ID: 950427391

View in Genome Browser
Species Human (GRCh38)
Location 3:12931792-12931814
Sequence GACCTGGCCTCCCCTACACT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 134}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950427391_950427399 6 Left 950427391 3:12931792-12931814 CCGAGTGTAGGGGAGGCCAGGTC 0: 1
1: 0
2: 1
3: 7
4: 134
Right 950427399 3:12931821-12931843 AGGGGGCTGCCTCCAGGTACAGG 0: 1
1: 0
2: 0
3: 16
4: 227
950427391_950427403 18 Left 950427391 3:12931792-12931814 CCGAGTGTAGGGGAGGCCAGGTC 0: 1
1: 0
2: 1
3: 7
4: 134
Right 950427403 3:12931833-12931855 CCAGGTACAGGGCCCTGTGCTGG 0: 1
1: 0
2: 3
3: 39
4: 394
950427391_950427398 0 Left 950427391 3:12931792-12931814 CCGAGTGTAGGGGAGGCCAGGTC 0: 1
1: 0
2: 1
3: 7
4: 134
Right 950427398 3:12931815-12931837 CACAGAAGGGGGCTGCCTCCAGG 0: 1
1: 0
2: 3
3: 28
4: 267
950427391_950427405 23 Left 950427391 3:12931792-12931814 CCGAGTGTAGGGGAGGCCAGGTC 0: 1
1: 0
2: 1
3: 7
4: 134
Right 950427405 3:12931838-12931860 TACAGGGCCCTGTGCTGGAAGGG 0: 1
1: 0
2: 0
3: 21
4: 215
950427391_950427400 7 Left 950427391 3:12931792-12931814 CCGAGTGTAGGGGAGGCCAGGTC 0: 1
1: 0
2: 1
3: 7
4: 134
Right 950427400 3:12931822-12931844 GGGGGCTGCCTCCAGGTACAGGG 0: 1
1: 0
2: 0
3: 22
4: 221
950427391_950427404 22 Left 950427391 3:12931792-12931814 CCGAGTGTAGGGGAGGCCAGGTC 0: 1
1: 0
2: 1
3: 7
4: 134
Right 950427404 3:12931837-12931859 GTACAGGGCCCTGTGCTGGAAGG 0: 1
1: 0
2: 2
3: 23
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950427391 Original CRISPR GACCTGGCCTCCCCTACACT CGG (reversed) Intronic
900799899 1:4730824-4730846 GACCTGGCCCTTCCTGCACTTGG + Intronic
901643386 1:10704419-10704441 GGCCGGGCCTGCCCTACACCGGG + Intronic
902686460 1:18080664-18080686 GAGCTGGCCTCACACACACTGGG + Intergenic
903223362 1:21881129-21881151 GAGCTGGCCTCCCCTCCTCCCGG - Intronic
903646114 1:24897397-24897419 GCCCTGCCCTCCCCTACCCACGG + Intergenic
905665515 1:39761003-39761025 GGCCTGGCCTCCCAGAGACTGGG - Intronic
907475099 1:54700248-54700270 CCCCTGGCCTCCCATGCACTGGG - Intronic
912866626 1:113263419-113263441 AAGCAGCCCTCCCCTACACTTGG + Intergenic
914428675 1:147600378-147600400 GACCTGGCCCCCACTACCCCCGG - Intronic
915666372 1:157448917-157448939 GACCTGGCCTGCCACACACCTGG + Intergenic
915848626 1:159297119-159297141 AACCTGGCCTACACTACATTCGG + Intronic
917716745 1:177745891-177745913 GACCTGGATTCCCGAACACTTGG - Intergenic
922582497 1:226709317-226709339 GAGATGGCCTCCCCTGCCCTGGG + Intronic
1065862937 10:29886682-29886704 TACCTGGCCTCACCAACACAAGG - Intergenic
1066292739 10:34029021-34029043 GACCTGAGCTCCCCTCCACCTGG + Intergenic
1066701811 10:38137574-38137596 GACCTGGCCTTCCAAACACCAGG - Intergenic
1069904153 10:71722630-71722652 GTCCTGGCCTTCCCTACCCCTGG - Intronic
1070785266 10:79158902-79158924 GTCCTGGCCTCCCCTCCCCCGGG + Intronic
1070801958 10:79249055-79249077 GTCCTGGCCTCCCACACACAGGG - Intronic
