ID: 950416684

View in Genome Browser
Species Human (GRCh38)
Location 3:12872929-12872951
Sequence GGGCAAGCATGGGAGTGTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 240}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950416677_950416684 15 Left 950416677 3:12872891-12872913 CCAACAAAGAGCAGGAACGGGAA 0: 1
1: 0
2: 0
3: 14
4: 207
Right 950416684 3:12872929-12872951 GGGCAAGCATGGGAGTGTTGTGG 0: 1
1: 0
2: 1
3: 22
4: 240
950416676_950416684 16 Left 950416676 3:12872890-12872912 CCCAACAAAGAGCAGGAACGGGA 0: 1
1: 0
2: 0
3: 14
4: 130
Right 950416684 3:12872929-12872951 GGGCAAGCATGGGAGTGTTGTGG 0: 1
1: 0
2: 1
3: 22
4: 240
950416674_950416684 17 Left 950416674 3:12872889-12872911 CCCCAACAAAGAGCAGGAACGGG 0: 1
1: 0
2: 0
3: 13
4: 105
Right 950416684 3:12872929-12872951 GGGCAAGCATGGGAGTGTTGTGG 0: 1
1: 0
2: 1
3: 22
4: 240
950416672_950416684 21 Left 950416672 3:12872885-12872907 CCTTCCCCAACAAAGAGCAGGAA 0: 1
1: 0
2: 3
3: 35
4: 303
Right 950416684 3:12872929-12872951 GGGCAAGCATGGGAGTGTTGTGG 0: 1
1: 0
2: 1
3: 22
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950416684 Original CRISPR GGGCAAGCATGGGAGTGTTG TGG Intergenic
900891186 1:5450959-5450981 GGCACAGCATGGGGGTGTTGGGG + Intergenic
900966251 1:5960773-5960795 CAGCAGCCATGGGAGTGTTGGGG - Intronic
900977739 1:6027523-6027545 GGGCAGGCATGGGAATTTTTTGG + Intronic
901393445 1:8963366-8963388 GTGTTTGCATGGGAGTGTTGAGG - Intronic
901798954 1:11696192-11696214 TGGCAGGCATGGGTGTGGTGGGG - Intronic
904011291 1:27392042-27392064 GGGCAACCATGGCAGTGTCAGGG - Intergenic
906110702 1:43320106-43320128 AGGGAATCAAGGGAGTGTTGGGG - Intronic
906524235 1:46485304-46485326 GGGAAAGGCTGGGAGTATTGGGG + Intergenic
907964472 1:59315789-59315811 GGGGAACCATGGAAGTGTTTGGG + Intronic
908430104 1:64048416-64048438 GGGCAGGGATGGGAATGTTCTGG - Intronic
910544288 1:88396482-88396504 GGGCAAGAATTGGAGTGATGGGG + Intergenic
910644931 1:89504196-89504218 GGGCATGCATGGGAGCTCTGGGG - Intergenic
911081214 1:93933246-93933268 GGGTAAGAGTGGGAGTGTGGGGG + Intergenic
912502962 1:110134584-110134606 GTGTAAGCATGGGACTGTAGGGG + Intergenic
913165658 1:116182223-116182245 TGGCAAGCATGGGAGTGGGAGGG + Intergenic
915607402 1:156961367-156961389 GGGCAAGGCAGGGAGGGTTGGGG + Intronic
916311802 1:163406531-163406553 GGGCAAGCACAGGAGTGAAGAGG - Intergenic
916517558 1:165533588-165533610 GGGAAATCATGTGTGTGTTGAGG - Intergenic
917981248 1:180271117-180271139 GGGCTGGCAGGGGAGGGTTGAGG + Intronic
918098234 1:181351691-181351713 AGGCAGACATGGGAGTGATGTGG - Intergenic
918126980 1:181592776-181592798 GTGCATGCATGGGAGAGTTGGGG - Intronic
920091313 1:203455187-203455209 AGGCAAGCAGGGGTGTGGTGAGG - Intergenic
920254362 1:204644412-204644434 GGGCAGGCATGGGGCTGTCGGGG - Intronic
921193301 1:212728854-212728876 GGGCAAGACTGGGAGTGCTGGGG + Intronic
