ID: 950422766

View in Genome Browser
Species Human (GRCh38)
Location 3:12908447-12908469
Sequence CTCAAAAAGGAGTCGGGCAA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 175}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950422766_950422773 0 Left 950422766 3:12908447-12908469 CCGTTGCCCGACTCCTTTTTGAG 0: 1
1: 0
2: 0
3: 11
4: 175
Right 950422773 3:12908470-12908492 GCTAGAGCACTGGGACATGCTGG 0: 1
1: 0
2: 0
3: 18
4: 113
950422766_950422771 -10 Left 950422766 3:12908447-12908469 CCGTTGCCCGACTCCTTTTTGAG 0: 1
1: 0
2: 0
3: 11
4: 175
Right 950422771 3:12908460-12908482 CCTTTTTGAGGCTAGAGCACTGG 0: 1
1: 0
2: 2
3: 11
4: 131
950422766_950422772 -9 Left 950422766 3:12908447-12908469 CCGTTGCCCGACTCCTTTTTGAG 0: 1
1: 0
2: 0
3: 11
4: 175
Right 950422772 3:12908461-12908483 CTTTTTGAGGCTAGAGCACTGGG 0: 1
1: 0
2: 0
3: 13
4: 136
950422766_950422774 1 Left 950422766 3:12908447-12908469 CCGTTGCCCGACTCCTTTTTGAG 0: 1
1: 0
2: 0
3: 11
4: 175
Right 950422774 3:12908471-12908493 CTAGAGCACTGGGACATGCTGGG 0: 1
1: 0
2: 0
3: 18
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950422766 Original CRISPR CTCAAAAAGGAGTCGGGCAA CGG (reversed) Exonic
900072852 1:787605-787627 CTGAAAAAGGAGTCAGTGAAGGG - Intergenic
905429882 1:37914062-37914084 CTGAAAAAGGAGTCAGCAAAGGG - Intronic
907232283 1:53010915-53010937 CTGAAAAAGGAGTCAGCAAAAGG - Intronic
907900600 1:58737967-58737989 CACAAAAATGAGTCGGGCGTGGG + Intergenic
908476155 1:64490679-64490701 ATTACAAAGGAGTCGTGCAAAGG + Intronic
910728123 1:90360091-90360113 CCCAAAATGGAGGAGGGCAAGGG + Intergenic
912504604 1:110147755-110147777 CTCAAGAAGGTGTGGGGCCATGG + Intergenic
915469949 1:156119863-156119885 CTCAGGAAGGAGCCAGGCAAGGG - Intronic
919426520 1:197439140-197439162 CTTAAAATGGAGTTGGTCAATGG + Intronic
920038281 1:203079905-203079927 CACACAAAGGAGTCAGGGAAAGG - Intergenic
920373061 1:205491903-205491925 CTCAGAAAGGAGTCAGGCCACGG - Intergenic
920831715 1:209471650-209471672 CTGAAAAAGGAGTCTGCAAAGGG + Intergenic
922268440 1:224010538-224010560 CTGAAAAAGGAGTCAGTGAAGGG - Intergenic
923309714 1:232724753-232724775 TACAAAAATTAGTCGGGCAATGG + Intergenic
923542543 1:234898923-234898945 CCCAATAAGGAGTTTGGCAAGGG + Intergenic
923894355 1:238252609-238252631 CTAGAAAAGGAGTGGGGGAAGGG + Intergenic
924460268 1:244252938-244252960 CAAAAAAAGGAGATGGGCAATGG - Intergenic
1066102921 10:32133790-32133812 CTGAAAAAGGAGTCAGCAAAGGG + Intergenic
1067060553 10:43076078-43076100 CTCAAAAAGCAGCCGGGGATGGG + Intergenic
1068856807 10:61806192-61806214 CTGCAAAAGGAGTGTGGCAATGG + Intergenic
1070543608 10:77435443-77435465 TTCAAAAGGGAGACAGGCAAGGG + Intronic
1071218269 10:83432892-83432914 CTCAAGAGCGAGTCGTGCAAGGG + Intergenic
1073059586 10:100725286-100725308 CTCCAAAAGGAGTGCGTCAATGG + Intergenic
1074549780 10:114431850-114431872 CTCAAAAAGAAGGGGGGAAATGG - Intronic