1071023379 10:81083813-81083835 GACCTCACCTCCGCTACACATGG - Intergenic
1075622347 10:123937118-123937140 CACCTGGACTCCCCTTTACTTGG - Intronic
1075637260 10:124037696-124037718 ACCCTGGCCTCACCCACACTGGG + Intronic
1075649321 10:124117313-124117335 AACCTGGCCTCACCCAAACTCGG + Intergenic
1075822842 10:125329322-125329344 GATCTGGCCACCAGTACACTGGG - Intergenic
1075885621 10:125896650-125896672 GCCCGGGCCTCCCTTACTCTGGG - Exonic
1076369637 10:129943527-129943549 GACCTGGCCTCCAGCGCACTTGG + Intronic
1081855367 11:46300052-46300074 GAACTGGACTCCCCTACGCCAGG + Exonic
1088470550 11:110184399-110184421 GACCTGGATTTCCCTACACCAGG - Intronic
1088818092 11:113434985-113435007 GACCAGGCCTCCCCTTCTCCAGG + Intronic
1091888180 12:4031691-4031713 GGCCAGGCCTCCCCGACTCTGGG + Intergenic
1094525266 12:31227059-31227081 GACCTGGCCTCCTGCCCACTGGG + Intergenic
1101015605 12:100497096-100497118 AAGCTGGCCTCCCCCACACCAGG - Intronic
1101044874 12:100794693-100794715 GACCATGCCTCCCCTGCACCTGG + Intronic
1103741541 12:123094757-123094779 AACCTGGCCTTCCCTGCCCTCGG - Intronic
1106587448 13:31069728-31069750 CACCTGCCATCCCCTAGACTTGG + Intergenic
1108156939 13:47594976-47594998 GACCTGGCCTCTGCTCCACATGG + Intergenic
1109392129 13:61707071-61707093 CACATGGCCTCCCTTACCCTGGG - Intergenic
1112840639 13:103573343-103573365 GCCCAGGACTCCCCCACACTGGG + Intergenic
1113282668 13:108806765-108806787 GTACTGGACTCCCCTCCACTTGG + Exonic
1114629455 14:24149834-24149856 CACATGGCCTGACCTACACTAGG - Intronic
1115105115 14:29751290-29751312 CACATGGCCTCCCCTACTTTGGG - Intronic
1119415295 14:74465713-74465735 GGCCTGACCTCCCCAACCCTGGG + Intergenic
1119853420 14:77882249-77882271 GAGCTGGCCCCCCCTACACCTGG - Intronic
1122691263 14:103533111-103533133 GGCCGGGCCTGCCCTGCACTTGG - Intronic
1123063039 14:105602874-105602896 GGCCTGGCCTCGGCTAAACTGGG - Intergenic
1123063170 14:105603526-105603548 GGCCTGGCCTGGCCTAAACTGGG - Intergenic
1202872446 14_GL000225v1_random:177290-177312 GCCCCGGCCTCCCTTACTCTGGG + Intergenic
1124952644 15:34337866-34337888 GACCTGGCCTCCCCCAGCCCCGG + Intronic
1128345169 15:66848804-66848826 GAACTGCCTTCCCCTACACAGGG - Intergenic
1128815258 15:70603513-70603535 GATCTGGCCTCCCCTTCAAGTGG - Intergenic
1130088534 15:80799421-80799443 GACCAGGCCTTCCCTAGCCTGGG - Intronic
1130111380 15:80968251-80968273 GCTCTGGCATACCCTACACTGGG + Intronic
1133774132 16:8884570-8884592 CAACTGGCCTCCCCTATGCTTGG - Intergenic
1140103392 16:71938109-71938131 GACCTGGGCATCCCTGCACTCGG + Intronic
1140729543 16:77843684-77843706 GACCTGGACCCCCCTTCACAGGG + Intronic
1142051746 16:87963308-87963330 GGCCTGGCCTGCACTGCACTTGG - Intronic
1143773812 17:9185120-9185142 GACCTGCGCTGCCCTACTCTGGG + Intronic
1146274894 17:31510317-31510339 CCGCTGGACTCCCCTACACTAGG + Intronic
1147138216 17:38447036-38447058 CTCCTGGCCTCCCAAACACTGGG + Intronic
1148752664 17:49954452-49954474 AACTTGGCCTCCCCTTCTCTGGG + Intergenic