922145805 1:222943058-222943080 GGGCAAGGATGGCAGCATTGGGG - Exonic
922616399 1:226963499-226963521 GGACCATCATGGGAGTGATGGGG + Intronic
922662356 1:227441190-227441212 GGGAAAACATGGAAGTGTGGAGG + Intergenic
1063219782 10:3956293-3956315 GGGAAAGGCTGGGAGTGGTGGGG + Intergenic
1064543167 10:16425641-16425663 GTGCATGCATGGGTGTGTGGAGG - Intergenic
1066265719 10:33774135-33774157 GGGCCAGGATGGGGGTGTGGCGG - Intergenic
1069041852 10:63704069-63704091 GCGCAGGCTTGGGAGTGTAGAGG - Intergenic
1070104570 10:73419163-73419185 GGGGAAGGATGGGGGTATTGGGG - Intergenic
1073629801 10:105137071-105137093 GGGCAAGGCTGGGAGCATTGGGG - Intronic
1075076966 10:119358191-119358213 GGGCAAGGGTGGCAGTGTTTTGG + Intronic
1075451680 10:122556348-122556370 GGGAGAGGATGGGAGTGTTAGGG + Intergenic
1076075448 10:127530371-127530393 GGGCAAGGATGGGGCTGTTATGG + Intergenic
1077330330 11:1981366-1981388 GGGCAGGCATGGCTGTGTGGTGG + Intronic
1078000877 11:7494615-7494637 TGATAAGCATGGGAGTGTCGGGG + Intronic
1079129731 11:17740463-17740485 GAGCAGGCAGGGGAGTGTTGGGG + Intronic
1079760100 11:24318822-24318844 GGGCAGCCAAGGGAGTGTTTTGG - Intergenic
1081838789 11:46179793-46179815 GGGTAACCAAGGGAGTGTTGAGG - Intergenic
1081984095 11:47289150-47289172 GGGCAAGCATGGGCGTCACGGGG - Intronic
1084086248 11:66856664-66856686 GGGCATGTGTGGGTGTGTTGGGG + Intronic
1084154341 11:67305115-67305137 GGGCAGCCTGGGGAGTGTTGGGG + Intronic
1084496941 11:69510685-69510707 GGGCTAGCAAGGGCTTGTTGGGG - Intergenic
1085189796 11:74609419-74609441 GGCCAAGCATTGGAGTGCAGTGG + Intronic
1085662017 11:78376988-78377010 GGGCAAGCTTGAGAGAGTCGGGG - Intronic
1088449990 11:109971177-109971199 GGGCAGCCATGGGGATGTTGGGG - Intergenic
1088644236 11:111903869-111903891 GGGCAAGCATGGGAGGGTAATGG + Intergenic
1089380922 11:118030829-118030851 GGGCATCCATGGCAGTGTTAGGG + Intergenic
1202813309 11_KI270721v1_random:36545-36567 GGGCAGGCATGGCTGTGTGGTGG + Intergenic
1093216383 12:16366874-16366896 GGGCAATGATGGGAGTTTTGGGG + Intronic
1094224134 12:28026644-28026666 GGGCAAGGGTGGGGGTATTGAGG + Intergenic
1095424442 12:42060468-42060490 GGGCAGGTGTGGGAGTGGTGGGG - Intergenic
1095593721 12:43935961-43935983 GTGAAAGGATGGGAGTGGTGAGG + Intronic
1095945690 12:47752040-47752062 AGGCAAGAGTGGGAGTGATGGGG - Intronic
1096638765 12:52977671-52977693 GGGCAACCCTGGAATTGTTGAGG - Intergenic
1099615424 12:84928505-84928527 GGGCAATCATAGCAGTTTTGGGG + Intergenic
1100743176 12:97617611-97617633 GAGCCAGCATGGTAGTGCTGAGG - Intergenic
1102463135 12:113112519-113112541 GGGTGAGGAAGGGAGTGTTGCGG - Intronic
1103833728 12:123801893-123801915 GGGCAAGGATGGGAGGGAAGTGG - Intronic
1104541876 12:129673125-129673147 GGGAAAGCATGAGAGAGTTTTGG - Intronic
1106080714 13:26498342-26498364 GGGCTATCAAGGGAGAGTTGGGG - Intergenic
