenic
1036594756 8:10201476-10201498 AAGGAGGGTGGGGAAAGCAGTGG - Intronic
1037841965 8:22251238-22251260 AAGCAGGAAGGGGCAAGAGTGGG - Exonic
1041499866 8:58528938-58528960 AAGCAGGATGGGGAAAGACTGGG - Intergenic
1044717035 8:95109768-95109790 AAGCAGGCAGGGGCTAGTCTAGG - Intronic
1045726899 8:105185026-105185048 AAGCAGACTGGGCCAAGCAGAGG - Intronic
1048977220 8:139679884-139679906 ACCCAGGCTGAGGGAAGCATGGG - Intronic
1049468687 8:142765367-142765389 AAGCAGCCTTGGGCAAGGGTGGG + Intronic
1050920919 9:11199563-11199585 CAGCAGGCTGGGGGAAGCTCTGG + Intergenic
1051680851 9:19606501-19606523 AACTAGTCTGGGGCAAGCACTGG + Intronic
1052534151 9:29726538-29726560 AAGCAGGCTTGGCCAGGCTTGGG - Intergenic
1053141868 9:35687661-35687683 AAGCATTCTGGGGACAGCATTGG + Intronic
1055018283 9:71642802-71642824 AAGAAGGCTGGAGAAAGTATAGG + Intergenic
1057194941 9:93111613-93111635 AACCAGGCAGGGCCAAGCCTTGG + Intronic
1057485209 9:95477474-95477496 AGGCTGGCTGGGCCAAGCCTGGG + Intronic
1060889625 9:127179702-127179724 AAGCTGCCAGGGGCAAGGATGGG + Intronic
1062121473 9:134836224-134836246 AAGCAGCCTGGGGCCATCACTGG - Intronic
1062362590 9:136194683-136194705 ATGCAGGCTTGGGCAACCCTGGG - Intergenic
1062372481 9:136247227-136247249 GAGCAAGCTGGGGGAAGCGTGGG + Intergenic
1186214887 X:7289300-7289322 GAGCAGGCAGGGGCAAGGTTAGG + Intronic
1187414772 X:19083653-19083675 ATGCACGCTGGGGAAAGAATGGG + Intronic
1190298111 X:49040342-49040364 ACGCAGGCTGGTGAAAGAATGGG + Intronic
1193009169 X:76656924-76656946 AAGCAGCCAGGGGAAAGCACAGG + Intergenic
1198138602 X:133780066-133780088 AAGTAGGCTGGGGCGAGGCTGGG + Intronic
1198478437 X:137018098-137018120 AGGGAGGCTGGGGCCAGCCTGGG - Intergenic
1199760622 X:150901645-150901667 AGGCAGGCTTGGGCAAGAGTGGG - Intergenic