ID: 950416814

View in Genome Browser
Species Human (GRCh38)
Location 3:12873507-12873529
Sequence GTGGGGAGCAGGCCTGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 616
Summary {0: 1, 1: 2, 2: 6, 3: 71, 4: 536}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950416801_950416814 27 Left 950416801 3:12873457-12873479 CCTCCTTTTAGAGGAACATTCTT 0: 1
1: 0
2: 0
3: 18
4: 158
Right 950416814 3:12873507-12873529 GTGGGGAGCAGGCCTGAGAAGGG 0: 1
1: 2
2: 6
3: 71
4: 536
950416802_950416814 24 Left 950416802 3:12873460-12873482 CCTTTTAGAGGAACATTCTTCTT 0: 1
1: 0
2: 3
3: 27
4: 235
Right 950416814 3:12873507-12873529 GTGGGGAGCAGGCCTGAGAAGGG 0: 1
1: 2
2: 6
3: 71
4: 536

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950416814 Original CRISPR GTGGGGAGCAGGCCTGAGAA GGG Intergenic
900001721 1:18175-18197 GTGGGCAGCAGGGCAGAGACTGG + Intergenic
900021441 1:188698-188720 GTGGGCAGCAGGGCAGAGACTGG + Intergenic
900515751 1:3081472-3081494 GTGAGGAGCAGGGCTGAGGTGGG + Intronic
900525157 1:3124882-3124904 GTGGGAAGTAGGCTGGAGAAGGG + Intronic
900811138 1:4802122-4802144 GTGGGGAGCTGGCCTCCGCAGGG - Intergenic
901011008 1:6202036-6202058 GTGGGGAGTAGGGCTGAACATGG - Intronic
901701126 1:11045245-11045267 AGGGGAAGCAGGGCTGAGAAGGG + Intronic
901773474 1:11543198-11543220 GTGGAGAGGAGGCCTGTGGAAGG - Intergenic
901876303 1:12168730-12168752 GTGGGGAGCAGGGATGAGGGAGG - Intronic
902384266 1:16067482-16067504 GGAGGGAGCAGGTCTGAGAAGGG - Intronic
902392831 1:16116099-16116121 GTGGGGAGCAGGCCTCTGGTGGG + Intergenic
902507022 1:16945363-16945385 CTGGGGACCAGGCCTGAGGCAGG - Intronic
902575012 1:17372227-17372249 CTGCGGTGCAGGCCTGAGGATGG + Exonic
902598439 1:17524950-17524972 AATGGGAGCAGGCCTGAGCAGGG - Intergenic
902728039 1:18350274-18350296 GTGGGGAGCAGGAGTGAGGGTGG + Intronic
902981859 1:20129195-20129217 GAGGGGAGCAGGCAGAAGAAAGG - Intergenic
904371936 1:30053464-30053486 GTGGGGAGACCGCCTGAGGATGG + Intergenic
904397301 1:30230401-30230423 GTGGGGAGCAGAGCAGAGACAGG + Intergenic
904677503 1:32207316-32207338 ATGGGGAACAGGCCTGTGAGAGG + Exonic
904960172 1:34326506-34326528 GTGGGAAGCAGGCTGGAGAGAGG - Intergenic
905249721 1:36640091-36640113 GCAGGGAGCAGGCCAGAGAGAGG - Intergenic
906215555 1:44036172-44036194 GTGGGGAGCAGGCCGGAAGAGGG + Intergenic
906536948 1:46556325-46556347 CTGGGGAGGTGGGCTGAGAAAGG + Intergenic
906792456 1:48670716-48670738 GTAGGGAGCCTGCCTGAGGAAGG - Intronic
907479721 1:54737060-54737082 GGGGCCAGCAGGCCTGAGCAGGG - Intronic
907864865 1:58389957-58389979 ATGGGGGGCAGGCATAAGAAGGG + Intronic
909914734 1:81302995-81303017 CTGGGGAGCAGGTCACAGAAAGG - Intergenic
910354375 1:86339419-86339441 CTTGGGAGTGGGCCTGAGAAGGG - Intergenic
910561558 1:88597414-88597436 CTGGAGAGCAGGCATGGGAATGG + Intergenic
910596618 1:88987309-88987331 GTTGGGAGAGGGCCTGAAAAAGG + Intronic
911041564 1:93594897-93594919 GTTATGAGCAGGGCTGAGAAAGG - Intronic
911152832 1:94611418-94611440 GGGGAGAGCTGGTCTGAGAATGG + Intergenic
912680409 1:111725571-111725593 GTGGGGAGAAGGCCACGGAATGG + Exonic
912944123 1:114070449-114070471 CTGGAGAACAGGCATGAGAATGG - Intergenic
914751560 1:150538276-150538298 TTGGGCTGAAGGCCTGAGAAAGG - Intergenic
914860699 1:151383502-151383524 TTGGGAAGAAGGCCTGTGAATGG + Intergenic
915138178 1:153748775-153748797 GTGGGGTACAGGCCAGATAATGG + Intronic
915235003 1:154474103-154474125 GAGGGCACCTGGCCTGAGAAAGG - Intronic
915288206 1:154866176-154866198 GAGGGAAGAAGTCCTGAGAAGGG - Intronic
915317332 1:155036504-155036526 CTAGGGAGCAGGCCTGAGCTGGG - Intronic
916051580 1:161040155-161040177 GTGGCTAGCAGAACTGAGAAGGG + Intronic
916218250 1:162417392-162417414 AGAGGGAGCAGGACTGAGAAGGG + Intergenic
916562147 1:165942207-165942229 GCGGTAAGCAGGCCTGAGAATGG - Intergenic
916685168 1:167137668-167137690 GTGGGGAGCAGGGAGGGGAATGG + Intergenic
916724528 1:167510797-167510819 GTGGGGAGGAGGGCTCAGAATGG - Intronic
917965864 1:180178184-180178206 GTGGGGAGGGGGACTGGGAAGGG - Intronic
917981639 1:180273078-180273100 ATGGGGGGCAGGCCTCAGAAGGG + Intronic
919241508 1:194922233-194922255 CTGGAGAACAGGCATGAGAATGG + Intergenic
919837705 1:201587115-201587137 GTGGGAAGAAGGCTTGAGCATGG + Intergenic
922337889 1:224632551-224632573 GTAGGGGGCAGGTCTGGGAAGGG + Intronic
922440577 1:225652772-225652794 GTGGGGAGCAGCTCGGAGACGGG + Exonic
922988134 1:229882633-229882655 GTGGAGAGCATGCCAGAGGAGGG - Intergenic
923035360 1:230281421-230281443 GTGGAGTGCAGGCCAGAGCAGGG + Exonic
923678547 1:236100710-236100732 GTGGAGAGCTGGACTGAGACTGG + Intergenic
923867059 1:237950800-237950822 GAGTGGAGCAGGGCTGAGACTGG + Intergenic
923943955 1:238861753-238861775 GTTGGGAGCAGGCCCGAGCAAGG + Intergenic
923981427 1:239328362-239328384 GAGGACAGCAGGCTTGAGAAAGG - Intergenic
924368180 1:243319057-243319079 GAGGGGAGCAAGCCTCACAAGGG + Intronic
1063441466 10:6076607-6076629 ATAGGGAGCAGGTCTGAGAGGGG + Intergenic
1065327608 10:24563054-24563076 GTGGGGAGGAGGGATTAGAAAGG - Intergenic
1066271928 10:33832622-33832644 CTGGTTATCAGGCCTGAGAAAGG - Intergenic
1066281773 10:33924713-33924735 GTGGGGGGCAGGGCTGAGGTGGG - Intergenic
1066539803 10:36433741-36433763 GAGTGGAGTAGGTCTGAGAATGG + Intergenic
1067332852 10:45337946-45337968 CTGGAGAACAGGCATGAGAATGG + Intergenic
1067474493 10:46556812-46556834 GTGGGGACCCGGCCTGAGGAGGG - Intergenic
1067524712 10:47031320-47031342 TCGGGGAGCAGGCCTGAGCCAGG + Intergenic
1067922378 10:50472911-50472933 GTGGGGAGCAGGATAGAGGAAGG - Intronic
1068012926 10:51477217-51477239 CTGGGGAGCATCACTGAGAAAGG + Intronic