1075764168 10:124879524-124879546 CCCATAAAGGAGTGGGGCAGTGG + Intergenic
1077553132 11:3211918-3211940 CTGAAAAAGGAGTCAGCAAAGGG - Intergenic
1077652951 11:3990956-3990978 CTCCAAAAGGAGTGGGGATAGGG - Intronic
1077722607 11:4643538-4643560 CTCAAACAGGAGAATGGCAAAGG - Exonic
1080877562 11:36290441-36290463 CAGAAAATGGAGTCGGGGAAGGG - Intergenic
1080994598 11:37583151-37583173 CTGAAAAAGGAGTCAGTGAAGGG + Intergenic
1082692519 11:56323726-56323748 CTGAAAAAGGAGTCAGCAAAGGG - Intergenic
1084433753 11:69126175-69126197 CTCAAAAGGGAGGCAGGCAGGGG + Intergenic
1084987471 11:72888773-72888795 TTCAAAAATTAGTCGGGCATGGG - Intronic
1085569934 11:77550506-77550528 CTGAAAAAGGAGTCAGCAAAGGG - Intronic
1088745523 11:112801141-112801163 TTCAAATAGGAGGCTGGCAAAGG + Intergenic
1089236496 11:117031459-117031481 ATCAAAAATCAGTTGGGCAATGG + Intronic
1089650960 11:119912582-119912604 CTCAGAAAGAAGTCAGGTAAGGG + Intergenic
1090247860 11:125229538-125229560 GTCAATAAGGAGTCGTGGAAGGG + Intronic
1090365267 11:126200176-126200198 CTGAAATGGGAGTCGGGCAGGGG - Intergenic
1096460472 12:51819231-51819253 CTCAGGAAGGAATTGGGCAAGGG + Intergenic
1096588567 12:52642374-52642396 TTCAAAAAGGAGACAGGCACAGG - Intergenic
1096887980 12:54736529-54736551 CTGAAAAAGGAGTCAGCAAAGGG - Intergenic
1101023904 12:100582111-100582133 CTGAAAAAGGAGTCAGCAAAGGG + Intronic
1102230089 12:111256382-111256404 CTCAGAATGAACTCGGGCAATGG - Intronic
1107824356 13:44314159-44314181 CTCTAAAAGAAGTCCAGCAAAGG + Intergenic
1108282299 13:48872118-48872140 CTAAAAAAGGAGTCAGCAAAGGG + Intergenic
1108389574 13:49935564-49935586 ATGACTAAGGAGTCGGGCAATGG + Intronic
1111832805 13:93351413-93351435 GTCAAAAAAGAGTCTGGGAAGGG + Intronic
1113535532 13:111063311-111063333 CTGAAAAAGGAGTCAGCAAAGGG - Intergenic
1114234827 14:20814609-20814631 CTGAAAAAGGAGTCAGCAAAGGG + Intergenic
1114290029 14:21280398-21280420 CACAAAAATTAGCCGGGCAATGG - Intergenic
1115074359 14:29368690-29368712 CTCAAAAAAGAAACGAGCAACGG + Intergenic
1115492983 14:33976597-33976619 CTCCAAAAGGAGTGGCGCAAGGG + Intronic
1116959253 14:50953070-50953092 CTGAAAAAGGAGTCAGCAAAGGG - Intergenic
1118426866 14:65674896-65674918 TTCTAAAAGGAGTCAGGTAAAGG - Intronic
1119559749 14:75580588-75580610 CTGAAAAAGGAGTCAGCAAAGGG + Intronic
1120580097 14:86236510-86236532 CTGAAAAAGTAGTGGGGCGAGGG + Intergenic
1125501707 15:40243859-40243881 CCCCAAAAGGAGTAGGGCCAGGG - Intronic
1126766637 15:52017219-52017241 CTGAAAAAGGAGTCAGCAAAGGG + Intronic
1127382717 15:58443761-58443783 CTGAAAAAGGAGTCAGCAAAGGG + Intronic
1135821673 16:25691712-25691734 CTCTAAAAGTACTGGGGCAAAGG + Intergenic
1139886593 16:70212679-70212701 CTGAAAAAGGAGTCAGCAAAGGG - Intergenic
1140793401 16:78413361-78413383 CTGAAAAAGGAGTCAGCAAAGGG + Intronic
1141005781 16:80350371-80350393 AAAAAAAAGGAGTTGGGCAATGG - Intergenic