1152101066 17:78301989-78302011 GGCCTGGCCTGCCCTGCACCGGG + Intergenic
1156516631 18:37685835-37685857 ACCCTGGCAGCCCCTACACTAGG - Intergenic
1156893607 18:42217646-42217668 GACCTGGCCTCTTCTTCAGTTGG + Intergenic
1160005352 18:75064680-75064702 GCCCGGCCCTCCCCTGCACTTGG - Exonic
1161315335 19:3614843-3614865 GTCCTGGCCTCCCCCACGCTGGG - Intronic
1162696943 19:12484215-12484237 GATCTGGCTTCCCATACACTTGG + Intronic
1166204924 19:41263519-41263541 GACACGGCCTCCCCTTCCCTTGG - Intronic
1166733474 19:45071308-45071330 GCCCTGGCCTCGCCCGCACTAGG + Intergenic
1166990630 19:46690524-46690546 TCCCTGACCACCCCTACACTGGG + Intronic
1168317078 19:55489098-55489120 GGCCTGGCCTCACCCCCACTGGG + Intronic
929430531 2:41882432-41882454 GACCTGGCATCCCCTTCATGAGG - Intergenic
932572862 2:72947073-72947095 CACCTTCCCTCCCCTACGCTGGG + Intronic
933525898 2:83438381-83438403 AATCTGGCCTCTCCCACACTGGG + Intergenic
933774300 2:85762606-85762628 GACCTCCCCTACCCTACACCAGG - Intronic
934661657 2:96146374-96146396 GAACTGGCCTCCCCCATCCTAGG + Intergenic
942117514 2:172742780-172742802 GACCTGGACTCCCTCAGACTGGG + Intronic
948102106 2:235383482-235383504 GACCTGGCCTCGCCAATGCTGGG + Intergenic
948917333 2:241041145-241041167 ACCCTGGCCTCCCATGCACTCGG - Intronic
1172068376 20:32237805-32237827 GTGCTGGGCTCCCCTAGACTAGG + Exonic
1174111171 20:48198873-48198895 GTCCTGGCATTCCCTACTCTGGG + Intergenic
1174553635 20:51378834-51378856 GACCTGGCCTGGCCTACCCCTGG - Intergenic
1175917608 20:62434050-62434072 GACCGTGCCTCCCCGACACCAGG - Intergenic
1176106450 20:63391810-63391832 GACCTTGCCTTCCCTCCACTGGG - Intergenic
1176121778 20:63457359-63457381 GACCGAGCCTCCCAAACACTGGG + Intronic
1181314095 22:21960868-21960890 GAGCTGCCCTCCCCTAAACCTGG + Intronic
1181783560 22:25209581-25209603 GCCCAGGTCTCCCATACACTCGG - Intergenic
1182805213 22:33064062-33064084 GACCTGGCCTCCGATGCCCTTGG + Intergenic
1183234614 22:36608043-36608065 GACCTCTCCTTCCCTACACAGGG - Intronic
1185285241 22:49997073-49997095 GACCTGCCCTCCCCCACCCAGGG - Exonic
950427391 3:12931792-12931814 GACCTGGCCTCCCCTACACTCGG - Intronic
952872378 3:37912233-37912255 GAACCGGCCTCCCCTCCACTAGG - Intronic
954280370 3:49572951-49572973 GACTTGGCCTCCCCCAGTCTCGG - Intronic
962299699 3:134228037-134228059 GTCCCGGCCTCCCACACACTGGG - Intronic
963008905 3:140751181-140751203 GAGCTGGCCTCCCCAAAAGTGGG + Intergenic
967021861 3:185529638-185529660 GCCCTGGCCTCCCAAACTCTAGG - Intronic
968703843 4:2069226-2069248 CACCTCGGCTCCCCTACACCTGG + Intergenic
976129576 4:81870547-81870569 GACCTGGGCACCCCTGCTCTCGG + Intronic
978654167 4:111047041-111047063 GTCCTGGCCTCCCCTTCAATGGG - Intergenic
985368095 4:189255021-189255043 GACATGGCCTCCTATACACATGG + Intergenic
986438876 5:7760904-7760926 TTCCTGGCCTCCCCAACACCTGG + Intronic
987310913 5:16680237-16680259 GTCCTGTCCTGCCCTGCACTAGG + Intronic
