ID: 950423990

View in Genome Browser
Species Human (GRCh38)
Location 3:12914816-12914838
Sequence GGGCCTCAGAGGACACACCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 222}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950423986_950423990 -4 Left 950423986 3:12914797-12914819 CCAGGTAGCGGACAGGGCAGGGC 0: 1
1: 1
2: 1
3: 19
4: 247
Right 950423990 3:12914816-12914838 GGGCCTCAGAGGACACACCGGGG 0: 1
1: 0
2: 1
3: 18
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950423990 Original CRISPR GGGCCTCAGAGGACACACCG GGG Intronic
900707705 1:4090722-4090744 GAGCCTCATGGGACTCACCGTGG - Intergenic
901184782 1:7365949-7365971 GGGCCATAGAGGACACCCCCAGG - Intronic
901699740 1:11038814-11038836 GGGCCTCAGAGGGCAGAGCCAGG + Intronic
902361154 1:15943329-15943351 GGGGCTCAGAAGACAAACTGGGG - Intronic
902809416 1:18879821-18879843 AGGCCTGAGAGGCCAAACCGAGG + Intronic
903586998 1:24423666-24423688 GGGCCACACGGGACACACCAAGG + Intronic
903653283 1:24933768-24933790 GGGCCTCAGCGGACACTGCCAGG + Intronic
903811910 1:26039309-26039331 GGGGCCGAGAGGACACAGCGGGG + Intronic
904088996 1:27931355-27931377 GGAGGTCAGAGGACACACCCTGG + Intergenic
904246590 1:29192431-29192453 GGCCTTGAGAGGACACACAGGGG - Intergenic
907335295 1:53695608-53695630 GGGCCTCCCAGGACACAGGGTGG - Intronic
914363133 1:146953137-146953159 GAGTCTCAGAGGACAGGCCGTGG + Intronic
916060744 1:161097090-161097112 GGTCCTCAGAGAACACAGCATGG - Intergenic
920105043 1:203546594-203546616 GGTCCTCAGTGGACTCACCAGGG + Intergenic
921370517 1:214418248-214418270 GAGCCTCAGACGACCCACAGTGG + Intronic
922579524 1:226686541-226686563 GGGCCCCAGAGGATGCACAGAGG - Intronic
923339654 1:232996492-232996514 GGGCCTCAGAGTAAACAGCATGG + Intronic
923793656 1:237133067-237133089 GGACTTCAGAGGAGACAGCGTGG + Intronic
1063171042 10:3510272-3510294 GGGCATCGGAGGACAGACTGTGG + Intergenic
1069960313 10:72075433-72075455 GGGCCTCAGATGACACCCAGGGG - Intronic
1070619792 10:78000411-78000433 GGACCTCAGAGGACACCCTGTGG + Intronic
1070724707 10:78780122-78780144 GAGCCTCTGAGCACACAGCGTGG - Intergenic
1071358393 10:84820915-84820937 GTTCCTCATAGGACACACCCTGG - Intergenic
1074159916 10:110829014-110829036 GGGACTCAGAGGACTCAACAGGG + Intronic
1074229337 10:111517875-111517897 GGTGCTCAGAGGACACCCCCAGG + Intergenic
1075105384 10:119536806-119536828 AGGCCCCAGAGGACACACAGGGG - Intronic
1075394568 10:122117680-122117702 GGACCTCAGAGGACCAAGCGTGG - Intronic
1075587835 10:123670172-123670194 AGGACACAGAGGACACACTGGGG - Intronic
1075655835 10:124160543-124160565 GTGCCTCAGAGGAGACAGCCTGG - Intergenic
1076776230 10:132699635-132699657 TGGCCTCTCAGGACACACCTCGG - Intronic
1077499589 11:2903134-2903156 GGACCTTAGAGGACACATCAGGG - Intronic
1080520780 11:33066280-33066302 GGGCCTTAGAGGCCACACCAAGG + Intronic
1083606067 11:63979590-63979612 GGGCCTGAGAGGACAGTCAGGGG - Intronic
1083669526 11:64292278-64292300 GGTCCGCAAAGGCCACACCGGGG - Intronic