1069404799 10:68087728-68087750 GTGGGGAGCAGGGAGGGGAAGGG + Intergenic
1069720243 10:70545095-70545117 GTGGGGAGCAGGTGTGAAAGTGG + Intronic
1070288722 10:75101087-75101109 GTGGGGAGAAGGCCTGCAGAAGG + Intronic
1070656942 10:78278170-78278192 CTGTGGAGCAGGCCAGAGAGTGG - Intergenic
1070744443 10:78924572-78924594 GTGGGGAGCTGTCCTGTGTAGGG + Intergenic
1070789195 10:79179697-79179719 GTGTGGAGCAGGGCAGAGAGAGG - Intronic
1070819332 10:79345899-79345921 GAGGTGAGCAGGCCTGAGTGGGG - Intergenic
1070965785 10:80529463-80529485 GTGGGAAGCAGACCTCAGGAAGG + Exonic
1071464849 10:85929748-85929770 CTGGGGAGCAGGACTGGGAGTGG - Intronic
1073570359 10:104576180-104576202 GTGGGAACCAAGCCTGAGCAAGG - Intergenic
1074099859 10:110346296-110346318 GAGTGGAGCAGGCCTGTAAAAGG - Intergenic
1074421009 10:113309051-113309073 GTTGGGAGCAGGGGTGAGGAAGG + Intergenic
1074436580 10:113439518-113439540 GAGGGGACCAGGGCTGAGAAAGG - Intergenic
1074495473 10:113976562-113976584 GTGGGCATCAGACCTGAGGATGG + Intergenic
1074712078 10:116185697-116185719 GTGGGGAGCAGGACAGGGAGGGG - Intronic
1074992124 10:118718322-118718344 GTGGGGGGCAGGACAGGGAAGGG + Intronic
1075314014 10:121437764-121437786 GTGGGAGGTAGGCCAGAGAAGGG + Intergenic
1075513760 10:123093453-123093475 GTGGGGAGGGGGACCGAGAAGGG + Intergenic
1075905147 10:126074852-126074874 GTGGAAAGGAGCCCTGAGAAAGG - Intronic
1077014499 11:393732-393754 GTGGGGATGAGGCCTAGGAAGGG - Intronic
1077052133 11:571650-571672 GTGGGGGGCAGGGGTGGGAAGGG + Intergenic
1077105182 11:839117-839139 GTGGGGAGCAGACGTGGGAAGGG + Intronic
1077231071 11:1458445-1458467 GAGGGGGGCAGGGCTGGGAAGGG - Intronic
1077440576 11:2566939-2566961 GTGCTGAGCTGGCCTGAGAAGGG + Intronic
1077481083 11:2814976-2814998 GTGCAGAGCAGGCCTCAGAAGGG - Intronic
1077503136 11:2918165-2918187 GTGGGGCACAGGCCAGAGGAAGG - Intronic
1078096578 11:8301092-8301114 GTGCTGAGCAGGCCTGGAAATGG + Intergenic
1078178669 11:8990863-8990885 GTTGGGAGTGGGACTGAGAAGGG - Intronic
1078822678 11:14897789-14897811 GTCTGGAGCAGGCCTGAGGAGGG - Intergenic
1079359717 11:19760281-19760303 GTTGGGAGTGGGCCTGAGAATGG - Intronic
1080458334 11:32434532-32434554 CTGGGGAGGAGGCCGGAGAGTGG - Intronic
1080642125 11:34164218-34164240 GTGGGGACCAGGCCTGCCCAGGG - Intronic
1080760609 11:35245482-35245504 GAGGGGAGCAGGACAGGGAAGGG - Intergenic
1080785017 11:35467233-35467255 GTGGGAAGCTGGCCTGGGAAGGG - Intronic
1080932291 11:36824530-36824552 GAGGGGAGCAGGCCTCCCAATGG + Intergenic
1080976551 11:37349564-37349586 CTGGAGAGCAGGCATGGGAATGG + Intergenic
1081072492 11:38628821-38628843 CTGGAGAGCAGGCATGAGAATGG + Intergenic
1082960777 11:58916844-58916866 AGTGGGAGCAGGCTTGAGAAAGG + Intronic
1083221591 11:61256468-61256490 GTGAGTAGCAGGTCAGAGAAGGG + Intergenic
1083681880 11:64355114-64355136 GTAGGGAGGAGGTCAGAGAATGG - Intronic
1083778037 11:64903664-64903686 GGGGGGAACAGGGCTGAGAAGGG + Intronic
1084150909 11:67287560-67287582 GTGCGGAACAGGGCTGAGAGTGG + Intergenic
1084164577 11:67369495-67369517 GTGAGGAGCAGGGAGGAGAAAGG - Intronic
1084898546 11:72293241-72293263 GAGGTAAGCAGGCCTGAGACTGG + Exonic
1085017298 11:73183161-73183183 GTGGGGAGCAACCCTGAGCTGGG - Intergenic
1085178163 11:74508729-74508751 GTGGAGAACAGGCTTGAGGAAGG + Intronic
1085249187 11:75130945-75130967 GTGGAGAACAGGTGTGAGAATGG + Intronic
1085732295 11:79010299-79010321 GCGGGGAGAAGGGCTGTGAAGGG + Intronic
1087291165 11:96322269-96322291 GAGGGGAGGAAGCCTGAAAATGG + Intronic
1087626601 11:100603503-100603525 GGGTGGAGCCTGCCTGAGAAGGG + Intergenic
1088245057 11:107809840-107809862 GAGGGGAGCAGGCTTCAAAAAGG + Intronic
1088264849 11:107979259-107979281 GTGGAGAACAGGCATGGGAATGG + Intergenic
1089287576 11:117417516-117417538 GTGGGCAGCACGCCTGGGAGGGG + Intergenic
1089303739 11:117514150-117514172 GAGGGGTCCAGGCCTGGGAAGGG - Intronic
1089625576 11:119748814-119748836 GTGGTGAGAAGGACAGAGAAGGG + Intergenic
1089785082 11:120901888-120901910 GTGGGGTGCAGGCCGGACACTGG + Intronic
1090004470 11:122989461-122989483 GAGGACAGCAGGCCTTAGAAAGG - Intergenic
1090831167 11:130421810-130421832 GTGGGGATCAGGCCTGCGGCTGG + Intronic
1091329907 11:134724246-134724268 GTGGGAAGCAGGGCTGTGAATGG - Intergenic
1091374804 12:18297-18319 GTGGGCAGCAGGGCAGAGAATGG + Intergenic
1091831067 12:3551516-3551538 GTGGGGGACAGGGCTGAGCATGG + Intronic
1092196781 12:6554634-6554656 GTGGAGAGCAGGGCTGACAGGGG - Intronic
1092875284 12:12842385-12842407 CTGAGGAGCAGGCCTGGGGAAGG - Intergenic
1092910615 12:13141756-13141778 CTCAGGAGCAGGGCTGAGAATGG + Intronic
1093662682 12:21774964-21774986 GTAGGGAGCAGGCCAGAGGGAGG + Intronic
1096107172 12:49003092-49003114 GAGGGGAGCAGCCTTGAGAGTGG - Intronic
1096559235 12:52423994-52424016 GCTGGGAGCAGGCCTGGGAGAGG + Intergenic
1098305585 12:69099392-69099414 GTGAGGAGAGGGCCTGAGATGGG + Intergenic
1100611137 12:96193306-96193328 TTGGGGCGCAGGCCTGGGAAGGG + Intergenic
1100974554 12:100108923-100108945 GTGGGGAGCAGGGGTGGGAATGG + Intronic
1101072920 12:101095604-101095626 TTAGGGAGCATGTCTGAGAAGGG - Intronic
1103340044 12:120216330-120216352 GTGGGGTGCAGGAATGGGAAGGG + Intronic
1103647265 12:122404174-122404196 TTGGGGCGCAGGCCACAGAAGGG + Intronic
1104908697 12:132229218-132229240 GTGGGGAGAAGACCAGGGAACGG - Intronic
1105492668 13:20903148-20903170 GCGGTGTGCAGGGCTGAGAACGG - Intergenic
1105641407 13:22268845-22268867 GTGGGGAGCCAGACTGAGCAGGG + Intergenic
1105769917 13:23599523-23599545 GTGGGGAGCAGGTAGGGGAAGGG + Intronic
