ID: 950420974

View in Genome Browser
Species Human (GRCh38)
Location 3:12899333-12899355
Sequence TTCTGAAAGGGCCTCCGCCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 141}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950420967_950420974 6 Left 950420967 3:12899304-12899326 CCCGCAGAGTCAGGCGTGAGCTT 0: 1
1: 0
2: 2
3: 4
4: 78
Right 950420974 3:12899333-12899355 TTCTGAAAGGGCCTCCGCCTGGG 0: 1
1: 0
2: 0
3: 7
4: 141
950420968_950420974 5 Left 950420968 3:12899305-12899327 CCGCAGAGTCAGGCGTGAGCTTC 0: 1
1: 0
2: 0
3: 11
4: 120
Right 950420974 3:12899333-12899355 TTCTGAAAGGGCCTCCGCCTGGG 0: 1
1: 0
2: 0
3: 7
4: 141
950420961_950420974 29 Left 950420961 3:12899281-12899303 CCACTGGGAACGCGGCCCCGCGG 0: 1
1: 0
2: 1
3: 10
4: 76
Right 950420974 3:12899333-12899355 TTCTGAAAGGGCCTCCGCCTGGG 0: 1
1: 0
2: 0
3: 7
4: 141
950420964_950420974 14 Left 950420964 3:12899296-12899318 CCCCGCGGCCCGCAGAGTCAGGC 0: 1
1: 0
2: 0
3: 20
4: 94
Right 950420974 3:12899333-12899355 TTCTGAAAGGGCCTCCGCCTGGG 0: 1
1: 0
2: 0
3: 7
4: 141
950420965_950420974 13 Left 950420965 3:12899297-12899319 CCCGCGGCCCGCAGAGTCAGGCG 0: 1
1: 0
2: 0
3: 8
4: 107
Right 950420974 3:12899333-12899355 TTCTGAAAGGGCCTCCGCCTGGG 0: 1
1: 0
2: 0
3: 7
4: 141
950420966_950420974 12 Left 950420966 3:12899298-12899320 CCGCGGCCCGCAGAGTCAGGCGT 0: 1
1: 0
2: 0
3: 6
4: 63
Right 950420974 3:12899333-12899355 TTCTGAAAGGGCCTCCGCCTGGG 0: 1
1: 0
2: 0
3: 7
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950420974 Original CRISPR TTCTGAAAGGGCCTCCGCCT GGG Exonic