ID: 950430404

View in Genome Browser
Species Human (GRCh38)
Location 3:12947651-12947673
Sequence TGGGCCCCTGGTGGTGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 412
Summary {0: 1, 1: 0, 2: 5, 3: 41, 4: 365}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950430393_950430404 10 Left 950430393 3:12947618-12947640 CCTTCCCATGAGATGAGTTCTGT 0: 1
1: 1
2: 1
3: 11
4: 153
Right 950430404 3:12947651-12947673 TGGGCCCCTGGTGGTGGGACAGG 0: 1
1: 0
2: 5
3: 41
4: 365
950430391_950430404 30 Left 950430391 3:12947598-12947620 CCATGAGCAGGAGGCCTGCTCCT 0: 1
1: 1
2: 3
3: 22
4: 256
Right 950430404 3:12947651-12947673 TGGGCCCCTGGTGGTGGGACAGG 0: 1
1: 0
2: 5
3: 41
4: 365
950430394_950430404 6 Left 950430394 3:12947622-12947644 CCCATGAGATGAGTTCTGTATGT 0: 1
1: 0
2: 0
3: 17
4: 190
Right 950430404 3:12947651-12947673 TGGGCCCCTGGTGGTGGGACAGG 0: 1
1: 0
2: 5
3: 41
4: 365
950430395_950430404 5 Left 950430395 3:12947623-12947645 CCATGAGATGAGTTCTGTATGTC 0: 1
1: 0
2: 2
3: 14
4: 143
Right 950430404 3:12947651-12947673 TGGGCCCCTGGTGGTGGGACAGG 0: 1
1: 0
2: 5
3: 41
4: 365
950430392_950430404 16 Left 950430392 3:12947612-12947634 CCTGCTCCTTCCCATGAGATGAG 0: 1
1: 0
2: 3
3: 70
4: 621
Right 950430404 3:12947651-12947673 TGGGCCCCTGGTGGTGGGACAGG 0: 1
1: 0
2: 5
3: 41
4: 365

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950430404 Original CRISPR TGGGCCCCTGGTGGTGGGAC AGG Intronic