1141325793 16:83058186-83058208 CTCACAAAGGAGAGGGGCTAAGG - Intronic
1144301864 17:13928655-13928677 CTGAAAAAGGAGTGGGCAAAGGG + Intergenic
1146967148 17:37042004-37042026 CTCAAAAAGAAAATGGGCAAAGG - Intronic
1152188321 17:78872665-78872687 CTCATAAAGGGGTCGTGAAAAGG - Intronic
1153276344 18:3371637-3371659 ATCACAAAGGAGTCATGCAAAGG + Intergenic
1159130454 18:64275416-64275438 CTGAAAAAGGAGTCAGCAAAGGG + Intergenic
1159540305 18:69766247-69766269 CTGAAGAAGGAGGAGGGCAAGGG + Intronic
1160863544 19:1247787-1247809 CTCAAAAAGCCGACGGGGAAGGG + Intergenic
1164259266 19:23554943-23554965 CTGAAAAAGGAGTCAGCAAAGGG - Intronic
1165382278 19:35489853-35489875 CTCAAAGAGGAGTGGGGCTGGGG - Intronic
1166411387 19:42557679-42557701 CTGAAAAAGGAGTCAGCAAAGGG - Intronic
1166977233 19:46611855-46611877 CTCACACAGGAGCTGGGCAAGGG + Intergenic
927939472 2:27094709-27094731 CTCCAAAAGGAGTGGGGAGAGGG - Intronic
930223449 2:48768322-48768344 TTCAAAAAGGAGCCTGGAAAGGG - Intronic
930652210 2:53973690-53973712 CTGAAAAAGGAGTCAGCAAAGGG - Intronic
931214177 2:60226064-60226086 GTCAGAAAGGAGGCAGGCAATGG + Intergenic
932605911 2:73165513-73165535 CTTAAAATGGAGTGGGGAAAAGG - Intergenic
934575980 2:95401912-95401934 CTCAAATAGAAGTCGGGACATGG + Intergenic
934638151 2:96009769-96009791 CTCAAATAGAAGTCGGGCCATGG + Intergenic
934795500 2:97095641-97095663 CTCAAATAGAAGTCGGGCCATGG - Intergenic
939588934 2:144039686-144039708 CTCAAACAGAAGTCAGGAAAAGG - Intronic
940396137 2:153195250-153195272 CCCAAACAAGAGTCAGGCAAAGG - Intergenic
940770935 2:157838925-157838947 CTCAAAAAGGAGTGGGGCTGAGG - Intronic
941528990 2:166641559-166641581 CCCAAAAAGGAGTCAGCAAAGGG + Intergenic
942626092 2:177902338-177902360 CTGAAAAAGGAGTCAGCAAAGGG - Intronic
943042995 2:182825160-182825182 CTCAAAAGGGGATCAGGCAAGGG + Intergenic
944552945 2:200862565-200862587 CAGAAAAAGGAGTCGGCAAAGGG - Intronic
945139425 2:206668087-206668109 CTCAGAAAGGAGTCAGCCCAGGG + Intronic
946804952 2:223462692-223462714 CTGAAAAAGGAGTCAGCAAAGGG - Intergenic
948134661 2:235627725-235627747 CTCAAACAGGAGTATTGCAATGG - Intronic
948739888 2:240039048-240039070 TTCAAGAAGGAGTTGAGCAAGGG - Intergenic
1175059417 20:56228237-56228259 CTCAAAAGTGAGCCAGGCAAAGG + Intergenic
1176661992 21:9645699-9645721 CTCAAAAATTAGTTGGGCCATGG - Intergenic
1182388452 22:29968515-29968537 ATTAAAAAGGAGAAGGGCAAAGG - Intronic
950422766 3:12908447-12908469 CTCAAAAAGGAGTCGGGCAACGG - Exonic
950987023 3:17384161-17384183 CTGAAAAAGGAGTGAGGCAAGGG + Intronic
951236163 3:20239094-20239116 CTCTAATAGGAATGGGGCAAAGG - Intergenic
952454855 3:33463575-33463597 CTGAAAAAGGAGTCAGCAAAGGG + Intergenic
955294390 3:57721825-57721847 CCCAAAAAGGAGTGGGGAATTGG - Intergenic
957394160 3:79618616-79618638 CTGAAAAAGGAGTCAGCAAAGGG - Intronic
957759500 3:84537204-84537226 CTGAAAAAGGAGTCAGCGAAGGG + Intergenic
958755222 3:98244220-98244242 CTGAGAAAGGAGTCAGCCAAGGG - Intergenic
