ID: 950420961

View in Genome Browser
Species Human (GRCh38)
Location 3:12899281-12899303
Sequence CCGCGGGGCCGCGTTCCCAG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 76}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950420961_950420969 16 Left 950420961 3:12899281-12899303 CCACTGGGAACGCGGCCCCGCGG 0: 1
1: 0
2: 1
3: 10
4: 76
Right 950420969 3:12899320-12899342 TGAGCTTCGCCCTTTCTGAAAGG 0: 1
1: 0
2: 1
3: 5
4: 84
950420961_950420963 -9 Left 950420961 3:12899281-12899303 CCACTGGGAACGCGGCCCCGCGG 0: 1
1: 0
2: 1
3: 10
4: 76
Right 950420963 3:12899295-12899317 GCCCCGCGGCCCGCAGAGTCAGG 0: 1
1: 0
2: 1
3: 15
4: 143
950420961_950420973 28 Left 950420961 3:12899281-12899303 CCACTGGGAACGCGGCCCCGCGG 0: 1
1: 0
2: 1
3: 10
4: 76
Right 950420973 3:12899332-12899354 TTTCTGAAAGGGCCTCCGCCTGG 0: 1
1: 0
2: 0
3: 3
4: 109
950420961_950420970 17 Left 950420961 3:12899281-12899303 CCACTGGGAACGCGGCCCCGCGG 0: 1
1: 0
2: 1
3: 10
4: 76
Right 950420970 3:12899321-12899343 GAGCTTCGCCCTTTCTGAAAGGG 0: 1
1: 0
2: 1
3: 8
4: 96
950420961_950420974 29 Left 950420961 3:12899281-12899303 CCACTGGGAACGCGGCCCCGCGG 0: 1
1: 0
2: 1
3: 10
4: 76
Right 950420974 3:12899333-12899355 TTCTGAAAGGGCCTCCGCCTGGG 0: 1
1: 0
2: 0
3: 7
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950420961 Original CRISPR CCGCGGGGCCGCGTTCCCAG TGG (reversed) Exonic
901696699 1:11012950-11012972 CCGCGGTGCCGCGTAGCCTGAGG + Intronic
902763164 1:18597604-18597626 GCGCGTGGCCGCCTTCTCAGCGG - Intergenic
903742969 1:25568972-25568994 GGGTGGGGCCGCGTGCCCAGGGG + Intergenic
905617200 1:39409215-39409237 CGGCGGGGCCGCGGGGCCAGCGG + Intronic
907305553 1:53511056-53511078 CCCCTGGGCCCCGTTCACAGGGG + Intronic
914702884 1:150150170-150150192 CCGCGGGGGCTCCTTCCCCGCGG - Exonic
917962346 1:180154981-180155003 CCGCGGGGCCGCGTTAGCGCCGG - Exonic
924527077 1:244863060-244863082 CCGCGGGCCCGCGCTCCCCGCGG + Intronic
1065014732 10:21451593-21451615 CCACTGGGCTGCATTCCCAGAGG - Intergenic
1066370487 10:34815085-34815107 CCGCGCGCCCGAGTCCCCAGCGG - Exonic
1076542496 10:131223075-131223097 CGGCGGGGACGAGATCCCAGAGG + Intronic
1077036666 11:498729-498751 CCGCGAGGCCTCCTTCCCGGAGG - Intronic
1077517749 11:3012070-3012092 GCACGGGGCAGCCTTCCCAGAGG + Intronic
1077555297 11:3223046-3223068 CAGCAGGGCCGCGCTCCCTGAGG - Intergenic
1077891166 11:6419093-6419115 CCGCGGGGCCGCGCCCCGAGCGG + Intronic
1080540430 11:33258504-33258526 CCGCGGCTCCGCGTCCCCAGCGG + Intronic