1107410383 13:40152626-40152648 GGGCAGGCATGGGTGTGGAGTGG - Intergenic
1107636202 13:42395067-42395089 AGCGAAGCATGGCAGTGTTGGGG + Intergenic
1112347278 13:98600615-98600637 GGGAAAGAATGGGGGAGTTGAGG + Intergenic
1112594779 13:100797621-100797643 GAGGAAACATGGGGGTGTTGGGG - Intergenic
1114150361 14:20031795-20031817 GGGCATGGGTGGGTGTGTTGGGG - Intergenic
1115072403 14:29340364-29340386 GATACAGCATGGGAGTGTTGTGG + Intergenic
1115289880 14:31757849-31757871 GGGTAAGCATGGTAGAGATGAGG - Intronic
1121558540 14:94857013-94857035 GGGCCAGAGTGGGAGTGGTGAGG + Intergenic
1122015081 14:98788446-98788468 TGGCATACATGGGAGTGATGGGG - Intergenic
1122211847 14:100178607-100178629 TGGGGAGCCTGGGAGTGTTGAGG + Intergenic
1122551603 14:102553012-102553034 GGGCAAGGCTGGGAGTGGGGAGG - Intergenic
1122967390 14:105137768-105137790 GGGCTAGGATGTGAGTCTTGGGG - Intergenic
1123404575 15:20012129-20012151 GGGCATGCATGGGAGGGGTGTGG + Intergenic
1123513908 15:21018776-21018798 GGGCATGCATGGGAGGGGTGTGG + Intergenic
1124167419 15:27340197-27340219 GTACAACCATGGGAGTGTTGTGG + Intronic
1124790322 15:32719873-32719895 GGGGGAGCATGAGAGTCTTGAGG + Intronic
1125355019 15:38808211-38808233 AGGCATGCAGGGGAGTGGTGGGG + Intergenic
1125585349 15:40815650-40815672 GGGCAGGCCTGGCAGTGCTGAGG + Exonic
1127604827 15:60576024-60576046 GGGGAAGGATGGGAGTGAAGAGG - Intronic
1130011546 15:80156463-80156485 GGGGAAGCATGGGATTGGTGTGG - Intronic
1130580746 15:85135062-85135084 GTGCAAGCATGGGAACGTTCTGG + Intronic
1130874437 15:88000263-88000285 GGGCCAGCATGACAGTGTTGAGG - Intronic
1131539092 15:93260996-93261018 GGGCATGCTAGGGAGTGCTGGGG + Intergenic
1132293820 15:100720550-100720572 GTGAGACCATGGGAGTGTTGGGG + Intergenic
1132710878 16:1266672-1266694 AGGCAGGGATGGGAGTGATGTGG + Intergenic
1133629791 16:7609245-7609267 GGGTATGGATGTGAGTGTTGTGG + Intronic
1134062685 16:11208532-11208554 GGGCAAGACTGGGAGAGTAGGGG + Intergenic
1136370688 16:29834121-29834143 GGGGAAGCAGGGGAAGGTTGAGG + Intronic
1137700090 16:50491262-50491284 GAGCAAGCACGGGAGAGGTGTGG + Intergenic
1138679111 16:58672268-58672290 GGGCAACCCTGGGAGGGTAGTGG + Intronic
1139442838 16:66977418-66977440 GGGCAGCCATGGGAGTGTAGCGG + Intergenic
1139672161 16:68499253-68499275 GGGTAAGCAATGTAGTGTTGTGG + Intergenic
1141314796 16:82951647-82951669 AGCCAAGCCTGGGAGAGTTGTGG - Intronic
1142742733 17:1940559-1940581 GGGGAGGCAGGGGTGTGTTGGGG + Intronic
1143724469 17:8835915-8835937 GGGCACCCATGGGAGAGGTGGGG - Intronic
1146603324 17:34236763-34236785 GAGCAACCATGGCAGAGTTGGGG - Intergenic
1146948982 17:36892740-36892762 GAGGGAGCAGGGGAGTGTTGAGG - Intergenic
1148781470 17:50124319-50124341 GGGCCAGCCTGGGGGTATTGAGG + Intronic
1150652680 17:67020069-67020091 GGGCAGGCATGGGAGCCTGGAGG + Intronic
1151585674 17:75006956-75006978 GAGGAAGAATGGGAGTGGTGAGG - Intergenic