1084019783 11:66410581-66410603 GGGCCCCAGAGGACAGCCTGTGG + Intergenic
1084116058 11:67043584-67043606 GGGCCTGAGAGGCCACAGCAGGG - Intronic
1084196079 11:67524126-67524148 GGGCCCCGGAGGACAGACCCAGG - Intergenic
1084367315 11:68710684-68710706 GGGCCTCTAAGGAAACACAGTGG + Intronic
1084467597 11:69335291-69335313 GAGCCTCGGTGGACACACCTGGG + Intronic
1089352156 11:117827977-117827999 GGGGCTCAGAGGACTCACCCAGG + Intronic
1089502088 11:118938622-118938644 GGGCCTGAGATGACTCACTGGGG + Intronic
1094411428 12:30171443-30171465 TGGCCTCAGTGGAGACACCTTGG - Intergenic
1102416440 12:112766931-112766953 GGGCCCCAGAGCACACACAAAGG + Intronic
1104383948 12:128332713-128332735 GGTCCACAGTGGACACACCAGGG - Intronic
1104909074 12:132231034-132231056 GGGCGACAGAGGAGACAGCGTGG + Intronic
1104909082 12:132231082-132231104 GGGCGACAGAGGAGACAGCGTGG + Intronic
1104909092 12:132231130-132231152 GGGCGACAGAGGAGACAGCGTGG + Intronic
1104909101 12:132231178-132231200 GGGCGACAGAGGAGACAGCGTGG + Intronic
1104909110 12:132231227-132231249 GGGCGACAGAGGAGACAGCGTGG + Intronic
1104909118 12:132231275-132231297 GGGCGACAGAGGAGACAGCGTGG + Intronic
1104909126 12:132231323-132231345 GGGCGACAGAGGAGACAGCGTGG + Intronic
1104909135 12:132231371-132231393 GGGCGACAGAGGAGACAGCGTGG + Intronic
1104909143 12:132231419-132231441 GGGCGACAGAGGAGACAGCGTGG + Intronic
1104909151 12:132231467-132231489 GGGCGACAGAGGAGACAGCGTGG + Intronic
1104909160 12:132231515-132231537 GGGCGACAGAGGAGACAGCGTGG + Intronic
1104909169 12:132231563-132231585 GGGCGACAGAGGAGACAGCGTGG + Intronic
1104909178 12:132231611-132231633 GGGCGACAGAGGAGACAGCGTGG + Intronic
1104909187 12:132231659-132231681 GGGCGACAGAGGAGACAGCGTGG + Intronic
1104909195 12:132231707-132231729 GGGCGACAGAGGAGACAGCGTGG + Intronic
1104909212 12:132231800-132231822 GGGCGACAGAGGAGACAGCGTGG + Intronic
1104909220 12:132231848-132231870 GGGCGACAGAGGAGACAGCGTGG + Intronic
1104909228 12:132231896-132231918 GGGCGACAGAGGAGACAGCGTGG + Intronic
1104909252 12:132232040-132232062 GGGCGACAGAGGAGACAGCGTGG + Intronic
1104909261 12:132232088-132232110 GGGCGACAGAGGAGACAGCGTGG + Intronic
1104909269 12:132232136-132232158 GGGCGACAGAGGAGACAGCGTGG + Intronic
1104909277 12:132232184-132232206 GGGCGACAGAGGAGACAGCGTGG + Intronic
1104909285 12:132232232-132232254 GGGCGACAGAGGAGACAGCGTGG + Intronic
1104909302 12:132232325-132232347 GGGCGACAGAGGAGACAGCGTGG + Intronic
1104909318 12:132232421-132232443 GGGCGACAGAGGAGACAGCGTGG + Intronic
1104909326 12:132232469-132232491 GGGCGACAGAGGAGACAGCGTGG + Intronic
1104909334 12:132232517-132232539 GGGCGACAGAGGAGACAGCGTGG + Intronic
1104909350 12:132232613-132232635 GGGCGACAGAGGAGACAGCGTGG + Intronic
1104909366 12:132232709-132232731 GGGCGACAGAGGAGACAGCGTGG + Intronic
1104909382 12:132232805-132232827 GGGCGACAGAGGAGACAGCGTGG + Intronic
1104909398 12:132232901-132232923 GGGCGACAGAGGAGACAGCGTGG + Intronic