1108130376 13:47293001-47293023 GTAAGGAGCAGGGCTGAGAATGG + Intergenic
1110868155 13:80420467-80420489 GTGGGGAGAAGGGGGGAGAAGGG - Intergenic
1112639982 13:101262341-101262363 GTGGGCAGCGGGCCCCAGAATGG - Intronic
1114032378 14:18588289-18588311 GTGGACATCAGGCCTGAGAAGGG + Intergenic
1114076422 14:19163753-19163775 GTGGGCATCAGGCCTGATATTGG - Intergenic
1114077159 14:19167315-19167337 GTGGACATCAGGCCTGAGAAGGG + Intergenic
1114085005 14:19232249-19232271 GTGGACATCAGGCCTGAGAAGGG - Intergenic
1114085746 14:19235816-19235838 GTGGGCATCAGGCCTGATATTGG + Intergenic
1114533542 14:23409701-23409723 GTGGGGGGAAGGCCAGAGCAGGG - Intergenic
1114604565 14:23986357-23986379 GTGGGGTGCAGGCATGGGGAAGG + Intronic
1114615205 14:24064607-24064629 GTGGGGGGCAGCCCTGGGACAGG + Intronic
1115437818 14:33396080-33396102 GTGGGGAGGAAGCCTGAGAAAGG + Intronic
1117270319 14:54136878-54136900 TTGGGGAGCCTTCCTGAGAATGG - Intergenic
1118319911 14:64747032-64747054 GTGGGGAGCTGGCAACAGAATGG + Exonic
1118779631 14:68998579-68998601 GTGGAGAGAAGGTATGAGAAAGG + Intergenic
1119330277 14:73787947-73787969 GTAGGGTGGAGGCCTGAGAAGGG + Intronic
1119621704 14:76136542-76136564 CTGGGGAGAGGGGCTGAGAAGGG + Intergenic
1120840738 14:89082899-89082921 GGGGTTAGCAGGGCTGAGAAGGG + Intergenic
1121010434 14:90517166-90517188 GTGGGGAGCTGTCCTGTGTATGG + Intergenic
1121282520 14:92709601-92709623 GTGGGCAGCATGCATGAGCACGG - Intronic
1121508498 14:94494426-94494448 GTGAGCTGCAGGCTTGAGAAAGG + Intronic
1122235130 14:100327103-100327125 GTGCGGAGCAGGGCTGAGTGTGG + Intronic
1122273626 14:100579845-100579867 GAGGTGGCCAGGCCTGAGAAAGG - Intronic
1122324786 14:100875634-100875656 TTGGGGAGGAGGGGTGAGAAAGG - Intergenic
1122446400 14:101772858-101772880 CTGTGAAGCAGGTCTGAGAATGG - Intronic
1122624764 14:103078873-103078895 CTGGGGAGCAGGGCTGGGAGAGG + Intergenic
1122816833 14:104318214-104318236 GTGAGGAGGAGGCCTGGGATGGG - Intergenic
1122884031 14:104702645-104702667 CTGGGGAGACGGGCTGAGAATGG - Intronic
1123002160 14:105301338-105301360 GTGGAGAGACGGCCTGCGAAGGG + Exonic
1123697586 15:22890455-22890477 GTGGGGTGCACGCCTGGGCAGGG - Intronic
1125607584 15:40950156-40950178 GGTGGGAGGAGGTCTGAGAACGG + Intergenic
1125906272 15:43395757-43395779 ATGTGGAGCAGGCCTTAAAAGGG - Intronic
1126101707 15:45121892-45121914 GTGGGGAGAGGGCCCCAGAAAGG - Intronic
1127260474 15:57323373-57323395 GTGGGGAGCAGGCCTTGGCAGGG + Intergenic
1127319577 15:57829802-57829824 TTGGGGAACATGCCAGAGAAGGG - Intergenic
1127923595 15:63515850-63515872 GTGGACAGCAGGACTGAGAGTGG - Intronic
1128253767 15:66182210-66182232 ATGGGGAGCAGGCCCGTGGAGGG - Intronic
1128326242 15:66725952-66725974 GTGGGCAGGAGGACTGAGGAAGG - Intronic
1128419972 15:67482771-67482793 GTGGGAAACGGGCCTGAGTAGGG + Intronic
1128604382 15:69026228-69026250 GTGGGGATCAGGTCAGAGAGTGG - Intronic
1128983139 15:72200643-72200665 CTGGTGAGCAGACCTGAGATGGG + Exonic
1129653411 15:77507294-77507316 GTGGGGAGCAGGGAAGAGGAAGG - Intergenic
1130744018 15:86631180-86631202 CTTGGGACCAGGCCTGAGAAGGG + Intronic
1130787724 15:87118665-87118687 CTGGAGAGCAGGCGAGAGAAAGG - Intergenic
1130895624 15:88168407-88168429 CTGGGGATCAGGGCTGGGAAAGG + Intronic
1131051905 15:89353964-89353986 GGGGGAAGCAGGCCAGGGAAGGG + Intergenic
1131059726 15:89397299-89397321 ATGGGGAACAGGGCTGTGAATGG + Intergenic
1131073452 15:89480133-89480155 GTGGGGATCAGGTCTGATCATGG + Intronic
1131460175 15:92612276-92612298 GTGGAGAGGAGGCCGCAGAAGGG - Intergenic
1132451790 15:101972765-101972787 GTGGGCAGCAGGGCAGAGACTGG - Intergenic
1132455103 16:17864-17886 GTGGGCAGCAGGGCAGAGACTGG + Intronic
1132846615 16:2003750-2003772 GTGGTGAGCAGGACTGGGATGGG + Intronic
1132912964 16:2325142-2325164 GTGATGAGAAAGCCTGAGAAGGG - Intronic
1132945856 16:2531178-2531200 GTGGGGCGCTGGCCGGTGAATGG - Exonic
1135144650 16:19950651-19950673 GTGGGGAGAATGCCTGAGACAGG + Intergenic
1135183172 16:20292381-20292403 CTGGGGAGCAGGGGAGAGAATGG - Intergenic
1135544544 16:23356930-23356952 GTGGGAAGGAGGCCTGAGGATGG + Intronic
1135799361 16:25478351-25478373 GTGAGGAGCAGGATAGAGAAGGG + Intergenic
1135960988 16:26994393-26994415 GTGGGCAGTAGGTCTCAGAAAGG - Intergenic
1136245777 16:28975074-28975096 GAGGGGAGGAGGCTGGAGAAAGG - Exonic
1136372678 16:29846041-29846063 GTGGGCAGCAGGCCTGGGTGGGG + Intronic
1136540706 16:30926279-30926301 GTGAGGAAGAGGCCAGAGAAGGG - Intronic
1137666346 16:50251851-50251873 TGGGGGAGCAGGCCGGGGAAGGG - Intronic
1137713361 16:50582675-50582697 CTGGGCAGCAGGCCTGGGATGGG - Intronic
1138186624 16:54982376-54982398 GTGGAGGGCGGGGCTGAGAATGG - Intergenic
1138344141 16:56309510-56309532 GTGGGGACAAGGACAGAGAAGGG + Intronic
1138459198 16:57138068-57138090 GTGAGGAGCAGGGCTGAGTCAGG - Intronic
1139087252 16:63602474-63602496 TTGGGGAGCAGGGGTGAAAACGG + Intergenic
1139429057 16:66901321-66901343 CTGGGCAGCAGGGCTGGGAATGG + Intergenic
1139483060 16:67241279-67241301 ACTGGGAACAGGCCTGAGAAGGG + Intronic
1141295064 16:82760153-82760175 GTGTGGAGCAGCCCTGAAATAGG - Intronic
1141554229 16:84826560-84826582 GTGGGCAGCAGGCCTGGGGCAGG - Intronic
1141611695 16:85185293-85185315 GTGTGCAGCTGGGCTGAGAAGGG - Exonic
1141634178 16:85304977-85304999 GTGTTGGGCGGGCCTGAGAAGGG - Intergenic
1142155464 16:88530964-88530986 GTGGCGAGCAGGCCGCAGAGGGG + Intronic
1142482057 17:225190-225212 CTGGGGAGCAGGACAGAAAAAGG - Intronic
1142883351 17:2897659-2897681 GTGGGGAGCAAGTCTCAGGAGGG - Intronic
1143100653 17:4502973-4502995 GAGGGCAGCAGGCCTCAGAGCGG + Intronic
1143473658 17:7191371-7191393 AGGGAGAGCAGGCCTGAGACTGG + Intronic
