ID: 950420970

View in Genome Browser
Species Human (GRCh38)
Location 3:12899321-12899343
Sequence GAGCTTCGCCCTTTCTGAAA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 96}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950420961_950420970 17 Left 950420961 3:12899281-12899303 CCACTGGGAACGCGGCCCCGCGG 0: 1
1: 0
2: 1
3: 10
4: 76
Right 950420970 3:12899321-12899343 GAGCTTCGCCCTTTCTGAAAGGG 0: 1
1: 0
2: 1
3: 8
4: 96
950420968_950420970 -7 Left 950420968 3:12899305-12899327 CCGCAGAGTCAGGCGTGAGCTTC 0: 1
1: 0
2: 0
3: 11
4: 120
Right 950420970 3:12899321-12899343 GAGCTTCGCCCTTTCTGAAAGGG 0: 1
1: 0
2: 1
3: 8
4: 96
950420959_950420970 26 Left 950420959 3:12899272-12899294 CCACGCTGTCCACTGGGAACGCG 0: 1
1: 0
2: 0
3: 5
4: 55
Right 950420970 3:12899321-12899343 GAGCTTCGCCCTTTCTGAAAGGG 0: 1
1: 0
2: 1
3: 8
4: 96
950420967_950420970 -6 Left 950420967 3:12899304-12899326 CCCGCAGAGTCAGGCGTGAGCTT 0: 1
1: 0
2: 2
3: 4
4: 78
Right 950420970 3:12899321-12899343 GAGCTTCGCCCTTTCTGAAAGGG 0: 1
1: 0
2: 1
3: 8
4: 96
950420965_950420970 1 Left 950420965 3:12899297-12899319 CCCGCGGCCCGCAGAGTCAGGCG 0: 1
1: 0
2: 0
3: 8
4: 107
Right 950420970 3:12899321-12899343 GAGCTTCGCCCTTTCTGAAAGGG 0: 1
1: 0
2: 1
3: 8
4: 96
950420966_950420970 0 Left 950420966 3:12899298-12899320 CCGCGGCCCGCAGAGTCAGGCGT 0: 1
1: 0
2: 0
3: 6
4: 63
Right 950420970 3:12899321-12899343 GAGCTTCGCCCTTTCTGAAAGGG 0: 1
1: 0
2: 1
3: 8
4: 96
950420964_950420970 2 Left 950420964 3:12899296-12899318 CCCCGCGGCCCGCAGAGTCAGGC 0: 1
1: 0
2: 0
3: 20
4: 94
Right 950420970 3:12899321-12899343 GAGCTTCGCCCTTTCTGAAAGGG 0: 1
1: 0
2: 1
3: 8
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950420970 Original CRISPR GAGCTTCGCCCTTTCTGAAA GGG Exonic