1104909406 12:132232949-132232971 GGGCGACAGAGGAGACAGCGTGG + Intronic
1104909414 12:132232997-132233019 GGGCGACAGAGGAGACAGCGTGG + Intronic
1104909422 12:132233045-132233067 GGGCGACAGAGGAGACAGCGTGG + Intronic
1104909430 12:132233093-132233115 GGGCGACAGAGGAGACAGCGTGG + Intronic
1104909449 12:132233188-132233210 GGGCGACAGAGGAGACAGCGTGG + Intronic
1104909457 12:132233236-132233258 GGGCGACAGAGGAGACAGCGTGG + Intronic
1104909466 12:132233284-132233306 GGGCGACAGAGGAGACAGCGTGG + Intronic
1104909474 12:132233332-132233354 GGGCGACAGAGGAGACAGCGTGG + Intronic
1104909483 12:132233380-132233402 GGGCGACAGAGGAGACAGCGTGG + Intronic
1104909492 12:132233428-132233450 GGGCGACAGAGGAGACAGCGTGG + Intronic
1104909515 12:132233572-132233594 GGGCGACAGAGGAGACAGCGTGG + Intronic
1104909524 12:132233620-132233642 GGGCGACAGAGGAGACAGCGTGG + Intronic
1104909538 12:132233716-132233738 GGGCGACAGAGGAGACAGCGTGG + Intronic
1104909547 12:132233764-132233786 GGGCGACAGAGGAGACAGCGTGG + Intronic
1104909563 12:132233860-132233882 GGGCGACAGAGGAGACAGCGTGG + Intronic
1104909580 12:132233956-132233978 GGGCGACAGAGGAGACAGCGTGG + Intronic
1104909589 12:132234004-132234026 GGGCGACAGAGGAGACAGCGTGG + Intronic
1104909603 12:132234100-132234122 GGGCGACAGAGGAGACAGCGTGG + Intronic
1104909611 12:132234148-132234170 GGGCGACAGAGGAGACAGCGTGG + Intronic
1104909619 12:132234196-132234218 GGGCGACAGAGGAGACAGCGTGG + Intronic
1104909627 12:132234244-132234266 GGGCGACAGAGGAGACAGCGTGG + Intronic
1104909635 12:132234292-132234314 GGGCGACAGAGGAGACAGCGTGG + Intronic
1104909643 12:132234340-132234362 GGGCGACAGAGGAGACAGCGTGG + Intronic
1104909652 12:132234388-132234410 GGGCGACAGAGGAGACAGCGTGG + Intronic
1104909668 12:132234484-132234506 GGGCGACAGAGGAGACAGCGTGG + Intronic
1104909685 12:132234580-132234602 GGGCGACAGAGGAGACAGCGTGG + Intronic
1104909694 12:132234628-132234650 GGGCGACAGAGGAGACAGCGTGG + Intronic
1104909714 12:132234772-132234794 GGGCGACAGAGGAGACAGCGTGG + Intronic
1104909723 12:132234820-132234842 GGGCGACAGAGGAGACAGCGTGG + Intronic
1104909739 12:132234916-132234938 GGGCGACAGAGGAGACAGCGTGG + Intronic
1104909756 12:132235012-132235034 GGGCGACAGAGGAGACAGCGTGG + Intronic
1104909765 12:132235060-132235082 GGGCGACAGAGGAGACAGCGTGG + Intronic
1104995213 12:132649854-132649876 AGGCCTCAGAAGACAGTCCGAGG - Exonic
1106328640 13:28718610-28718632 GGGCAACAGAGGACGCGCCGGGG + Exonic
1108712227 13:53044810-53044832 GGACCACAGAGGACTCACTGAGG + Intronic
1112003812 13:95236952-95236974 GGGCCGCAGCAGACACACCTGGG + Intronic
1113823182 13:113230045-113230067 TGGCCACAGAGGACACACAGGGG - Intronic
1113842211 13:113366541-113366563 GGGCCTCAGGGGCCACACCAGGG + Intergenic
1113858140 13:113460738-113460760 GGTCCTCAGAGGAGACAACACGG + Intronic
1113872139 13:113565849-113565871 GGGTCTGAGAGGACAGACTGAGG - Intergenic
1116288553 14:43004082-43004104 GGGACCCAGAGGACACAGGGAGG + Intergenic