1143542380 17:7577285-7577307 GAAGGGAGCAGGCCTCAGGAAGG + Intronic
1143723530 17:8830184-8830206 ATTGGAAGCAGCCCTGAGAAGGG - Intronic
1143789446 17:9281988-9282010 GTGGGGAGAAGGCCCCAGGAGGG - Intronic
1144578307 17:16443681-16443703 GTGGGGAGGAGGTCCGGGAAGGG - Exonic
1145056452 17:19706804-19706826 GTGGGGAGCAGGAATGAGGTGGG - Intronic
1145116486 17:20214976-20214998 ATGTGGGGCAGGCTTGAGAAGGG + Intronic
1145242902 17:21250037-21250059 GTGGGGACCAGGACAGAGCAGGG - Intronic
1146957841 17:36947143-36947165 GTAGGGACCAGGACAGAGAAGGG + Intergenic
1147244049 17:39109061-39109083 GTGGGGAGCAGGCATGCCCAGGG + Intronic
1147636292 17:41966621-41966643 GTGGGGAGCAGGCGCGCGCAGGG + Intergenic
1147704991 17:42420318-42420340 GAGGTCTGCAGGCCTGAGAAGGG - Intronic
1148211730 17:45812963-45812985 GTAGGGACAAGGCCTCAGAAGGG - Intronic
1148792406 17:50180791-50180813 GTGTGGAGCAGGCGTGAGCGTGG - Intergenic
1149645651 17:58239637-58239659 ATAGGGGGAAGGCCTGAGAAGGG - Intronic
1149706962 17:58703850-58703872 GGGTGGAGCAGGCCTGAGGTGGG + Intronic
1150438872 17:65175691-65175713 GTGGGGAGGAGGACAGGGAAAGG - Intronic
1150699905 17:67437619-67437641 TTGGGGTGCAGGCATGAGAGAGG + Intronic
1151682275 17:75628480-75628502 GAGGGGAGCAGGCCAGTGGAAGG - Intronic
1151826722 17:76527902-76527924 GTGGGGAGCTGGTCTGAGAAGGG + Exonic
1151834360 17:76573376-76573398 ATGGGGAGCAGCCATGAGGAGGG + Intronic
1151970543 17:77455362-77455384 CGGGGGCACAGGCCTGAGAAGGG - Intronic
1152140439 17:78533324-78533346 ATGGGGAGCAGGTCAGGGAATGG + Intronic
1152330035 17:79667452-79667474 GTGAGGAGCAGGCATGGGAATGG - Intergenic
1152569626 17:81116017-81116039 GTGGGGCGCAGGCCCCTGAAGGG + Intronic
1152748066 17:82050307-82050329 GTGGAAAGCTGGCTTGAGAAGGG - Intronic
1152749922 17:82057938-82057960 GTGGGGAGCAGGCCCCAGGCTGG - Exonic
1152820516 17:82435566-82435588 GTGGGGAGGAGGCCAGGGAGGGG - Intronic
1152938986 17:83155887-83155909 GTGAGGTGCAGGCCTGCGCACGG - Intergenic
1153953959 18:10080490-10080512 GTAAGGAGCAGGTCTGAGCAGGG + Intergenic
1154068169 18:11128845-11128867 CTGGAGAACAGGCCTGGGAATGG + Intronic
1155066929 18:22276124-22276146 GTGGTGCACAGGCCTGGGAAGGG - Intergenic
1155574054 18:27225832-27225854 CTTGGTACCAGGCCTGAGAAGGG - Intergenic
1157124177 18:44939230-44939252 GTGGGGACCGGGGCTGGGAAGGG - Intronic
1157333729 18:46722007-46722029 GTCGGGAGAAGGCCATAGAAGGG + Intronic
1157572860 18:48724444-48724466 GTTGGGAGCAGGACAGAGACAGG - Intronic
1157598558 18:48878632-48878654 GTGGGGAACAATACTGAGAAAGG + Intergenic
1157623306 18:49028315-49028337 GTGGGAAACAGGCCTGGGCATGG + Intergenic
1157909512 18:51602291-51602313 TTGGAGAACAGGCATGAGAAGGG - Intergenic
1158172633 18:54616732-54616754 GTTGCAAGCAGGCCTGAAAATGG - Intergenic
1158543078 18:58374460-58374482 GTGGGGAGGAGGCCGGGAAAGGG - Intronic
1159067877 18:63589798-63589820 CTGGGGAAAAGGACTGAGAAAGG + Intronic
1159605089 18:70466684-70466706 TTGGTGAGCAGGCCTGAGCTGGG + Intergenic
1159716682 18:71833092-71833114 ATGAGGACCAGACCTGAGAATGG - Intergenic
1160160543 18:76466901-76466923 GTGGGGAGCAAACATGGGAAGGG + Intronic
1160989379 19:1854305-1854327 GTGAGGAGGGGGCCTGAGACTGG - Exonic
1161091334 19:2361294-2361316 GTGGGGTGCAGGGCTGGGATGGG + Intergenic
1161235166 19:3194022-3194044 TGGGGGAGCAGGGCTGAGAAGGG + Intronic
1161342019 19:3748093-3748115 ATGGGGGGCAGGCCTGGGAAGGG + Intronic
1161601784 19:5188647-5188669 CTGGGAAGCAGCCCAGAGAAAGG - Intronic
1162178467 19:8849039-8849061 GTGAGGAGGAGGCGTGAGAATGG + Intronic
1162328910 19:10014994-10015016 GTGGGTAGCAGGCACGTGAATGG - Intronic
1163468547 19:17483796-17483818 GGTGGGAACAGGCCTGGGAATGG - Intronic
1163758191 19:19119490-19119512 GAGAGGAGCAGGACTGAGAGGGG - Intronic
1164706286 19:30322750-30322772 GTGGGCAGGAGGGCTGTGAATGG - Intronic
1165737061 19:38183513-38183535 GTGGGGAGCAGGCTTGGGGAAGG + Intronic
1165782127 19:38441022-38441044 GAGGGGTGGAGGTCTGAGAAGGG + Intronic
1165782531 19:38442578-38442600 GTGGGGGGCAGGGCAGAGAGAGG - Intronic
1165793878 19:38507435-38507457 GAGGAGAGAAGGGCTGAGAAGGG + Intronic
1165893401 19:39127833-39127855 ATGGGGAGGAGGGCTGGGAATGG + Intronic
1165897361 19:39150832-39150854 GTGGGCAGCAGGCCTGAACGGGG - Intronic
1166686708 19:44800705-44800727 GTGGGGACCAGGCCTGGGGACGG - Intergenic
1166689305 19:44813170-44813192 GTGGGGAGAACTCCTGAGAGAGG + Intronic
1166766007 19:45252254-45252276 ATGGGGACCAGGCCTGGGACGGG - Intronic
1167707553 19:51090531-51090553 GTGGGGAGGCTGCCTGAGGAGGG + Intergenic
1167904661 19:52649034-52649056 GTGGGGACCCGGCGGGAGAAGGG - Intronic
925190272 2:1876663-1876685 GTGGGGTGCAGGGCTGGGATGGG - Intronic
925212743 2:2064121-2064143 GAGGGGAGAAGCCCAGAGAAAGG + Intronic
926605876 2:14897968-14897990 GTGGGGAGCAATGCTGAGGAGGG + Intergenic
927025109 2:19059479-19059501 GTGGGGAGCATGCCTCAGGGTGG - Intergenic
929453157 2:42049417-42049439 CTGGGGAGCAGGCTAGAAAAAGG + Intronic
929552479 2:42903429-42903451 GTGGGGCACTGGCCTGAGCAGGG - Intergenic
929769513 2:44879893-44879915 GTGGGGAGAAGGAGTTAGAAAGG - Intergenic
929918544 2:46155783-46155805 GTGGGGAGAAGGATGGAGAAAGG - Intronic
930028738 2:47045479-47045501 GTGGGGAGTGGCCCTTAGAATGG - Intronic
931648183 2:64444379-64444401 GTGGGGAGCAGGAGAGAGCATGG + Intergenic
931673250 2:64668478-64668500 GTTGGGAGCAGACATGGGAATGG + Intronic
932304322 2:70691051-70691073 TTGGGGAGCAGGCACAAGAAAGG + Intronic
932475321 2:72002433-72002455 GTGGGGAGCGGGCCCGGGGAGGG - Intergenic
932598898 2:73111089-73111111 GCGGGGAGCAGGCCAGGGGATGG + Intronic
