ID: 950420961

View in Genome Browser
Species Human (GRCh38)
Location 3:12899281-12899303
Sequence CCGCGGGGCCGCGTTCCCAG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 76}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950420961_950420969 16 Left 950420961 3:12899281-12899303 CCACTGGGAACGCGGCCCCGCGG 0: 1
1: 0
2: 1
3: 10
4: 76
Right 950420969 3:12899320-12899342 TGAGCTTCGCCCTTTCTGAAAGG 0: 1
1: 0
2: 1
3: 5
4: 84
950420961_950420963 -9 Left 950420961 3:12899281-12899303 CCACTGGGAACGCGGCCCCGCGG 0: 1
1: 0
2: 1
3: 10
4: 76
Right 950420963 3:12899295-12899317 GCCCCGCGGCCCGCAGAGTCAGG 0: 1
1: 0
2: 1
3: 15
4: 143
950420961_950420970 17 Left 950420961 3:12899281-12899303 CCACTGGGAACGCGGCCCCGCGG 0: 1
1: 0
2: 1
3: 10
4: 76
Right 950420970 3:12899321-12899343 GAGCTTCGCCCTTTCTGAAAGGG 0: 1
1: 0
2: 1
3: 8
4: 96
950420961_950420974 29 Left 950420961 3:12899281-12899303 CCACTGGGAACGCGGCCCCGCGG 0: 1
1: 0
2: 1
3: 10
4: 76
Right 950420974 3:12899333-12899355 TTCTGAAAGGGCCTCCGCCTGGG 0: 1
1: 0
2: 0
3: 7
4: 141
950420961_950420973 28 Left 950420961 3:12899281-12899303 CCACTGGGAACGCGGCCCCGCGG 0: 1
1: 0
2: 1
3: 10
4: 76
Right 950420973 3:12899332-12899354 TTTCTGAAAGGGCCTCCGCCTGG 0: 1
1: 0
2: 0
3: 3
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950420961 Original CRISPR CCGCGGGGCCGCGTTCCCAG TGG (reversed) Exonic