1117834737 14:59791862-59791884 GGTCCTCTGATGAGACACCGAGG + Intronic
1118706651 14:68486369-68486391 GGGCCCCAGAGGACAGCCAGTGG - Intronic
1119874211 14:78043260-78043282 GGGACTCAGTGGAGACACCCAGG - Intergenic
1122437843 14:101711711-101711733 AGTCCTCAGAGGAAACACAGAGG + Intergenic
1122548443 14:102537678-102537700 AGGCCTCAGTGGAGACACTGTGG - Intergenic
1122785681 14:104162367-104162389 GGGCCACAGCGGGCACACCCAGG - Intronic
1122843682 14:104479050-104479072 GGGCCTCAGAGGGCAGAACCTGG - Intronic
1124661527 15:31554188-31554210 GGGCCTCAGAGGCTACTCTGGGG - Intronic
1125492883 15:40161285-40161307 GGGCCTGAGAGGACACGGCCTGG + Intronic
1125520435 15:40345193-40345215 GGTCCTCAGAGCACAGACCTGGG + Intergenic
1127650939 15:61006460-61006482 GGGCTTCAGAGTACACCCAGGGG - Intronic
1128779367 15:70348732-70348754 GGGCCCCAGAGGACAGAACTGGG - Intergenic
1130965529 15:88694966-88694988 ACGCCTCAGAGGACACCCCATGG + Intergenic
1136312663 16:29423421-29423443 GGGCGTTATAGGACAGACCGTGG - Intergenic
1136381446 16:29897913-29897935 GGGCCTCAGAGGCCACCGTGGGG + Exonic
1138578791 16:57926179-57926201 GAGCCTCTGAGAACACACCCTGG + Intronic
1139700715 16:68706447-68706469 GGGCCTTGGAGTACACACCTGGG + Intronic
1140727040 16:77822813-77822835 GAGCCCCAGAAGACACACTGGGG + Intronic
1141460998 16:84178928-84178950 GGGCTTCTGAGGACACAAGGTGG - Exonic
1141854713 16:86673300-86673322 GGGCCTGAGAGGACAGTCTGGGG - Intergenic
1142213145 16:88817851-88817873 GTGCCTCAGAGCACACGCGGCGG - Intronic
1144371460 17:14595503-14595525 GGGCATCAGAGGACAGTCTGAGG + Intergenic
1146790453 17:35747831-35747853 GGCCCTCAGGGGACTCACAGAGG + Exonic
1150168498 17:62966682-62966704 GGTCCTCACAGGAGACCCCGGGG + Intergenic
1151550002 17:74817032-74817054 AGACCTCAGCGGCCACACCGTGG + Intronic
1152865854 17:82722519-82722541 GGGCACCAGAGGACACACACAGG - Intronic
1152987022 18:330353-330375 CAGCCCCAGAGGCCACACCGTGG + Intronic
1154367836 18:13727135-13727157 GGGCCCGAGAGGACGCACAGAGG - Intronic
1157474875 18:48017043-48017065 GGTCCTGAGAGGAGACACTGGGG + Intergenic
1158508374 18:58067528-58067550 GGGCCTGCGAGGACACACTTGGG + Intronic
1159590115 18:70325069-70325091 GGGCCGCAGAGGCCACGGCGCGG - Exonic
1159922506 18:74238362-74238384 GGGTCTCCCAGGACACACTGAGG + Intergenic
1161013068 19:1969416-1969438 AGGCCACAGAGGACACAGCCAGG - Intronic
1161707062 19:5827177-5827199 GGGCCTCAGAGCAGACGTCGGGG + Intronic
1162762716 19:12897873-12897895 GGACCTCAGAGGGCTCACTGAGG + Intronic
1163144779 19:15373054-15373076 GGGGCTCAGAGGACGCAGCGGGG + Exonic
1163241158 19:16064666-16064688 GGGTCTCTGGGGACACAGCGGGG + Intergenic
1165346470 19:35251612-35251634 GGTCCGCAGAGGACTCACAGAGG + Intronic
1165395474 19:35561379-35561401 GGGGCCCAGGGGACACACAGAGG - Intronic
1167301355 19:48679864-48679886 AGGCCTCAGAGCACAGACCCTGG - Intergenic
1167676848 19:50892640-50892662 GGGCCTCAGAGAGCTCACAGCGG - Intergenic
926143156 2:10380540-10380562 GGCCCTCTGTGGACACACCATGG - Intronic