967757531 3:193186900-193186922 CTCAAAAGAAAGTCGGGAAAGGG - Intergenic
968209322 3:196834834-196834856 CTCAAAAAGCTGTAGTGCAATGG - Intergenic
968412159 4:399703-399725 CTGAAAAAGGAGTCAGCAAAGGG + Intergenic
969902237 4:10360589-10360611 CTCAAAAAGGATTGGGCCAGTGG - Intergenic
973337960 4:48975608-48975630 CTTAGAAAGGAGTAGGGGAAGGG - Intergenic
980593136 4:134917346-134917368 CTGAAAAAGGAGTCAGCAAAGGG - Intergenic
983020236 4:162667564-162667586 CTTCAAAAGAAGTCGAGCAAAGG + Intergenic
983359541 4:166710327-166710349 CCCAAAAAGGAGTCAGCAAAGGG - Intergenic
983547159 4:168976452-168976474 CTGAAAAAGGAGTCAGCAAAGGG + Intronic
984271031 4:177548885-177548907 CTCACAAAGGAGGAGGGCAGTGG - Intergenic
984296819 4:177863008-177863030 CTGAACAAGAACTCGGGCAAAGG + Intronic
984360349 4:178722078-178722100 CTCAAAAAAGACTCTTGCAAAGG - Intergenic
984540911 4:181035857-181035879 CTCAACAGAGAGTCGTGCAATGG + Intergenic
985413403 4:189710847-189710869 CTCAAAAATTAGTTGGGCCATGG + Intergenic
986611782 5:9575681-9575703 CACAAGAAGGAGTTGGGGAAGGG - Intergenic
989677229 5:43986013-43986035 CTGAAGATAGAGTCGGGCAATGG - Intergenic
990564575 5:57016543-57016565 CTGAAAAAGGAGTCAGCAAAGGG + Intergenic
991468302 5:66938520-66938542 TTTAAAGAGGAGTTGGGCAAAGG + Intronic
994325524 5:98441226-98441248 CTGAAAAAGGAGTCAGCAAAGGG - Intergenic
996723743 5:126655398-126655420 CTCTGAAAGGAGTAGGCCAAAGG - Intergenic
999375272 5:151082066-151082088 CTCAAAAAGAATTAGGGGAAAGG + Intronic
1000930329 5:167243672-167243694 CTCAAAAAAGGGTGGGGCAGAGG - Intergenic
1002105490 5:176877671-176877693 CTCAAAAAGCAGTCGTGCGAGGG + Exonic
1006992384 6:38226429-38226451 CTGCAAAAGGAGTCAGGAAATGG + Intronic
1011983567 6:93416987-93417009 CTCGAGAAGGAGTCGGGAAGAGG + Intronic
1012450770 6:99350501-99350523 CTGAAAAAGGATTCGGGCCGTGG + Intergenic
1014115605 6:117664863-117664885 CTGAAAAAGGAGTCAGCAAAGGG + Intergenic
1016256086 6:142107272-142107294 CTCAAAAACCAGTCTTGCAAAGG + Intergenic
1018155958 6:160985243-160985265 GTCTGAAAGGAGTCGGGGAAGGG + Intergenic
1019941324 7:4293995-4294017 CTCAAAACAGAATGGGGCAAAGG + Intergenic
1023520542 7:41046208-41046230 CTCTAAGAGGAGGAGGGCAATGG + Intergenic
1023916832 7:44596312-44596334 CCCAGAAAGTAGTCGGCCAAGGG + Intergenic
1024017362 7:45329254-45329276 CTCACAAAGGTGTTGGGGAAAGG + Intergenic
1024169543 7:46769566-46769588 CCAAAAAAGGAGTCGGCAAAGGG - Intergenic
1027600396 7:80233057-80233079 CACAAAAAGGAGCCAGGAAATGG - Intergenic
1029413596 7:100430076-100430098 CTCAAAGATGAGTCGGGCGGAGG + Exonic
1029434990 7:100558837-100558859 CTCAAAAAGCAGTCAGTCACTGG + Intronic
1030167263 7:106567727-106567749 CTGAAAAAGGAGTCAGCAAAGGG - Intergenic
1031075866 7:117211629-117211651 CCAAAAAAGGGGTGGGGCAAAGG + Intronic
1031619257 7:123916447-123916469 CTTAACAAGGGGTGGGGCAAGGG - Intergenic
