ID: 950420963

View in Genome Browser
Species Human (GRCh38)
Location 3:12899295-12899317
Sequence GCCCCGCGGCCCGCAGAGTC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 143}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950420955_950420963 14 Left 950420955 3:12899258-12899280 CCGGCCACGGCTCACCACGCTGT 0: 1
1: 0
2: 0
3: 3
4: 105
Right 950420963 3:12899295-12899317 GCCCCGCGGCCCGCAGAGTCAGG 0: 1
1: 0
2: 1
3: 15
4: 143
950420956_950420963 10 Left 950420956 3:12899262-12899284 CCACGGCTCACCACGCTGTCCAC 0: 1
1: 0
2: 2
3: 8
4: 176
Right 950420963 3:12899295-12899317 GCCCCGCGGCCCGCAGAGTCAGG 0: 1
1: 0
2: 1
3: 15
4: 143
950420952_950420963 25 Left 950420952 3:12899247-12899269 CCTCCTGCCGTCCGGCCACGGCT 0: 1
1: 0
2: 1
3: 13
4: 147
Right 950420963 3:12899295-12899317 GCCCCGCGGCCCGCAGAGTCAGG 0: 1
1: 0
2: 1
3: 15
4: 143
950420959_950420963 0 Left 950420959 3:12899272-12899294 CCACGCTGTCCACTGGGAACGCG 0: 1
1: 0
2: 0
3: 5
4: 55
Right 950420963 3:12899295-12899317 GCCCCGCGGCCCGCAGAGTCAGG 0: 1
1: 0
2: 1
3: 15
4: 143
950420950_950420963 30 Left 950420950 3:12899242-12899264 CCTCTCCTCCTGCCGTCCGGCCA 0: 1
1: 0
2: 2
3: 33
4: 337
Right 950420963 3:12899295-12899317 GCCCCGCGGCCCGCAGAGTCAGG 0: 1
1: 0
2: 1
3: 15
4: 143
950420953_950420963 22 Left 950420953 3:12899250-12899272 CCTGCCGTCCGGCCACGGCTCAC 0: 1
1: 0
2: 1
3: 12
4: 102
Right 950420963 3:12899295-12899317 GCCCCGCGGCCCGCAGAGTCAGG 0: 1
1: 0
2: 1
3: 15
4: 143
950420954_950420963 18 Left 950420954 3:12899254-12899276 CCGTCCGGCCACGGCTCACCACG 0: 1
1: 0
2: 0
3: 5
4: 56
Right 950420963 3:12899295-12899317 GCCCCGCGGCCCGCAGAGTCAGG 0: 1
1: 0
2: 1
3: 15
4: 143
950420961_950420963 -9 Left 950420961 3:12899281-12899303 CCACTGGGAACGCGGCCCCGCGG 0: 1
1: 0
2: 1
3: 10
4: 76
Right 950420963 3:12899295-12899317 GCCCCGCGGCCCGCAGAGTCAGG 0: 1
1: 0
2: 1
3: 15
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950420963 Original CRISPR GCCCCGCGGCCCGCAGAGTC AGG Exonic