932615112 2:73226697-73226719 TTGGGAAGCAGGTGTGAGAAAGG - Exonic
933286306 2:80388009-80388031 GTGGGGAGCAGGCTCAAAAAAGG + Intronic
933737516 2:85507113-85507135 GTGGGGAGCGGGGCTGAGAGAGG + Intergenic
933785525 2:85838220-85838242 GATGGGAGCAGGCCTGAGAATGG + Intergenic
936152665 2:110030181-110030203 GAGGGGAGCAGGCGGGAGGAAGG + Intergenic
936192015 2:110341231-110341253 GAGGGGAGCAGGCGGGAGGAAGG - Intergenic
936568001 2:113595232-113595254 GTGGGCAGCAGGGCAGAGACTGG - Intergenic
936639252 2:114293630-114293652 GTGTTGAGAAAGCCTGAGAAGGG - Intergenic
937043552 2:118838701-118838723 CAGGGGAGCAGGGCAGAGAAGGG - Intergenic
937265161 2:120610762-120610784 GGGGTGAGCAGGCCTCAAAACGG + Intergenic
937312399 2:120910229-120910251 GTGGTCAGCAGGCCTGAGCCAGG + Intronic
937333937 2:121049148-121049170 ATGTGGAGAAGGCCAGAGAATGG + Intergenic
937910763 2:127074436-127074458 GTGTGGAGCAGTCCTGAGCTGGG - Intronic
938083242 2:128381298-128381320 CTGGAGACCAGGCCTGAGGAGGG + Intergenic
938491018 2:131761268-131761290 GTGGGCATCAGGCCTGATATTGG - Intronic
938611142 2:132948775-132948797 GTGGGGAAAAGGCAAGAGAAGGG - Intronic
938721551 2:134071531-134071553 GTGAGGGGCAGCCCTGAGACAGG + Intergenic
941936645 2:170986939-170986961 TTGGGGGGTGGGCCTGAGAATGG - Intergenic
941963880 2:171281302-171281324 GTAGGGATCAGGCCTGAGGGTGG + Intergenic
943060550 2:183038170-183038192 GAGGGGAGGAGGCCCGAGAGAGG - Exonic
944595281 2:201255492-201255514 CTGAGGAGCAGTACTGAGAATGG - Intronic
944933414 2:204544058-204544080 GAAGAGAGCTGGCCTGAGAATGG + Intergenic
945256811 2:207810049-207810071 ATGTGGAGCAGGAATGAGAATGG + Intergenic
945569034 2:211441047-211441069 GAGAGGAGCAAGCCTGAGGAAGG - Intronic
946056646 2:216908624-216908646 GTGTTGAGGAGGCTTGAGAAAGG - Intergenic
946161825 2:217840208-217840230 GTGTAGGGCAGGCCTGAGCATGG + Intronic
946326390 2:218986604-218986626 GGGTGGAGGAGGCCTGGGAATGG + Intergenic
946393229 2:219429178-219429200 ATGTGGGGCAGGGCTGAGAAGGG - Intergenic
947732105 2:232436979-232437001 GTGGGGAGCAGGGAGGAGAGAGG + Intergenic
948173943 2:235928590-235928612 GAGGAGAGCAGGGCGGAGAAGGG + Intronic
948376151 2:237521804-237521826 GAGCGGAGCAGGGCTGAGACTGG + Intronic
948376162 2:237521865-237521887 GAGTGGAGCAGGGCTGAGACTGG + Intronic
948376171 2:237521926-237521948 GAGCGGAGCAGGGCTGAGACTGG + Intronic
948376192 2:237522048-237522070 GAGCGGAGCAGGGCTGAGACTGG + Intronic
948376203 2:237522109-237522131 GAGCGGAGCAGGGCTGAGACTGG + Intronic
948376214 2:237522170-237522192 GAGCGGAGCAGGGCTGAGACTGG + Intronic
948376235 2:237522292-237522314 GAGCGGAGCAGGGCTGAGACTGG + Intronic
948376246 2:237522353-237522375 GAGTGGAGCAGGGCTGAGACTGG + Intronic
948376255 2:237522414-237522436 GAGCGGAGCAGGGCTGAGACTGG + Intronic
948376277 2:237522536-237522558 GAGCGGAGCAGGGCTGAGACTGG + Intronic
948376295 2:237522658-237522680 GAGCGGAGCAGGGCTGAGACTGG + Intronic
948467624 2:238159789-238159811 GTGTGGCCCAGGCCTGAGGAGGG + Intronic
948663810 2:239522439-239522461 GTGGGGTGCAGGCTGGGGAAGGG - Intergenic
948861517 2:240754958-240754980 GAGGGGAGCAGGGCTGGGGAGGG - Intronic
949017243 2:241720387-241720409 GTGGGGAACAGGCCTGAAGAGGG - Intronic
1169091242 20:2862553-2862575 GTGGGGAGCAGTCCAGAGCCAGG - Intronic
1169387771 20:5165704-5165726 GTGGGGAGCACTCCTAAGGAAGG + Intronic
1169781419 20:9314519-9314541 GTGGAGAGAATGCCAGAGAAGGG + Intronic
1172593211 20:36131995-36132017 CTGGGGAACAGGCCTGAGCTGGG - Intronic
1172778837 20:37423772-37423794 TTGGAGAGCAGGCCTGACCAAGG + Intergenic
1172869522 20:38127034-38127056 GTGGGAAAGAGGCCTGAGGAGGG + Intronic
1173088042 20:39943281-39943303 GTGGAGAGCTGGCCTGCGCACGG + Intergenic
1173144483 20:40512810-40512832 GTGGCCAGCTGTCCTGAGAAGGG - Intergenic
1173961580 20:47076796-47076818 GGGAGGAGCTTGCCTGAGAACGG - Intronic
1174619870 20:51865789-51865811 GTGGGGAGCAGAGATTAGAATGG - Intergenic
1175091548 20:56508650-56508672 GTGTGGTGCTGGCATGAGAACGG + Intronic
1175114706 20:56673903-56673925 GTGGGGATGAGGCCAGACAACGG + Intergenic
1175227089 20:57451027-57451049 GGGTGGACCCGGCCTGAGAAAGG + Intergenic
1175374275 20:58514132-58514154 GTGCCCAGCAGGCCTGACAAAGG - Intronic
1175402414 20:58708147-58708169 CTGGGTTGCTGGCCTGAGAAAGG - Intronic
1175655053 20:60762688-60762710 GTGGGGAGCAGGGGTGATAGGGG - Intergenic
1175659952 20:60803959-60803981 GAGAGGAGCAGGGATGAGAAGGG - Intergenic
1175756434 20:61533260-61533282 ATGGGGGGCAGGCCTGGGCACGG + Intronic
1176131061 20:63497035-63497057 GTGGGGAGCGGTCATGAGACGGG - Intronic
1176515028 21:7777564-7777586 GTGGGAAGCAGGCGTGGGAGGGG - Intergenic
1176708862 21:10133679-10133701 GTGGACATCAGGCCTGAGAAGGG + Intergenic
1176997858 21:15577933-15577955 CTGGAGAACAGGCATGAGAATGG + Intergenic
1178460268 21:32796261-32796283 GTGGGGAGGAGGCGAGAGGAGGG + Intronic
1178649056 21:34407576-34407598 GTGGGAAGCAGGCGTGGGAGGGG - Intronic
1178689736 21:34741009-34741031 GAGGGGAGCAGGATTGGGAATGG - Intergenic
1179035163 21:37753150-37753172 GTGTGCAGCTGGGCTGAGAAAGG + Intronic
1180104279 21:45607649-45607671 GAGGGGAGGAGGGATGAGAAAGG + Intergenic
1180292228 22:10857377-10857399 GTGGGCATCAGGCCTGATATTGG - Intergenic
1180292965 22:10860944-10860966 GTGGACATCAGGCCTGAGAAGGG + Intergenic
1180456489 22:15515346-15515368 GTGGACATCAGGCCTGAGAAGGG + Intergenic
1180495033 22:15886799-15886821 GTGGGCATCAGGCCTGATATTGG - Intergenic
1180495771 22:15890366-15890388 GTGGACATCAGGCCTGAGAAGGG + Intergenic
1180835171 22:18926129-18926151 CTGGGGTGGAGGCCTGAGTAAGG - Intronic
