ID: 950424596

View in Genome Browser
Species Human (GRCh38)
Location 3:12918256-12918278
Sequence GTGCACCCCATTCCCAAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 1, 2: 1, 3: 17, 4: 115}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950424596_950424600 -2 Left 950424596 3:12918256-12918278 CCCTTCTTGGGAATGGGGTGCAC 0: 1
1: 1
2: 1
3: 17
4: 115
Right 950424600 3:12918277-12918299 ACAGCCCCTTCCATGGGAAGTGG 0: 1
1: 0
2: 2
3: 21
4: 240
950424596_950424602 0 Left 950424596 3:12918256-12918278 CCCTTCTTGGGAATGGGGTGCAC 0: 1
1: 1
2: 1
3: 17
4: 115
Right 950424602 3:12918279-12918301 AGCCCCTTCCATGGGAAGTGGGG 0: 1
1: 1
2: 2
3: 26
4: 224
950424596_950424601 -1 Left 950424596 3:12918256-12918278 CCCTTCTTGGGAATGGGGTGCAC 0: 1
1: 1
2: 1
3: 17
4: 115
Right 950424601 3:12918278-12918300 CAGCCCCTTCCATGGGAAGTGGG 0: 1
1: 1
2: 1
3: 24
4: 214
950424596_950424605 3 Left 950424596 3:12918256-12918278 CCCTTCTTGGGAATGGGGTGCAC 0: 1
1: 1
2: 1
3: 17
4: 115
Right 950424605 3:12918282-12918304 CCCTTCCATGGGAAGTGGGGAGG 0: 1
1: 0
2: 2
3: 30
4: 256
950424596_950424598 -9 Left 950424596 3:12918256-12918278 CCCTTCTTGGGAATGGGGTGCAC 0: 1
1: 1
2: 1
3: 17
4: 115
Right 950424598 3:12918270-12918292 GGGGTGCACAGCCCCTTCCATGG 0: 1
1: 0
2: 0
3: 26
4: 242
950424596_950424599 -8 Left 950424596 3:12918256-12918278 CCCTTCTTGGGAATGGGGTGCAC 0: 1
1: 1
2: 1
3: 17
4: 115
Right 950424599 3:12918271-12918293 GGGTGCACAGCCCCTTCCATGGG 0: 1
1: 0
2: 0
3: 17
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950424596 Original CRISPR GTGCACCCCATTCCCAAGAA GGG (reversed) Intronic
900408660 1:2503283-2503305 GTGGCCCCCAGTCCCAGGAAAGG - Intronic
901811400 1:11768702-11768724 GAGCACCCCTTTCCCAAGGAGGG - Intronic
902575131 1:17372783-17372805 AAGCACCCAATTCCCAAGAAGGG - Intronic
908828232 1:68153890-68153912 GGGCATCCCATTCACAATAACGG + Intronic
912085114 1:105991478-105991500 GTGCACACCATTGCCAAGTCTGG - Intergenic
913384166 1:118241447-118241469 GTGCACCCAACACCCAAGCAGGG - Intergenic
917028646 1:170666785-170666807 GTGGACGCCACTCCCAAGAAGGG + Intronic
1067274458 10:44821629-44821651 GTGAAGCCCATTCCCATGAACGG - Intergenic
1069828604 10:71269362-71269384 GTGCACCAGACTCCCAGGAAAGG - Intronic
1072117976 10:92381997-92382019 GAGCACCCCACTCCTAAGCATGG - Intergenic
1072120536 10:92402058-92402080 GTTCAGCCTATGCCCAAGAATGG - Intergenic
1073212956 10:101819271-101819293 GCGCTCCCCATTCCCAAACAAGG - Intergenic
1075246236 10:120824404-120824426 GGGAGCCCCATTCCCAAGCATGG + Intergenic
1076541285 10:131216778-131216800 GTGCACCCCACTCCCATGCCTGG - Intronic
1077614423 11:3664840-3664862 GTCCACCCCATTCCCACACACGG - Intergenic
1078661612 11:13292023-13292045 GTTCACTCCATTCCTAGGAAAGG - Intronic
1079903760 11:26220795-26220817 GAGCATCCCATTCCCAGGGATGG + Intergenic