927506784 2:23620113-23620135 GGGGCCCAGTGGACACACAGAGG + Intronic
927518678 2:23686600-23686622 GGGCATCAGAGGTCACAGGGAGG + Intronic
928303547 2:30147402-30147424 GGGCCTCGGAGGACGCGACGGGG - Intronic
930878877 2:56249509-56249531 CAGCCTCAGAAGACACACTGTGG + Intronic
931253120 2:60550773-60550795 GGGGCTCAAAGGACAGACCGGGG - Intronic
936241805 2:110794263-110794285 GGGCCAGAGAGCACACACAGAGG - Intronic
937094233 2:119225100-119225122 GTGACTGAGAGGACACACCCAGG - Intronic
937958975 2:127439897-127439919 GGGCCTCAGAGTCCACACTGTGG - Intronic
938247508 2:129790395-129790417 GGGCTCCAGTGGACACACCATGG + Intergenic
940117523 2:150225419-150225441 GGACCTCAAAGGATACACTGGGG - Intergenic
943903581 2:193471345-193471367 GGGACCCAGAGGACACAGTGAGG + Intergenic
945431703 2:209772169-209772191 GGGGCGCAGAGGGCGCACCGCGG + Intronic
946049452 2:216849852-216849874 GGAGCTCAGAGGACACTCCCAGG - Intergenic
947535088 2:230935059-230935081 GGGTCTCAGAGGAAACGCCTGGG + Intronic
948601748 2:239111465-239111487 GGGCCACAGTGGGCACAGCGCGG - Intronic
1171164582 20:22958660-22958682 GAGCATCCGAGGACACACAGGGG + Intergenic
1171978109 20:31608302-31608324 GTGCCTCCGAGGACACTCCAAGG - Intergenic
1175981846 20:62742675-62742697 TGTCCTCAGAGGAGACACCATGG - Intronic
1176253313 20:64137586-64137608 AGGCCTCGGAGGACACAGGGAGG + Intergenic
1178106081 21:29320799-29320821 GGTCCCCAGAGGTCACACCTTGG - Intronic
1178714085 21:34947812-34947834 GGACCTCAGAGGAAACACTTTGG - Intronic
1178852882 21:36227873-36227895 GCCCCTCAGAGTACACACCGAGG - Exonic
1180972140 22:19821300-19821322 GTGCCTCGGAGGACAAACTGGGG + Exonic
1181597273 22:23924293-23924315 GGGCCTTGGAGGACTCCCCGAGG - Intergenic
1183524795 22:38316876-38316898 GGGCCTCGGAGGGCCCAGCGGGG + Intronic
1184760758 22:46542768-46542790 GAGCCTCAGAGTGCACAGCGTGG + Intergenic
1184974614 22:48052163-48052185 GGGCCTCAGATCACACACTGGGG + Intergenic
1185289768 22:50017458-50017480 GGGCCTGATGGGACCCACCGGGG + Intronic
1185416655 22:50714342-50714364 GGTCCTCAGTGGACCCACAGGGG + Intergenic
950423990 3:12914816-12914838 GGGCCTCAGAGGACACACCGGGG + Intronic
950441848 3:13015111-13015133 GGCCCTCAGAAGTCACACAGTGG - Intronic
952274452 3:31864089-31864111 AGGCCTCCGAGGACACACGGTGG + Intronic
955333093 3:58063541-58063563 GGCCCTCAGAGGACAGATAGGGG - Intronic
961573846 3:127819388-127819410 GGACCTCAGAAGCCACCCCGGGG - Intronic
966257242 3:177930901-177930923 GGGCACCAGAGGATACACTGTGG + Intergenic
968571711 4:1345741-1345763 AGGGCTGAGAGGACACCCCGGGG + Intergenic
969524283 4:7696221-7696243 GGGCCCCAGAGGCCCCACCCTGG - Intronic
978016788 4:103754292-103754314 GGGTCTCTGAGGACACAGGGTGG + Intergenic
982057304 4:151564959-151564981 GGGCTTCAGAGGAGACTCAGGGG - Intronic
984570283 4:181383788-181383810 GGGCCTCAGAGGCCACGGTGAGG - Intergenic
985494079 5:194816-194838 GGACCTCAGTGGACACAACCTGG + Exonic
985812980 5:2103703-2103725 GTGCCTCAGAAAACACAGCGAGG - Intergenic