1151847982 17:76671493-76671515 GGGCAAGCCTGGGAGCGTCAGGG + Intergenic
1152325611 17:79634147-79634169 TGGGAAGCATGGGAGAGGTGTGG - Intergenic
1152920843 17:83065888-83065910 GGGAACGCATGGGAGTGTGGGGG - Intergenic
1153540122 18:6144923-6144945 GTCCAAGGATGGCAGTGTTGTGG - Intronic
1153815039 18:8784285-8784307 GGGCAAGAAGGAGAGTGATGGGG + Exonic
1154079952 18:11246447-11246469 GGGCAGGCATGGGAGAGTAGGGG + Intergenic
1154172801 18:12063315-12063337 GGGCAGGCATTGGAGTATTTGGG + Intergenic
1159482961 18:69014583-69014605 GGGCAAGCATGTGTGTGTGTTGG + Intronic
1160774486 19:848711-848733 GGGCAGGCAGGGGAGGGATGTGG + Intergenic
1161839332 19:6669527-6669549 GGGTGTGCATGGCAGTGTTGGGG + Intronic
1161961946 19:7528043-7528065 GGGCAAGCGTGCGGGTGATGAGG + Intronic
1162534352 19:11254075-11254097 GGGCAGGGCTGGGTGTGTTGGGG - Intronic
1163561853 19:18023876-18023898 GGGGCAGCATGGGGGTGCTGAGG + Intergenic
1164433755 19:28210372-28210394 GGGCTTGCATGGCAGTGCTGAGG - Intergenic
1165255707 19:34576372-34576394 GGGGAAGCACGGGAAGGTTGAGG + Intergenic
1166217391 19:41344500-41344522 GGGCAAGGATGGGGCTGTTTTGG + Intronic
1166666055 19:44681054-44681076 GGGCAGGCCTGGGACTGTCGTGG + Intronic
1166745981 19:45142087-45142109 GGTCCAGCAGGGGCGTGTTGCGG - Exonic
1167168388 19:47814599-47814621 GTGCAAGCATGGGGGTCTGGAGG + Intronic
1167409535 19:49336894-49336916 GGCCAAGCCTGGGAGAGGTGAGG - Exonic
1167659989 19:50790721-50790743 GGGCAAGGGTGGGAGGGGTGGGG + Intronic
1167716648 19:51146615-51146637 GGGCAAGAATGGGAGGGAGGAGG - Intronic
925053417 2:834932-834954 GGGTGAGCCTGGGAGTGTTTAGG + Intergenic
925059237 2:878372-878394 GGGCATGCATGTGTGTGTAGTGG - Intergenic
927191211 2:20518273-20518295 AGACAAGGATGTGAGTGTTGTGG + Intergenic
927261630 2:21097381-21097403 CAGAAAGCCTGGGAGTGTTGAGG - Intergenic
928761473 2:34588176-34588198 GAGAAAGCATGGAAGTGTTAAGG - Intergenic
930978415 2:57492698-57492720 GATCAAACATGGGAGTCTTGAGG + Intergenic
931072989 2:58675245-58675267 GTGCAAGCACGTGTGTGTTGTGG + Intergenic
931918332 2:66983799-66983821 GGGAAAGCATTGGAGGCTTGTGG + Intergenic
934475084 2:94588293-94588315 GGGCCAGCATGGGTGGGGTGGGG + Intergenic
936544738 2:113381220-113381242 GTGCAAGAAAGGGAGTGTGGGGG - Intergenic
937615197 2:123913696-123913718 GGGCCAGCCTGGTAGTGGTGTGG - Intergenic
938289579 2:130142217-130142239 AGGCAAGCATGGGCGTCTTGCGG - Exonic
938466951 2:131530721-131530743 AGGCAAGCGTGGGCGTCTTGCGG + Exonic
941918410 2:170827170-170827192 GGGGATGCATGGGAGGGCTGCGG - Intronic
942117086 2:172738537-172738559 GGGCATGCCAGGGAGTGGTGTGG + Intronic
942801831 2:179884181-179884203 GGGCAGGGGTGGGAGTGTGGGGG + Intergenic
944207348 2:197170381-197170403 GGGAAAGAAAGGGAGTTTTGTGG - Intronic
944256173 2:197625601-197625623 GGGCAAGAGTGGAAGTGTGGTGG - Intronic