989485559 5:41987340-41987362 GAACTGACCTCCCCTAACCTGGG + Intergenic
990425464 5:55684275-55684297 GTCCTGGCTTCTCTTACACTTGG + Intronic
990562559 5:56997416-56997438 GACCAGGGCTGCCATACACTAGG - Intergenic
995272902 5:110242577-110242599 CACCAGGCCTCCCCAACATTGGG + Intergenic
1002597648 5:180334731-180334753 GACCAGGCCTCACCTAGAGTGGG + Intronic
1002932842 6:1646295-1646317 GACCAGCCCTCCCCTGCTCTGGG + Intronic
1004350663 6:14887753-14887775 GACCTGACCAGCCCCACACTGGG + Intergenic
1006797770 6:36742205-36742227 GCCCTGGCCTCCCATTCACCTGG + Exonic
1007374902 6:41449870-41449892 TGCCTGGCCTGCCCTCCACTCGG - Intergenic
1007424846 6:41740255-41740277 GACCTGGACTCCCGAACATTAGG - Intronic
1007697626 6:43743872-43743894 GCCCTGGCCTCTGCTACCCTGGG + Intergenic
1008044475 6:46837615-46837637 GCCCTGGCCTCCCTTAGCCTGGG - Intronic
1010508302 6:76687230-76687252 GATCTGGCCTCTCCTTCATTTGG - Intergenic
1011639327 6:89404486-89404508 GACCTCACCTCTCCTCCACTTGG + Intronic
1013001159 6:106023514-106023536 GACCAGCCCTCCCCTCCTCTAGG + Intergenic
1013231656 6:108166164-108166186 GACCTGGCCGCCTCTTCCCTCGG + Intronic
1018672689 6:166192807-166192829 GAGCTGGCATCCCCTCCCCTAGG + Intergenic
1018813227 6:167312900-167312922 GGCCTCTCCTCCCCTAGACTGGG + Intronic
1019263662 7:98975-98997 CACCTTCACTCCCCTACACTTGG - Intergenic
1019508462 7:1405213-1405235 CACCTGGCCTCCCTTTGACTTGG - Intergenic
1019929000 7:4211106-4211128 GACCTGACCTCCCCAAGACCAGG + Intronic
1026933396 7:74237836-74237858 GAACTGGCCTTCCCTACAAAAGG + Intronic
1036077120 8:5514303-5514325 GACCTGGACTCTCCTTCACAGGG - Intergenic
1037323494 8:17665851-17665873 GACCTTTCCCCCCCTATACTGGG + Intronic
1039428654 8:37507462-37507484 TACCTGGGCTCACCTTCACTTGG + Intergenic
1039471088 8:37814275-37814297 GGCCTGGCTTCCCCTACACTCGG + Intronic
1043937444 8:86157582-86157604 AACCTGGCCTCCCTTACATAAGG - Intergenic
1045357641 8:101403702-101403724 GACCTGTCCTCCCCTCCAAACGG + Intergenic
1049249880 8:141582637-141582659 GACCTGGCCTCTCCTTCTCTGGG + Intergenic
1049643434 8:143725710-143725732 CCCCTGGCCTCCCCAACGCTGGG - Exonic
1050121066 9:2307726-2307748 CACATGGCCTCCCCAACACAAGG - Intergenic
1056252826 9:84768241-84768263 GACTTGGCATTTCCTACACTTGG - Intronic
1060098051 9:120811510-120811532 GCCCTTGCCACCCCTACACAGGG - Intergenic
1060931625 9:127492703-127492725 GGCCTGGCCTCCCGCTCACTCGG - Intronic
1061458080 9:130713288-130713310 GGCCGGGCCTCCTCTACACGGGG + Intergenic
1062392032 9:136337688-136337710 GTCCTGGCCTCATCTGCACTTGG + Intronic
1062432186 9:136531186-136531208 CTCCTGGCCTGACCTACACTCGG + Intronic
1203732004 Un_GL000216v2:99252-99274 GCCCCGGCCTCCCTTACTCTGGG - Intergenic
1190497975 X:51045372-51045394 GATCTGATCTCCCCTACAGTAGG - Intergenic
1190508407 X:51152201-51152223 GATCTGATCTCCCCTACAGTAGG + Intergenic
1195947190 X:110227723-110227745 GACTTGGCCTCGCCAGCACTAGG - Intronic
1201283106 Y:12357954-12357976 GACCAGGGCTCCTTTACACTTGG - Intergenic