1032456627 7:132077897-132077919 CACAAACAGGAGCCGGACAAAGG + Intergenic
1032564307 7:132925835-132925857 CTCAAAAACGAGTTGGGGATGGG + Intronic
1033943766 7:146688423-146688445 CTGAAAAAGGAGTCAGCAAAGGG + Intronic
1034974283 7:155438873-155438895 CTTGAAAAGGAGACGGCCAAGGG - Intergenic
1035424933 7:158763922-158763944 CTCACAAAGGAGTGGGGGAGAGG + Intronic
1036004295 8:4644406-4644428 CTCAAAAAAAAATAGGGCAAAGG - Intronic
1038257796 8:25966648-25966670 CTCAAAGAGGAGATGGGCCAAGG - Intronic
1039180816 8:34864136-34864158 CTCAAGAGAGAGTTGGGCAATGG + Intergenic
1042147280 8:65743291-65743313 TTCAAAAAGGAGAAGGGCCAAGG + Intronic
1043707876 8:83376712-83376734 CTCAAAAAGAAGTACAGCAATGG - Intergenic
1044413540 8:91910893-91910915 TTCAGAAAGGAGTGGGGCAAAGG + Intergenic
1046550550 8:115710261-115710283 CTGAAAAAGGAGTCAGCAAAGGG - Intronic
1049498983 8:142951244-142951266 CTTCAAAAAGAGTCGGGGAAAGG - Intergenic
1049819890 8:144627100-144627122 CTCACAAAGGAGCCAGGCCAAGG + Intergenic
1051226873 9:14908490-14908512 GGAAAAAAGGAGTTGGGCAAAGG - Intronic
1052393106 9:27904407-27904429 CTCAAAAAGCAGGCAGGGAAGGG + Intergenic
1056468260 9:86880024-86880046 GTAAAAAAGGAATAGGGCAATGG - Intergenic
1057178266 9:93014974-93014996 CTCACAAAGGGGTGGGACAAGGG - Intronic
1057392410 9:94650808-94650830 CTGAAAAAGGAGTCAGCAAAGGG - Intergenic
1057802182 9:98197249-98197271 ATCAAAAAAGAATCAGGCAACGG - Intergenic
1060949421 9:127591927-127591949 CTCAAAAAGGAGGCTGGGCATGG - Intergenic
1061615221 9:131774760-131774782 CTGGAAAAGGAGTCGGGCTGTGG + Intergenic
1203639553 Un_KI270750v1:147542-147564 CTCAAAAATTAGTTGGGCCATGG - Intergenic
1185515638 X:697068-697090 CTGAAAAAGGAGTCAGCAAAGGG + Intergenic
1187850489 X:23586859-23586881 CTCAAAAAGAGGTTGGTCAAAGG + Intergenic
1188381946 X:29505833-29505855 TTCAAGAGGGAGTCGGTCAAGGG - Intronic
1188671799 X:32889778-32889800 CTGAAAAAGGAGTCAGCCAAGGG - Intronic
1188890800 X:35609713-35609735 CTGAAAAAGGAGTCAGCCAAGGG - Intergenic
1189134483 X:38534324-38534346 CTCAAAGAGGAGGTGGGCACAGG + Intronic
1189824460 X:44902888-44902910 GACAAAAAGCAGTAGGGCAAAGG + Intronic
1190086323 X:47398355-47398377 CAGCAAAAGGAGTGGGGCAATGG - Intronic
1191887900 X:65907920-65907942 CTGGAAAAGGAGTTGGGTAAAGG + Intergenic
1193536797 X:82727085-82727107 CTGAAAAAGGAGTCAGCAAAGGG - Intergenic
1193537622 X:82732837-82732859 CTGAAAAAGGAGTCAGCAAAGGG - Intergenic
1195633196 X:107082053-107082075 GTCAAAAAGAAGTGGGGAAAGGG + Intronic
1195879388 X:109576499-109576521 CTGAAAAAGGAGTCAGCAAAGGG - Intergenic
1196222013 X:113122490-113122512 CTGAAAAAGGAGTCAGCAAAGGG + Intergenic
1197007239 X:121515876-121515898 CTCAAAAAGGAGGCAGACAAAGG + Intergenic
1200203213 X:154296514-154296536 ATAAAAAATGAGTCGGGCATGGG + Intronic
1201362186 Y:13164582-13164604 CTAAAAAAGGAGTCAGCAAAGGG + Intergenic
1201484245 Y:14475353-14475375 CTGAAAAAGGAGTCAGCAAAGGG + Intergenic