1180898438 22:19353898-19353920 GTGGAGACCAGGCCTGGGCAGGG + Intronic
1180933214 22:19607418-19607440 GCGAGGAGCAGCCCTGAGCAGGG - Intergenic
1181020540 22:20099527-20099549 CTGGGGAGAAGGGCTGGGAATGG + Intronic
1181053230 22:20247421-20247443 GTGGGGAGCAGGCGTGGGAGGGG - Intronic
1181164414 22:20975793-20975815 GTGGGAAACAGGCCCGAGGAGGG + Intronic
1181749118 22:24976677-24976699 GTGGGGAGCAGGCAGGGAAAGGG - Intronic
1181987278 22:26808908-26808930 TTGGGGTGCAGGGCTGAGGATGG + Intergenic
1182478584 22:30591340-30591362 TTAGCGAGCAGGCCTGACAAGGG - Intronic
1182550883 22:31100197-31100219 GAGGAGAGCAGGACAGAGAAAGG - Intronic
1182727738 22:32461316-32461338 GTTGGGAGCAGAGCTAAGAAAGG + Intronic
1183246517 22:36697800-36697822 GCAGAGAGCAGGCCTTAGAATGG - Intronic
1183346589 22:37311589-37311611 GTGGGGAGAGGGCCTGAGGCTGG + Intronic
1183928869 22:41224892-41224914 GAGGGAAGCAGGCCTCAGGAGGG - Intronic
1184391684 22:44206834-44206856 GTGGGGAGCTGGGCTGGAAAAGG - Exonic
1184736155 22:46398828-46398850 GAGGGGACCAGGCCAGAGGATGG + Intronic
1184847831 22:47100000-47100022 CTGGGCTGCAGGCCTGAGAGTGG + Intronic
1185053876 22:48567880-48567902 GTGCTGGGCAGGCCTGGGAACGG + Intronic
1185409404 22:50674344-50674366 GGGGGGAGGGGGCCTGAGACGGG - Intergenic
1203285259 22_KI270734v1_random:151428-151450 CTGGGGTGGAGGCCTGAGTAAGG - Intergenic
949838215 3:8291971-8291993 GTGGGGAGCAGGTTTGAGGAAGG + Intergenic
950053415 3:10008512-10008534 GTGGGGAGCAGGCCTCAGCAGGG + Intronic
950305053 3:11910797-11910819 GTGGGGAGCAGGCCTGAGCAGGG + Intergenic
950305843 3:11914949-11914971 ACGGGGAGCAGGCCTGAGCAGGG + Intergenic
950311332 3:11960959-11960981 GTGGGGGGAAGGACAGAGAACGG + Intergenic
950415051 3:12864361-12864383 GTGGGTAGCAGGCCTGAGCAGGG + Intronic
950416814 3:12873507-12873529 GTGGGGAGCAGGCCTGAGAAGGG + Intergenic
951475399 3:23100370-23100392 GGCGGGAGCAGGACTGAGAGAGG + Intergenic
951630167 3:24711224-24711246 GTGGGGATCAGTACTGACAATGG - Intergenic
951709381 3:25573474-25573496 GTGGGCAGCAGGCCTCCGGAAGG - Intronic
952189620 3:31008948-31008970 GTGAGGGGTAGACCTGAGAATGG - Intergenic
952763067 3:36932768-36932790 TTGGGGAGCAGATCTGGGAATGG + Intronic
952763757 3:36937801-36937823 GTTGGGAGCAGCCCCGAAAAGGG + Intronic
952925620 3:38317228-38317250 GTAGGGAGGAGGGCAGAGAAAGG - Intronic
952933308 3:38376245-38376267 GTGGTGCCCAGGCCTGTGAAGGG + Intronic
953019130 3:39102974-39102996 GTGGGCAGCAGCCCTCAGCAGGG + Intronic
954070998 3:48142692-48142714 GTGGGGAGCAGGGGAGAGACAGG + Intergenic
954466102 3:50655740-50655762 GTGGGGAGTATCTCTGAGAAGGG + Intergenic
956791497 3:72683519-72683541 GGGGGGAGCAGGACAGGGAAGGG + Intergenic
956888782 3:73588531-73588553 GTGGGAAACAGGACTGAGGAGGG - Intronic
957131087 3:76223076-76223098 CTGGGGAGCATGTCTGGGAATGG - Intronic
957396915 3:79652316-79652338 GTGTGGAAGAGGTCTGAGAATGG - Intronic
957775390 3:84751988-84752010 GTAGGGAGCAGGGGTCAGAATGG - Intergenic
960970538 3:123136368-123136390 GTGGTGACCAGCCCTGAGAAGGG - Intronic
961001999 3:123380259-123380281 GTGGTGAACAGGCTTGAGTAGGG + Intronic
961043283 3:123692474-123692496 GTGGGGATCAGGACTGGGAGGGG + Intronic
961713196 3:128842674-128842696 GGTGGGAGCAGGCCTGAGCAGGG - Intergenic
961847086 3:129774805-129774827 GTGGGGAGCAAGGGTGTGAATGG + Intronic
962006677 3:131356730-131356752 GTGGAGAGCAGGTTTGAAAAGGG + Intergenic
963934929 3:151042750-151042772 GTGGTGGGCAGGCAAGAGAAGGG - Intergenic
965315161 3:167181950-167181972 GTGGGGGGCAGGCCTGGGACGGG + Intergenic
966445378 3:179996266-179996288 CTGGAGAGCAGGCATGGGAATGG + Intronic
966862223 3:184236854-184236876 GTGGGGAGAAGGCCTGGTGAGGG - Intronic
967505578 3:190249473-190249495 CTGGGGAACAGGCATGGGAATGG - Intergenic
967991811 3:195137128-195137150 GTGGGGGCCAGGACAGAGAAGGG + Intronic
968568695 4:1328231-1328253 CTGGTGGTCAGGCCTGAGAAGGG + Intronic
968689703 4:1984201-1984223 GAGGGTAGCAGGACAGAGAAGGG - Intronic
968986805 4:3880107-3880129 GAGGGCAGCAGGCCTGAGTGTGG - Intergenic
969336563 4:6513775-6513797 GTGGTGGGCAGGCCAGGGAAGGG + Intronic
969526328 4:7705924-7705946 GTGGGGAGCAGGCCTGGTTTTGG + Intronic
969563388 4:7963436-7963458 CTGGGGAGAAGGGCTGAGGATGG + Intergenic
969588835 4:8109735-8109757 CTGGGAAGCAGGCATGGGAAAGG + Intronic
969630169 4:8331250-8331272 GTGGGCAGAAGGCCAGAGGAAGG + Intergenic
971473807 4:27053842-27053864 GTGCTGAGCAGGGCTCAGAATGG + Intergenic
971685256 4:29757289-29757311 CTGGAGAACAGGCATGAGAATGG + Intergenic
972567416 4:40282197-40282219 CTGGTGAGCACTCCTGAGAATGG + Intergenic
975422809 4:74189017-74189039 GTTTGGAGCAGGACGGAGAATGG + Intronic
975811107 4:78170878-78170900 GGAGGGAGGTGGCCTGAGAAAGG - Intronic
978350144 4:107812729-107812751 GTAGAGAACAGGGCTGAGAAGGG - Intergenic
978833360 4:113116494-113116516 GGGGTGAGCAGGTCTGGGAAGGG - Intronic
981636474 4:146886565-146886587 GAGGAGAGAAGGCCTGATAAAGG + Intronic
982245723 4:153348307-153348329 GTGGGGAGTAGGTATGAGAGAGG + Intronic
984099917 4:175472768-175472790 GAGGGAAGCAGCCCTGACAAGGG - Intergenic
984473007 4:180200960-180200982 AGGGGGAGCAGGACTGAGCATGG - Intergenic
984814773 4:183825892-183825914 ATGGGGAGAAGGCGCGAGAAGGG + Intergenic
984866667 4:184286516-184286538 GTGAGGAGGAGGCCAGGGAAAGG + Intergenic
984930764 4:184845202-184845224 GTGGGGAGCAGCCCATGGAAAGG + Intergenic
985782583 5:1878864-1878886 GTCGGGAACAGGCCTCATAATGG - Intronic
986690239 5:10307885-10307907 GTGGGGAGGAGACGAGAGAAGGG + Exonic
986813381 5:11383250-11383272 GTGGTGCGCATGGCTGAGAAGGG + Intronic