1080295811 11:30725980-30726002 GTGCAACTTATTCCCAAGAAAGG + Intergenic
1080383193 11:31795493-31795515 GTGCAACACATTACAAAGAATGG - Intronic
1081988561 11:47325160-47325182 GTGCTCCCCAATCAAAAGAAAGG - Intronic
1082132905 11:48512859-48512881 ATGCACCCCAGTTCCAATAAAGG - Intergenic
1082139387 11:48590288-48590310 GTGCACGCCAGTTCCAATAATGG - Intergenic
1082622818 11:55444971-55444993 GTGCACACCATTTCCAATAATGG - Intergenic
1082624565 11:55467311-55467333 GTGCACGCCAGTTCCAATAATGG - Intergenic
1083476262 11:62917536-62917558 GTTCACCCCATTCCACAGAAGGG - Intronic
1083894837 11:65614587-65614609 GTTCACCCCCTTCCCAAGTGTGG - Intronic
1084473573 11:69376652-69376674 TGGCACCCCCTTCCCAGGAAGGG - Intergenic
1085743361 11:79095122-79095144 CTGGACCCCATTTCCAAGAGGGG - Intronic
1086750997 11:90493466-90493488 TTGCACCTAATTCACAAGAATGG - Intergenic
1087673249 11:101129598-101129620 GTACAGCCCATTCCCAGGAAGGG + Exonic
1089242357 11:117092609-117092631 GTGCACTCCAGACCCTAGAATGG + Intronic
1089277400 11:117347007-117347029 ATGCACCCCCTCCCCAACAATGG + Intronic
1089737035 11:120556651-120556673 GTTAAGCCCATTCCCAAGACAGG - Intronic
1090737145 11:129619849-129619871 GTGCACCCCTTCCCGATGAAAGG + Intergenic
1091227823 11:133968275-133968297 GTGCCCCACACGCCCAAGAAAGG + Intergenic
1092528786 12:9327169-9327191 GTGCACCCCCGCCCCCAGAAGGG - Intergenic
1095708042 12:45258995-45259017 ATCCACCCCTTCCCCAAGAAGGG - Intronic
1096589465 12:52648043-52648065 TTGGGCACCATTCCCAAGAAAGG - Intronic
1098304357 12:69087588-69087610 CTGTGCCCCATTCCCAAGAGTGG - Intergenic
1098881256 12:75919805-75919827 GGGCACCACATACCCAAAAAGGG + Intergenic
1099546996 12:83996188-83996210 GTGCACACCATTGCCAACTATGG - Intergenic
1100906276 12:99303719-99303741 GTGCACCCATTACCCAAGGAGGG + Intronic
1105221068 13:18327963-18327985 GGTCACCCCATTCCAAAGCATGG - Intergenic
1107819293 13:44271885-44271907 TTGCACCCCGTTCTCTAGAAGGG + Intergenic
1109133519 13:58618554-58618576 GTGCACCCCATTCCTTTGAGAGG + Intergenic
1113804941 13:113107070-113107092 CTGCACCCCAGTCCCAGGGAAGG - Intronic
1118885225 14:69860343-69860365 GGGCCCTCCATTCCCAAGAAGGG + Intronic
1119646341 14:76351156-76351178 GAGCACACCATCCCCATGAATGG + Intronic
1122080078 14:99261040-99261062 GTTCACCCGATTCCAAAGAACGG + Intronic
1122309639 14:100786307-100786329 GTCCACCCACTTCCAAAGAAGGG + Intergenic
1122350140 14:101084281-101084303 GTCCACCCCAAACCCAGGAACGG + Intergenic
1123099890 14:105790536-105790558 CTGCCCTCCATACCCAAGAATGG + Intergenic
1124867168 15:33503758-33503780 GTGCACCCCAATCCCAACCTAGG - Intronic
1125775686 15:42210960-42210982 GTGCACCACATTGCCAGCAATGG + Exonic
1133711400 16:8404935-8404957 ATGCAACCCATTCACTAGAAAGG + Intergenic
1140685934 16:77434387-77434409 TTGCCCCCCATCCCCAAGAAGGG - Intronic