946149213 2:217752977-217752999 GGGCAGGCATGTGAGTGATTTGG - Intronic
947640028 2:231702048-231702070 GGGCAGGCCTGGGCGTGCTGAGG + Intergenic
948377638 2:237532195-237532217 GGGCATGGCTGGGAGTCTTGGGG - Intronic
948456219 2:238105841-238105863 AGGCAAGCATGGGAGGTCTGGGG - Intronic
1169960854 20:11158694-11158716 GTGCAAGCATTGGAGGTTTGTGG + Intergenic
1170470873 20:16666936-16666958 GGGCAAGGATGTGAGTGGTGGGG - Intergenic
1170796720 20:19553746-19553768 GGGCATGCATTGGAGTGTACAGG + Intronic
1171756581 20:29115294-29115316 GGGAAAGGCTGGGAGTGGTGGGG - Intergenic
1171862618 20:30414554-30414576 GGGAAAGGCTGGGAGTGGTGGGG - Intergenic
1171953472 20:31441449-31441471 GAGAGAGCATGGGAGTGTCGGGG + Intronic
1172509945 20:35493609-35493631 GGGAAAGCCTGGCTGTGTTGGGG - Intronic
1172843596 20:37916331-37916353 AGGCAAGCGCGGGAGTGTTCAGG - Intronic
1176232663 20:64040077-64040099 GGGCAAGTGTGGGAGGGATGAGG + Intronic
1178818681 21:35955117-35955139 TGTCAAGCATGGGAGTGCTATGG - Intronic
1179393042 21:41011205-41011227 GGGCAAGGCTGGGAGCGCTGAGG + Intergenic
1179981105 21:44896511-44896533 GGGCAGTCATGGGAGGGTTTGGG - Intronic
1181009052 22:20029584-20029606 GGCCAGGCTTGGGGGTGTTGAGG + Intronic
1182511879 22:30825804-30825826 GGGCAAGCAGGGGTGCTTTGAGG - Intronic
1185388086 22:50545693-50545715 GGGCCAGCAGGGGAGGGGTGGGG - Intergenic
949399965 3:3655978-3656000 GAGTAAGCAAGAGAGTGTTGGGG + Intergenic
950414944 3:12863791-12863813 GGGACAGGATGGGAGTGTTGTGG + Intronic
950416684 3:12872929-12872951 GGGCAAGCATGGGAGTGTTGTGG + Intergenic
950466025 3:13154122-13154144 GGGACAGGGTGGGAGTGTTGTGG - Intergenic
951109596 3:18786206-18786228 GAGCAAGCAAGGGAGTGCAGGGG - Intergenic
954035151 3:47847359-47847381 GGGCTAGCATGGGACAGATGGGG - Intronic
954847861 3:53575343-53575365 GGGCAGGAAGGGGAGTGGTGGGG + Intronic
955639329 3:61065571-61065593 GGACAAGCATGTTAGTTTTGGGG - Intronic
955890074 3:63640752-63640774 GGGGAAGCATGAGAGTGTCTGGG - Intergenic
960124033 3:113978199-113978221 GGGCAAGCATGAGATTGCAGCGG - Exonic
960224114 3:115148693-115148715 GGGCCAAGATGGGAGGGTTGGGG + Intergenic
961126597 3:124424180-124424202 GGGCAACCACAGGAGTGATGTGG - Intronic
961713324 3:128843240-128843262 GGGACAGGCTGGGAGTGTTGTGG - Intergenic
962264370 3:133934910-133934932 GGGCCAGCGTGGGAATGATGTGG - Intronic
962893374 3:139692459-139692481 GAGCAAGCATGGGAAAGGTGAGG + Intergenic
966264469 3:178022497-178022519 GACCAAGCATGGCAATGTTGTGG + Intergenic
967613549 3:191537407-191537429 GGCCATGCATTGGAATGTTGCGG - Intergenic
967993605 3:195150374-195150396 GGGCTCCCAGGGGAGTGTTGGGG - Intronic
969388672 4:6874403-6874425 GGGATGGCATGGGAGTGTGGTGG + Intronic
970143866 4:13012832-13012854 GGGCAAGCAAGAGAGAGGTGGGG - Intergenic
973216756 4:47677953-47677975 CTGCAAGGATGGGAGTGATGAGG - Exonic
973671906 4:53228273-53228295 GGGTAAAAATGGGAGTGGTGTGG + Intronic