988267781 5:28973650-28973672 CTGGAGAACAGGCCTGGGAATGG - Intergenic
988594971 5:32582948-32582970 CTGGGAAGTAGGGCTGAGAAGGG - Intronic
990335000 5:54763944-54763966 GTGGGGAGCTGCCCTGTGCATGG - Intergenic
990461827 5:56037793-56037815 GAGAGGAGCAGAGCTGAGAAGGG - Intergenic
990467301 5:56082417-56082439 TTGGGGAGCAGGCTTGGGAATGG - Intergenic
990575101 5:57116481-57116503 GTAGGACGCAGGCCTGATAATGG + Intergenic
992015832 5:72574364-72574386 GCGGGAAGAAGGCCTGAGTAAGG - Intergenic
992080708 5:73232967-73232989 ATGGGGAGGAGGGCAGAGAAGGG - Intergenic
992756309 5:79909897-79909919 CTGGGGAAAAGGCATGAGAAGGG - Intergenic
993297026 5:86153578-86153600 GTGGGGAGGAGAGCTGAAAAGGG + Intergenic
993862696 5:93155703-93155725 GTGGGGACCAGCCTTGTGAAAGG + Intergenic
994155878 5:96503817-96503839 GTGGGGTGCAGGCCAGGGAAAGG - Intergenic
994715365 5:103315178-103315200 GAGAGGATCAGGCTTGAGAAGGG + Intergenic
995259383 5:110084046-110084068 GTGGAGAGCAGGATGGAGAATGG - Intergenic
995460603 5:112399290-112399312 GAGGGGAGCCTTCCTGAGAATGG - Intronic
995837378 5:116412107-116412129 GTGGGGAGGGGGCCAGAGGAGGG - Intronic
996681591 5:126233281-126233303 GTGGAGAGGATGCGTGAGAAAGG + Intergenic
996778766 5:127160644-127160666 GGGTGGAGCCTGCCTGAGAAGGG - Intergenic
997440743 5:133907150-133907172 GTGGGGAGCCTGCCTGCGCAGGG + Intergenic
997519408 5:134512873-134512895 GTAGGGAGCAAGACTGGGAAGGG - Intergenic
997741606 5:136259832-136259854 GTGAGGAGCAAGGCTGAGGAAGG - Intronic
998392060 5:141793565-141793587 GAGGGGAGGAGGCTGGAGAATGG - Intergenic
998671238 5:144356718-144356740 GTGGGGAGAAAGGCTGGGAAAGG + Intronic
998924142 5:147103960-147103982 GAGGGAAGCAGATCTGAGAAAGG - Intergenic
1000126083 5:158245316-158245338 GTGTGGAGCAGGCAAGAGATGGG - Intergenic
1001003296 5:168028078-168028100 GAGAGGAGCAGACCTTAGAAGGG + Intronic
1001525232 5:172424052-172424074 GGGGGGAGCCTGCCTGAGAAAGG + Intronic
1001605562 5:172957777-172957799 TTGGGGGGCAGTCCTAAGAAAGG - Intergenic
1001679757 5:173547476-173547498 GTGGGGAGAAGGCCAGTGCAGGG + Intergenic
1001681864 5:173563814-173563836 GAGGGGACCAAGGCTGAGAAGGG - Intergenic
1002000176 5:176192848-176192870 GTGAGGCCCAGGCCTGGGAATGG - Intergenic
1002254138 5:177946046-177946068 GTGAGGCCCAGGCCTGGGAATGG + Intergenic
1002427767 5:179186078-179186100 CTGGGAGGCAGGCCTGAGCAAGG + Intronic
1002567366 5:180119496-180119518 GAGGGGAGCGGGCCTGATCAGGG - Intronic
1002716581 5:181231808-181231830 GTGAGCAGCAGGCCAGAGGAGGG - Intronic
1003480301 6:6525111-6525133 GCGGGGAGCAGGGCTGGGAAGGG + Intergenic
1004014416 6:11719091-11719113 GTGGGCTGCTGGACTGAGAAGGG - Intronic
1005169665 6:22968515-22968537 GCGGGGAGGAGGACTGAGCAAGG - Intergenic
1005379292 6:25217370-25217392 GTTGGTAGCAGGCCTCAGAGAGG - Intergenic
1006011577 6:31046720-31046742 GGTGGGACCAGGCCTGAGCATGG - Intergenic
1006062047 6:31430862-31430884 GTGGAGAACAGGCATGGGAATGG + Intergenic
1006137311 6:31902765-31902787 GTTGGGATCAATCCTGAGAATGG - Intronic
1006360435 6:33584295-33584317 GTGGGGAGGAGGCTGGAGATGGG + Intergenic
1006745237 6:36336997-36337019 GCGGGGAGCAGTCCTGGGATGGG - Intergenic
1006914353 6:37584970-37584992 TGAGGGAGCAGGCCAGAGAAAGG + Intergenic
1006931140 6:37689161-37689183 GGCGGGAGGAGGCCTGAGAGGGG - Intronic
1007207457 6:40164301-40164323 GTGGGGGGCAGGGCGGGGAATGG - Intergenic
1007340713 6:41189797-41189819 GTGGAGAGGAGGCCTGAAAGAGG + Intergenic
1007393883 6:41566252-41566274 CTGGGCAGCAGGCTTGAGATTGG + Intronic
1007520956 6:42451741-42451763 AAGGGGAGCAGGGCTGGGAAAGG - Intronic
1007577771 6:42937272-42937294 GTGGGAAGCAGGCCTAAAAGAGG + Intronic
1007766293 6:44162259-44162281 GTGGAAAGCAGTCCTGAGAGGGG - Intronic
1009598425 6:65766373-65766395 GTGGTGTGCAAGACTGAGAAAGG + Intergenic
1014282707 6:119459465-119459487 GTAGGGAGCAGGGCTAAGAATGG - Intergenic
1015241168 6:131025186-131025208 GGGGGAAACAGGCCTTAGAAAGG - Intronic
1017485735 6:154900561-154900583 CTGGGGAGCAGGGTGGAGAAAGG + Intronic
1018146524 6:160895690-160895712 ATGTGGAGCACACCTGAGAAAGG - Intergenic
1018593763 6:165455679-165455701 GAAGGCAGCAGACCTGAGAAGGG - Intronic
1019102538 6:169642752-169642774 GTGGGAAGCAGGCCTAGGCAAGG - Intronic
1019983916 7:4641689-4641711 GCGAGGAGCAGGGCTGGGAAGGG + Intergenic
1022374105 7:29797407-29797429 GTGAGGAGCAGAGCTGTGAATGG - Intergenic
1022489387 7:30805116-30805138 GGGTGCAGCAGGTCTGAGAAAGG + Intronic
1022824880 7:33998711-33998733 GTGGGGAGCAGCCCTAACCATGG + Intronic
1022905301 7:34849884-34849906 GTGGGAAGGAGGGCTGGGAATGG - Intronic
1023490161 7:40731119-40731141 GGGAGGAGCAGGTGTGAGAAAGG + Intronic
1023625515 7:42111594-42111616 CAGGAGAGCAGGCCTGAGGAAGG + Intronic
1024257484 7:47549546-47549568 TTGGAGAGCAGGCCAGAGACAGG - Intronic
1024639682 7:51318263-51318285 GTGGGGAGCAGGCTGGACAATGG + Intergenic
1026902803 7:74046371-74046393 GGGGGGAGCAGGCCTGGGATGGG - Intronic
1028585444 7:92447481-92447503 CTGGGAAGCAGGACTGGGAAAGG - Exonic
1028773967 7:94657831-94657853 GGGCGGGGCAGGCCTGAGACTGG - Intronic
1030704099 7:112673534-112673556 GCAGGGAGGAGGCCAGAGAATGG - Intergenic
1032076409 7:128838213-128838235 GGGGAGAGCAGTCCTGAGAGGGG - Intronic
1032095236 7:128935001-128935023 GTGGGGAGCAGGGGGGAGGAGGG - Intergenic
1033535402 7:142307698-142307720 GTGGGGAGCTGTCCTGTGTAGGG - Intergenic
1033629282 7:143140950-143140972 ATGGGGAGCCGGCCAGGGAATGG + Intergenic
1034163233 7:149007402-149007424 GTGGGAAGCAGAGCTGAGATTGG - Intronic
1034276683 7:149826841-149826863 GTGGGGAGCAGGGATGAGGAAGG + Intergenic