985875471 5:2591067-2591089 GGGCCTCAGGGGAGTCACCGAGG + Intergenic
987080215 5:14419216-14419238 GGGCCTCAGGAGCCACACCAAGG + Intronic
990596580 5:57318172-57318194 GAGCCGCAGAGGACACATCCAGG - Intergenic
993902460 5:93593877-93593899 GAGACTCAGAGGACCCACCTGGG + Exonic
1001966410 5:175912980-175913002 TGGGCTCAGAGGACACAGCAGGG + Intergenic
1002250537 5:177926224-177926246 TGGGCTCAGAGGACACAGCAGGG - Intergenic
1002345334 5:178544526-178544548 GGGCCTCAGAGTACTCACAGCGG - Intronic
1002877124 6:1220679-1220701 GGGCTTCAGAGGACACCCCAGGG + Intergenic
1006375958 6:33671724-33671746 GGGGCTGAGAGGACACTGCGGGG - Intronic
1016880922 6:148911274-148911296 GAGCCTCAGAGCTCACACCCTGG + Intronic
1019329397 7:455221-455243 GGGCCCCCGAGGACACACGGGGG - Intergenic
1019428391 7:987813-987835 GGGACCCCCAGGACACACCGAGG - Intronic
1019919069 7:4151269-4151291 TGGCCCCAGAGGACCCACCCTGG + Intronic
1020285442 7:6676049-6676071 GAACATCAGAGGACACACCCAGG + Intergenic
1021576247 7:22108629-22108651 GGGCCCCAGGGCACACACTGGGG + Intergenic
1021871711 7:25013512-25013534 GGGCCTCAGAGAGCACTCTGGGG + Intergenic
1022293811 7:29030444-29030466 GGGCCACAGAAGACACACACTGG + Intronic
1022510517 7:30932410-30932432 GGCCCTCAGAGAAAACACCCAGG - Intergenic
1027275261 7:76549613-76549635 AGGCCTCTGAGGACACACACGGG - Intergenic
1029724914 7:102396431-102396453 GGGCCTCGGTGGTCGCACCGAGG - Exonic
1034635440 7:152563736-152563758 GGACCTCAGTGGACTCACAGAGG - Intergenic
1036750569 8:11441259-11441281 GGACCTGAGAGGACAGACCCAGG - Intronic
1037760938 8:21741165-21741187 GGGCCTCACAGGCCACAGCAAGG - Intronic
1047695132 8:127395868-127395890 GCTTCACAGAGGACACACCGAGG - Intergenic
1047940942 8:129826911-129826933 GGGCCTGAGGGGTCACACTGAGG + Intergenic
1048901322 8:139040372-139040394 GTGCCCCAGAAGACGCACCGTGG - Intergenic
1049316935 8:141974365-141974387 GGGTCTCAGAGCTCCCACCGTGG + Intergenic
1049331587 8:142056897-142056919 TGGGCTCAGAGAACACCCCGTGG - Intergenic
1049357606 8:142196434-142196456 GGGGCTCAGAGGCCACACCGAGG - Intergenic
1053157371 9:35790952-35790974 GGGCCTCTGAGGACACGAGGAGG + Intergenic
1053445980 9:38153573-38153595 AGGGCTCAGAGGCCACACGGTGG - Intergenic
1056101050 9:83301102-83301124 GGACCCCTGAGGACACACAGAGG + Intronic
1057497937 9:95575016-95575038 GGGACTCAGAGGACAGCCTGGGG - Intergenic
1059421587 9:114195810-114195832 AGGCCTCAGAGGAGACTCGGGGG - Intronic
1060545319 9:124455931-124455953 GGGCCTCAGAGGACAGAACTGGG + Intronic
1061402515 9:130376132-130376154 GGGCTCCAGAGGACACAATGAGG + Intronic
1061800581 9:133111599-133111621 TGTCCTCAGAGGACTCACAGTGG + Intronic
1192151883 X:68717776-68717798 CATCCTCAGTGGACACACCGGGG + Exonic
1193173735 X:78367611-78367633 TGGTTTCAGAAGACACACCGTGG + Intergenic
1196736492 X:118985335-118985357 GGGCTTCAGAGGACCAACCTTGG + Intronic
1197719780 X:129737436-129737458 CAGCCTCAGAGGACAGACCAGGG - Intergenic
1198871504 X:141180642-141180664 GGGTCTCAGAGCACACTCAGAGG - Intergenic