973774946 4:54233721-54233743 GGAGAAGCAGGGGAGTGTGGAGG + Intronic
974077759 4:57183075-57183097 GGGTATGCATGGGATTATTGGGG + Intergenic
978007358 4:103633554-103633576 GGGGAAGAGTGGGAGGGTTGAGG - Intronic
980411181 4:132421603-132421625 GGTTAAGCATGGGAGTACTGAGG + Intergenic
980863737 4:138529760-138529782 TGGCATGCATGGGTGTGTGGTGG - Intergenic
981585660 4:146299649-146299671 GGGCAAGTGGGAGAGTGTTGGGG + Intronic
982243753 4:153327734-153327756 GGTCAAGCAGTGGAGTGCTGTGG - Intronic
985016917 4:185645858-185645880 GGACATGCAAGGGAGTATTGGGG + Intronic
985545581 5:507602-507624 GGGCAGGGATTGGGGTGTTGGGG - Intronic
985854310 5:2413100-2413122 GGGCAGGCAGGGGACTGTTGAGG - Intergenic
986051132 5:4091412-4091434 GGGCAAGTGTGGGAGGGGTGAGG + Intergenic
986112724 5:4735824-4735846 GAGGATGCATGGGAGTGTGGTGG - Intergenic
990168125 5:53017824-53017846 GGGCCAGCAAAGCAGTGTTGGGG + Intronic
991409657 5:66333491-66333513 GAGCAGGGATGGGAGTGTGGAGG - Intergenic
997618979 5:135272596-135272618 GGGCCTGCATGGGAGTGGCGGGG + Intronic
997662434 5:135599832-135599854 GGGCAAGCCTGGGAGTGCGAAGG - Intergenic
998704033 5:144738259-144738281 GTGCAAGCATTTGAGTCTTGGGG - Intergenic
999199299 5:149804713-149804735 GTGGAAGGATTGGAGTGTTGGGG + Intronic
1001775885 5:174328846-174328868 GGGCAAGCCTGGGCCTGTTTGGG + Intergenic
1002109291 5:176897480-176897502 AGGCAAGGAGGGGAGTGTAGGGG - Intronic
1003116086 6:3284730-3284752 GAGAAAGCCTGGGAGTGCTGGGG - Intronic
1007700947 6:43766292-43766314 GAGCATGCCTGGGGGTGTTGGGG + Intergenic
1008096016 6:47340228-47340250 GGGGAAGGATAGGAGTGGTGAGG + Intergenic
1009724970 6:67526799-67526821 GGGCTGGCCTGGGAGTGTGGGGG - Intergenic
1010323177 6:74537505-74537527 GGGCAATCTTGGGAGATTTGAGG - Intergenic
1012133124 6:95520334-95520356 GGGCGAGGTTGGGAGGGTTGGGG + Intergenic
1012861022 6:104559622-104559644 GTGCATGCATGGGAGGGCTGAGG - Intergenic
1014255965 6:119160118-119160140 AGGCAAGCATGGGGGTGTTGGGG + Intergenic
1015017143 6:128427357-128427379 AGGCAGGCAAGGGAGTGGTGTGG - Intronic
1016325910 6:142900815-142900837 GGGCAAGTCTTGGAGGGTTGAGG + Intronic
1018982676 6:168612674-168612696 AGGCAAGCAAGGGACTGTTCTGG - Intronic
1019356668 7:583629-583651 GTGCATGCATGTGAGTGTGGGGG - Intronic
1020330906 7:7016022-7016044 GGGCAAGCTTGGGAGCTATGAGG + Intergenic
1024049669 7:45610609-45610631 GGGAAAGAATGGGGGTGTGGAGG + Intronic
1024502611 7:50128304-50128326 GGCCAAGAAAGGGAGTGTGGAGG + Intronic
1027745049 7:82062370-82062392 AGGCAAGCATGGGAGGGGAGAGG - Intronic
1027984025 7:85262140-85262162 GGCCAAGAATGGGAGTAGTGGGG - Intergenic
1028420869 7:90631421-90631443 GGGGAAGTATGGTAGTGGTGGGG + Intronic
1032090952 7:128911373-128911395 GGCCAAGCCTGGGACTGCTGGGG - Intergenic
1035746292 8:1963902-1963924 GGGCAAGCCTGTGGGTGTCGAGG - Intergenic