1034816363 7:154175396-154175418 GGGAGGAGAAGGCCTGAGAAGGG + Intronic
1036506527 8:9361626-9361648 GTGGTGAGCAGGGCTGATAGAGG - Intergenic
1037813882 8:22101985-22102007 GTGTGGAGCAGGGGTGAGACGGG - Intronic
1038022059 8:23558923-23558945 GTGGGGAGCAGGCCGGAGGCAGG - Intronic
1039547514 8:38420692-38420714 GTTGGGAGGAGGCCTGTGGAAGG - Intronic
1041542028 8:58995989-58996011 GGGGAGAGCAGGCCTGGAAACGG - Intronic
1041834689 8:62198275-62198297 GGGGGAAGCAGGCCTCAGCATGG + Intergenic
1042220816 8:66472236-66472258 CTGGGGAGTAGGTATGAGAAAGG + Intronic
1042331439 8:67584666-67584688 GAGTGGAGTAGGGCTGAGAATGG + Intronic
1042614645 8:70634954-70634976 TTGGGGAACAGGGGTGAGAAGGG - Intronic
1042978486 8:74498817-74498839 GTGGGGAGCAGGACAGAGAAAGG - Intergenic
1045378536 8:101600169-101600191 ATGTAGAACAGGCCTGAGAAAGG + Intronic
1046827764 8:118710508-118710530 GAGTGAAGCAGGCCTGAGACGGG - Intergenic
1047681490 8:127258372-127258394 GAGGTGAGGAGGTCTGAGAAGGG + Intergenic
1047768315 8:128008495-128008517 GTAGGGAACAGGCATGAGAAGGG - Intergenic
1048084181 8:131159446-131159468 CTGGAGAACAGGCATGAGAAAGG - Intergenic
1049286492 8:141778190-141778212 GTGGAGAGCAGGCCTGGCATGGG + Intergenic
1049410092 8:142470041-142470063 GCGGGGGGCAGGGCTGAAAATGG - Intronic
1049884529 9:18288-18310 GTGGGCAGCAGGGCAGAGACTGG + Intergenic
1050606378 9:7305656-7305678 GTGGAGAGAGGGCCTGTGAATGG - Intergenic
1051552892 9:18350078-18350100 ATGGGGAGCAGATCTGAAAAGGG + Intergenic
1051985699 9:23084134-23084156 GAGGGGAGCAGGGATGAAAAGGG - Intergenic
1052961241 9:34298862-34298884 GTGGGGAGCTGGGGAGAGAAAGG + Intronic
1053306388 9:36987098-36987120 GTGGGGTGCAGGCCAGAGAGTGG + Intronic
1053575255 9:39353488-39353510 GTGGAGGGCAGGCCAGACAATGG - Intergenic
1053645838 9:40119176-40119198 GTGGACATCAGGCCTGAGAAGGG + Intergenic
1053645844 9:40119203-40119225 GTGGACATCAGGCCTGAGAAGGG + Intergenic
1053759874 9:41344333-41344355 GTGGACATCAGGCCTGAGAAGGG - Intergenic
1054096817 9:60912171-60912193 GTGGAGGGCAGGCCAGACAATGG - Intergenic
1054118221 9:61187797-61187819 GTGGAGGGCAGGCCAGACAATGG - Intergenic
1054326135 9:63713540-63713562 GTGGGCATCAGGCCTGATATTGG - Intergenic
1054326850 9:63717077-63717099 GTGGACATCAGGCCTGAGAAGGG + Intergenic
1054326856 9:63717104-63717126 GTGGACATCAGGCCTGAGAAGGG + Intergenic
1054538727 9:66256769-66256791 GTGGACATCAGGCCTGAGAAGGG - Intergenic
1054538733 9:66256796-66256818 GTGGACATCAGGCCTGAGAAGGG - Intergenic
1054589534 9:66994767-66994789 GTGGAGGGCAGGCCAGACAATGG + Intergenic
1056737229 9:89220192-89220214 CTGTGGAGCAGGCCTGTGAAGGG - Intergenic
1057184909 9:93052002-93052024 GTGATGAGCCGGCCTGGGAATGG + Intergenic
1057750428 9:97788216-97788238 GTGTGGGGCAGGCATGAGTAGGG - Intergenic
1057829491 9:98395835-98395857 GGGAAGAGCAGGCTTGAGAATGG + Intronic
1058648621 9:107154353-107154375 GTAGGGAGCTGGGCAGAGAAGGG - Intergenic
1058954164 9:109930186-109930208 TTGGGGAGAAGGAATGAGAAAGG - Intronic
1059411033 9:114132497-114132519 GTGTGGAGCAGGGCTGTGAAAGG + Intergenic
1059528565 9:115015455-115015477 GTGGGGAGCAGAGGTGAGGATGG - Intergenic
1060055970 9:120413385-120413407 TTGGGGAGCAGGCCTGAGAAAGG - Intronic
1060190500 9:121589307-121589329 GAGGGGAGCAGCCATGAGAGGGG - Intronic
1060197779 9:121634566-121634588 GTGACGCGCAGGTCTGAGAATGG + Intronic
1061793234 9:133069485-133069507 ATGGGGTGCAGGGCTGAGCAGGG - Intronic
1061795838 9:133085269-133085291 ATGGGGTGCAGGGCTGAGCAGGG - Intronic
1061884966 9:133586795-133586817 TTGGGTGGCAGTCCTGAGAAAGG - Intergenic
1061952115 9:133942472-133942494 GCTGGGAGCAGGCCTGAGCCGGG + Intronic
1062242659 9:135548504-135548526 GGGGAGAGGAGGCCTGAGAATGG - Intronic
1062690157 9:137837512-137837534 GGGGAGTGCAGGCCTGGGAAGGG + Intronic
1202793623 9_KI270719v1_random:102649-102671 GTGGACATCAGGCCTGAGAAGGG + Intergenic
1186574474 X:10750739-10750761 GTGGGTAGCAAGTCTGAAAATGG - Intronic
1186851331 X:13583147-13583169 GTTAGGAGCAGGAGTGAGAAGGG - Intronic
1188901204 X:35734471-35734493 GTGTGGAGCCTGCCTGAGACTGG - Intergenic
1189240708 X:39522340-39522362 TTGAGGGGCAGTCCTGAGAAGGG - Intergenic
1189242664 X:39537547-39537569 GTGGGGTGCAGGGGTGGGAAGGG + Intergenic
1189815169 X:44817531-44817553 GGCAGGAGCGGGCCTGAGAAAGG + Intergenic
1190078241 X:47334679-47334701 GTGGGAGGAAGGCCTGAGACTGG + Intergenic
1190261880 X:48802496-48802518 GGAGGGAGAAGGCCTGAGAGAGG + Intronic
1192916390 X:75655853-75655875 GTGGTGAGCAGACCTGTGTAGGG - Intergenic
1194032294 X:88832157-88832179 CTGGAGAACAGGCATGAGAATGG - Intergenic
1195006024 X:100686817-100686839 GTGAAAAGCAGGCTTGAGAAAGG - Intronic
1195094606 X:101492137-101492159 CTGGGGAGCAGGCCAGTGGAGGG + Exonic
1195782672 X:108482171-108482193 CTGGAGAACAGGCATGAGAATGG - Intronic
1196201094 X:112886928-112886950 GTGGGGAGCAGGTGTGGGGAAGG - Intergenic
1197497762 X:127207273-127207295 CTGGAGAACAGGCCTGGGAATGG - Intergenic
1198030757 X:132751447-132751469 GCTAGGAGCAGCCCTGAGAATGG - Intronic
1198126232 X:133646760-133646782 GTGGGGAGTAGGCCAGAGCCTGG + Intronic
1198515500 X:137402668-137402690 ATGGGGACCAGTCCTGAGTATGG - Intergenic
1199275772 X:145940174-145940196 CTGGGGAACAGGCATGGGAATGG + Intergenic
1199627374 X:149752896-149752918 CTGGAGAACAGGCATGAGAATGG - Intergenic
1200210786 X:154345815-154345837 GTGGGGGGCAGGCCCGAGGCAGG - Intergenic
1200220066 X:154386277-154386299 GTGGGGGGCAGGCCCGAGGCAGG + Intergenic
1200401278 X:156021863-156021885 GTGGGCAGCAGGGCAGAGAATGG - Intergenic
1201562153 Y:15329023-15329045 TAGGGGAGCAGGCCTGCGATGGG - Intergenic