1083625620 11:64070592-64070614 CGGAGGGGCCCCCTTCCCAGAGG + Intronic
1085284735 11:75352205-75352227 CCCCGAGGCCGCGCTCCCTGCGG + Intergenic
1095261715 12:40105829-40105851 CCGCGGAGCCGCGTCCCCCCGGG - Exonic
1102375791 12:112419536-112419558 GCGCGGGGCCGGGCCCCCAGTGG + Intronic
1103895338 12:124269435-124269457 CCGCGGGGCTGTGTTCCTGGTGG - Intronic
1104916806 12:132269700-132269722 CCCCAGGTACGCGTTCCCAGCGG - Intronic
1106422583 13:29595784-29595806 CCGCCGCGCCGCGCTCCCATTGG - Intergenic
1112428860 13:99332060-99332082 CCTAGGGGCTGCTTTCCCAGGGG - Intronic
1112507507 13:99983811-99983833 CCGCGGGGCCGCGCTGCCTGGGG - Intronic
1115545455 14:34462026-34462048 CCGCGGGGCCGCATTTCCCCAGG - Intronic
1117548055 14:56809147-56809169 CTGAGGGGCCGCGGTCCCAGCGG + Intronic
1125814846 15:42575588-42575610 CCGCGCGGCGGCGTCCCCAGAGG + Intergenic
1132589545 16:720722-720744 CCGGGGAGCCGCTTTCCCACCGG + Intronic
1132690762 16:1180887-1180909 CTGCTGGGCCGCGTTGGCAGGGG + Intronic
1133225523 16:4338675-4338697 CTGCTGGGCCGCTTTCTCAGAGG + Exonic
1138157809 16:54722159-54722181 CAGCGGGGCCTAGTTCCCAGTGG - Intergenic
1139691644 16:68645511-68645533 GCGCGGGGCTGCGCTCCCTGGGG + Intronic
1142837000 17:2594290-2594312 CCGCGGGGCGGGGGTCGCAGAGG - Intronic
1147200607 17:38799225-38799247 GCGCGGGGCCGCGCTCAGAGGGG + Intronic
1148545268 17:48513928-48513950 CCGCGTGGCCTCGCTACCAGTGG + Intergenic
1152396295 17:80035748-80035770 CCGCGGGGGCGGGGTCCGAGGGG - Intronic
1156350480 18:36297801-36297823 CCGCGGGGGCGCGGGCCCCGGGG - Intronic
1160686766 19:440544-440566 CCACTGGGCCCCGGTCCCAGAGG + Intronic
1160845417 19:1164053-1164075 CCGCGGGCCTGAGTTTCCAGAGG - Intronic
1161410356 19:4113540-4113562 CCTCGGAGCCATGTTCCCAGTGG + Intronic
1161494653 19:4580685-4580707 CCGCGGGGCAGGGGTCGCAGTGG - Intergenic
1162128273 19:8511008-8511030 GCTCGGGGCCGCGTGCCCTGCGG + Exonic
1165782052 19:38440714-38440736 CCGAGGGGCAGCGTCTCCAGGGG - Intronic
1167730447 19:51250486-51250508 CTGCTGGGCTGCATTCCCAGAGG - Intronic
927945851 2:27134709-27134731 CCGCGGGGCCGCGTTTCCCGGGG + Intergenic
930585950 2:53267574-53267596 CCCCGGGACAGAGTTCCCAGGGG + Intergenic
932024867 2:68122628-68122650 CTGAGGGGCCTCCTTCCCAGGGG + Intergenic
936462798 2:112724637-112724659 CAGCGAGACCGGGTTCCCAGGGG + Intronic
938319842 2:130355666-130355688 CCGCGCGGCCTGGCTCCCAGGGG + Intergenic
944114221 2:196170880-196170902 CGGCGTGGGCGCGTTCCCATCGG - Intronic
945878147 2:215299657-215299679 CCGTGGGGGCGCATTCCCAGTGG + Intergenic