1039415875 8:37393681-37393703 GGGCCACCATGGGAGGGGTGGGG + Intergenic
1039437196 8:37567684-37567706 GGGCCAGGGTGGGAGTGATGGGG + Intergenic
1039971252 8:42323444-42323466 GGGCAGGCCTGGCCGTGTTGTGG + Intronic
1040749009 8:50682742-50682764 GGGCATGCCTGAGGGTGTTGGGG - Intronic
1041371564 8:57166068-57166090 GAGCAAGCTTGACAGTGTTGTGG + Intergenic
1043400214 8:79877196-79877218 GATCAAGAATGTGAGTGTTGGGG - Intergenic
1047169289 8:122475343-122475365 GGGCAAGCCTGGCAGTGCTGTGG + Intergenic
1047953520 8:129955439-129955461 GCGGAAACGTGGGAGTGTTGTGG - Intronic
1049224706 8:141444690-141444712 GGGGCAGCAGGGGAGTCTTGAGG - Intergenic
1052854968 9:33401469-33401491 GGGCCAGCATGGGTGGGGTGGGG - Intronic
1053371713 9:37567075-37567097 GGGCAGGCAAGGGTGTTTTGAGG + Intronic
1053682988 9:40497798-40497820 GGGCCAGCATGGGTGGGGTGGGG - Intergenic
1053932970 9:43126112-43126134 GGGCCAGCATGGGTGGGGTGGGG - Intergenic
1054280726 9:63127130-63127152 GGGCCAGCATGGGTGGGGTGGGG + Intergenic
1054296088 9:63333298-63333320 GGGCCAGCATGGGTGGGGTGGGG - Intergenic
1054394104 9:64637793-64637815 GGGCCAGCATGGGTGGGGTGGGG - Intergenic
1054428754 9:65143006-65143028 GGGCCAGCATGGGTGGGGTGGGG - Intergenic
1054501626 9:65878537-65878559 GGGCCAGCATGGGTGGGGTGGGG + Intronic
1055654103 9:78436541-78436563 GGAGAAGCAGGGGTGTGTTGTGG + Intergenic
1057690748 9:97282153-97282175 GGGCAAGCAGGGGTGTGTGTAGG - Intergenic
1058065535 9:100544583-100544605 GGGCAAGCAGGGGAATGATATGG - Intronic
1059492036 9:114675989-114676011 GGGCCAGCAGGGGAGTGCTGTGG - Intergenic
1061034919 9:128108074-128108096 GGGCATGCTTGGGAGTGCAGGGG + Exonic
1061572359 9:131485629-131485651 GGGGAAGCGTGGGGGTTTTGAGG + Intronic
1061681244 9:132243413-132243435 GGGGCAGCTTGGGAGTGGTGAGG + Exonic
1202801918 9_KI270720v1_random:8045-8067 GGGAAAGGCTGGGAGTGGTGGGG + Intergenic
1203446473 Un_GL000219v1:61797-61819 GGGAAAGGCTGGGAGTGGTGAGG + Intergenic
1186673101 X:11787353-11787375 GGGCTGGCTTGGGAGTTTTGAGG - Intergenic
1188029957 X:25253222-25253244 GGGCAATCTTGGGAGTGGGGAGG + Intergenic
1188393535 X:29651617-29651639 TGGCTGGGATGGGAGTGTTGGGG + Intronic
1190624973 X:52328288-52328310 TAGCAAGCATGAGAGTGCTGGGG - Intergenic
1191608062 X:63083027-63083049 TGCCAGGCATAGGAGTGTTGAGG - Intergenic
1191841530 X:65516727-65516749 GGGCAAGGAGGGCTGTGTTGGGG - Intronic
1192203328 X:69081018-69081040 GGGAGAGCAGGGGAGGGTTGTGG - Intergenic
1196539772 X:116894057-116894079 GGGTAACCATGGGCTTGTTGAGG + Intergenic
1197305877 X:124841577-124841599 TGGCTAGCAGGTGAGTGTTGTGG + Intronic
1197729476 X:129797585-129797607 GGGCAAGAAAGGCAGTGCTGAGG + Intergenic
1198230084 X:134680789-134680811 GGGCAGACATGGTAGTGCTGGGG + Intronic
1198310889 X:135425171-135425193 GTGCATGCATGGGAGTGTGGGGG + Intergenic
1199891445 X:152086938-152086960 GGACAAGCAGGGGAGGGATGAGG - Intergenic