1142159606 16:88550285-88550307 GTGCACCCCCGTCCCCAGCACGG + Intergenic
1142423902 16:89990565-89990587 CTGTACCTCATACCCAAGAACGG - Intergenic
1143286013 17:5789833-5789855 ATGCTCCCCATTCCCAAGTTGGG - Intronic
1145365949 17:22267111-22267133 GAGCACACCACACCCAAGAAAGG + Intergenic
1151270111 17:72987565-72987587 ATGCTCCCCATTCCCCAAAAAGG + Intronic
1152687591 17:81702268-81702290 GTGCACCCCATTACCATGCCTGG + Intronic
1155033671 18:22005748-22005770 GTGCTCCCCATTCCCAGGCCTGG - Intergenic
1155655408 18:28186114-28186136 GTTCACTCCATTCCCACTAACGG + Intergenic
1157514649 18:48302194-48302216 TTCCTCCCCATTCCCCAGAAAGG + Intronic
1160214125 18:76911835-76911857 ATGCTCTCCATCCCCAAGAACGG - Intronic
1160744015 19:702080-702102 GGGCAACCCATTCCCTAGATGGG - Intergenic
1167666945 19:50827754-50827776 GTGCACCCCACTCCCAGCCATGG - Exonic
925202690 2:1981676-1981698 GTCCTCCCCATGCTCAAGAAAGG - Intronic
927846240 2:26474106-26474128 GTGACCCCCATTCCCCAGATTGG - Exonic
931084525 2:58814733-58814755 GTGCATCCTATTTCCAAGGATGG + Intergenic
931598299 2:63975270-63975292 GTTCACCCTATGCCCAAGAATGG - Intronic
931907704 2:66860378-66860400 GGGCACCAGATTGCCAAGAAAGG + Intergenic
934182989 2:89644505-89644527 GGTCACCCCATTCCAAAGCATGG + Intergenic
934293275 2:91718692-91718714 GGTCACCCCATTCCAAAGCATGG + Intergenic
935197026 2:100822781-100822803 GTGCAACTCTTTCCCAAGAGAGG + Intronic
938479416 2:131647072-131647094 CTGCTTCCCAGTCCCAAGAAGGG - Intergenic
940054653 2:149500765-149500787 GTTTACCCCATTGCCAGGAAGGG + Intergenic
941209720 2:162622570-162622592 TTTCACCCCATCCCCAATAAAGG - Intronic
941865050 2:170325769-170325791 GTCCAGCCCAGTCCCAAGACTGG + Intronic
944785597 2:203066794-203066816 GTGCACCTCACTTCCCAGAAGGG + Intronic
945008819 2:205439994-205440016 ATGCATCCCTGTCCCAAGAAAGG + Intronic
947024744 2:225724495-225724517 GTAAACCCCAGTCCCAAGACAGG - Intergenic
947555082 2:231085128-231085150 GTCCACCCCATTCCCAAGAAAGG - Intronic
1172787030 20:37475198-37475220 GTGCACCCCATCCCCAACTCTGG + Intergenic
1172997853 20:39083980-39084002 ATGGACCCCATCCCCAAGCAAGG + Intergenic
1174845271 20:53937282-53937304 GTTCACCCCATTCTAAAGTAAGG - Intronic
1176256378 20:64155189-64155211 GGGCCCTGCATTCCCAAGAATGG - Intronic
1178486545 21:33023206-33023228 GAGCACTCCATTCCCCAGGAAGG + Intergenic
950424596 3:12918256-12918278 GTGCACCCCATTCCCAAGAAGGG - Intronic
951326466 3:21308194-21308216 GTGCACCCATCACCCAAGAAGGG - Intergenic
953595768 3:44311735-44311757 GAACAGGCCATTCCCAAGAAAGG + Intronic
955344108 3:58148432-58148454 GTGCTACCCATTCCCAAGAAAGG - Intronic
963003350 3:140703840-140703862 ATGCACCCCATTGGTAAGAAAGG - Intergenic
967852054 3:194089723-194089745 GTTAAGCCCATTGCCAAGAAAGG + Intergenic