946422068 2:219570819-219570841 TCACGGGGCCTCGATCCCAGTGG - Exonic
946843087 2:223837229-223837251 CCGCGGCGCCGCGTTGCCGCAGG + Intronic
947188036 2:227472345-227472367 CCGGGGGCCCGCGGTCCCACGGG - Exonic
1171974859 20:31587917-31587939 CCGCCGGGCCTGGTTCCCACGGG + Intergenic
1173672800 20:44810054-44810076 CCCTGGGGGCGCCTTCCCAGGGG + Intronic
1174204392 20:48828173-48828195 GCGCCGCGCCGCGTCCCCAGGGG - Intergenic
1176194444 20:63830934-63830956 CCGCGGGGGCGCCCTCCCGGGGG - Intronic
1176381695 21:6117047-6117069 TCCCGAGGCCGCGTTCCCCGAGG + Intronic
1178514483 21:33235262-33235284 CTGCTGGGCTGCATTCCCAGGGG - Intronic
1179178934 21:39028958-39028980 CCGTGGGGGCGGGTGCCCAGGGG - Intergenic
1179741777 21:43421192-43421214 TCCCGAGGCCGCGTTCCCCGAGG - Intronic
1183942087 22:41301748-41301770 CCGCCGGGCTGCGCTCCCCGCGG - Exonic
1184792589 22:46709083-46709105 CACCGGGGCAGCCTTCCCAGCGG + Intronic
1185226941 22:49658546-49658568 CCCCGGGGCCACGTTCCCTCTGG + Intergenic
1185381236 22:50508287-50508309 CCGCAGGGCTGCCTTCCGAGGGG - Exonic
950420961 3:12899281-12899303 CCGCGGGGCCGCGTTCCCAGTGG - Exonic
955971935 3:64445206-64445228 CCGCGGGGCCGGCTTACCTGGGG + Intronic
962588158 3:136862572-136862594 CCGCGGGGTCACGCTCCCTGGGG - Intronic
977257589 4:94758081-94758103 CGGCGGGGCCCCGTCCCCTGCGG + Intronic
982651650 4:158094838-158094860 CTGCTGGGCTGCATTCCCAGGGG + Intergenic
984735005 4:183099821-183099843 CCTCGGGGCCGGGTCCCCGGAGG - Intronic
992530198 5:77645617-77645639 CGGAGGTGCCGCGGTCCCAGAGG + Intergenic
992866296 5:80960448-80960470 TCGCGGGGCCGCGCTCCACGCGG + Intergenic
999188914 5:149731917-149731939 CCGCGGGGCCGCGTGGTCGGTGG + Intronic
1000719956 5:164693710-164693732 CCCCGGGGCAGAGCTCCCAGAGG + Intergenic
1002828400 6:794979-795001 CTGGGGGGCTGTGTTCCCAGGGG - Intergenic
1007633602 6:43285561-43285583 GCGCGGGGCCGCGTCCCCCACGG - Exonic
1008511973 6:52284535-52284557 CGGCCGGGCCGCGTCCGCAGGGG + Intronic
1019514225 7:1432723-1432745 CCACGGGGCTGAGATCCCAGGGG + Intronic
1030830242 7:114211045-114211067 AGGCGGGTCCGAGTTCCCAGAGG - Intronic
1034560630 7:151877331-151877353 CCGCCGCGCCGCGGCCCCAGGGG + Intergenic
1049218237 8:141417531-141417553 CCGCCGGGCCGCGCTCCTGGTGG - Intronic
1055000824 9:71447160-71447182 CCGCAGGGTAGCGCTCCCAGCGG + Intergenic
1061379138 9:130243778-130243800 CCCCAGGGCCCCATTCCCAGGGG + Intergenic
1190024569 X:46912216-46912238 CCGCGGCGCCGCGTTCCAGGTGG - Intergenic
1194977900 X:100411291-100411313 CCGCGGGGTCTCGGTCCCAGGGG + Intergenic