ID: 950417125

View in Genome Browser
Species Human (GRCh38)
Location 3:12875152-12875174
Sequence ATGCTCTTCTTGAGGCTAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950417125_950417133 18 Left 950417125 3:12875152-12875174 CCCTTTAGCCTCAAGAAGAGCAT No data
Right 950417133 3:12875193-12875215 CTGAAACCTAAACCAAATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950417125 Original CRISPR ATGCTCTTCTTGAGGCTAAA GGG (reversed) Intergenic
No off target data available for this crispr