971091545 4:23351728-23351750 TTGAGCCCCATTCCCAAGAAAGG + Intergenic
972257893 4:37378451-37378473 GTGGACCACAATTCCAAGAACGG + Intronic
974289031 4:59907056-59907078 GTACAACCCATTCTTAAGAAGGG + Intergenic
975329834 4:73100269-73100291 GACCACCCCAGTCCCAAGGAAGG + Intronic
976199468 4:82563943-82563965 GGGAGCCCTATTCCCAAGAAAGG - Intergenic
976437352 4:85033364-85033386 GAGGGCCCCATTCTCAAGAATGG - Intergenic
980064959 4:128176886-128176908 GTGCTTCACATTCCCAAGAAAGG + Exonic
984376930 4:178943645-178943667 ATGCAGCCCATGCCTAAGAAAGG + Intergenic
985642370 5:1069625-1069647 GGGCACCTCATTCCCAGGCAGGG - Intronic
988191900 5:27948236-27948258 GTGCACCACCTTCCCAGCAATGG - Intergenic
988777110 5:34487181-34487203 GGGCACCCAAATCCCAGGAATGG + Intergenic
990956408 5:61344524-61344546 CCTCACCCCATCCCCAAGAAAGG - Intronic
991408187 5:66321844-66321866 GTGCACCCCTCTCCCCAGCAAGG - Intergenic
991488541 5:67163183-67163205 GTGCCCCCAATTCCCCAGCAGGG + Exonic
996629234 5:125607598-125607620 ATGCTCCACATTTCCAAGAAAGG + Intergenic
1002711495 5:181197844-181197866 ATACACCCCATTCCCAGGAGAGG + Intronic
1004198203 6:13524615-13524637 GTGCTCCCCACTCCCAAAAGTGG - Intergenic
1007749532 6:44063394-44063416 CTGCATCCCATTCCCAAGGAGGG + Intergenic
1015004951 6:128268492-128268514 AAGGACCCCATTCCCAAGAAAGG - Intronic
1015227916 6:130879670-130879692 GTGGACCACATTCCCAATCATGG + Intronic
1015234875 6:130959186-130959208 GTGTTCCCCATTTCCATGAATGG - Intronic
1018717227 6:166542910-166542932 GTTCACCTCATTTCCAAAAAAGG + Intronic
1029338637 7:99924278-99924300 GTGCAGCCCATGCCTAAAAAGGG + Intronic
1032329975 7:130969216-130969238 GTGGACCCAATTCCTAGGAAAGG - Intergenic
1034270888 7:149803033-149803055 GTGGACCCCCCACCCAAGAATGG + Intergenic
1034527684 7:151675994-151676016 GAGCACCCCGTTCCCAATGAGGG - Intronic
1037538193 8:19847145-19847167 GTGGACTCCATTCTCAAGAATGG + Intronic
1039476112 8:37840209-37840231 GGGCACCCCCTCCGCAAGAAGGG + Exonic
1041095170 8:54342586-54342608 GTCCCCCACACTCCCAAGAAGGG - Intergenic
1043250790 8:78070722-78070744 GTTCAGCCTATGCCCAAGAATGG - Intergenic
1047726512 8:127688632-127688654 GAGAGCCCAATTCCCAAGAAAGG - Intergenic
1051494779 9:17708001-17708023 GTGCACTCCATTTACAATAATGG - Intronic
1051588290 9:18749815-18749837 GTGCACTGCATTCTCAAGGACGG - Intronic
1054596722 9:67074987-67075009 GAGAACCTCACTCCCAAGAAAGG - Intergenic
1057293647 9:93822941-93822963 CTGGATCCCATTCCCAAGGATGG + Intergenic
1061682577 9:132250284-132250306 GGTCTCCCCATGCCCAAGAAAGG + Intergenic
1194316644 X:92384963-92384985 GTTCAGCCTATTCCCAGGAATGG + Intronic
1198047845 X:132920330-132920352 CTGCATCCCATTCCCAGGACAGG + Intronic
1199812306 X:151362045-151362067 GACCACCCCATTCCCCAGAGAGG + Intergenic
1200624820 Y:5498285-5498307 GTTCAGCCTATTCCCAGGAATGG + Intronic