ID: 950430639

View in Genome Browser
Species Human (GRCh38)
Location 3:12948994-12949016
Sequence CAGGTACAAGATGCCGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 97}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950430639 Original CRISPR CAGGTACAAGATGCCGTGGT GGG Intronic
900980015 1:6040967-6040989 GAGGAACAGGATGCCGGGGTTGG - Intronic
902506775 1:16943819-16943841 CAGGTAGAAGAGGCCGAGCTAGG - Intronic
905152705 1:35944325-35944347 CAGGCACAAGATGCTGTGCCTGG + Intronic
906185376 1:43858509-43858531 CAGGTACAAGATCCCCACGTGGG + Intronic
906318791 1:44804260-44804282 CTGGTACATGCTGCTGTGGTGGG + Intronic
908569847 1:65397827-65397849 AAGGTACTAGATGACTTGGTTGG + Intronic
912516302 1:110218619-110218641 CAAGTACAAGACACCGTGTTTGG - Intronic
915450664 1:156002834-156002856 CAGGTACAAGAAGCCATGCTGGG + Intronic
915619432 1:157071259-157071281 CTGGTATAAAATTCCGTGGTTGG - Intergenic
1069831420 10:71284492-71284514 CAGGTAGAAGATGCATTGGTGGG + Intronic
1070319484 10:75343854-75343876 CTGTTACATGATGCCCTGGTGGG + Intergenic
1071116474 10:82227147-82227169 CAAGTACAAGCTGCAGTGGGTGG - Intronic
1071718416 10:88119895-88119917 CCGCTTCAAGATGCCCTGGTGGG - Intergenic
1073198724 10:101717301-101717323 CAGCTACAGGAGGCTGTGGTGGG - Intergenic
1075299792 10:121311853-121311875 CTGGTGCAAGATCCCGGGGTTGG - Intergenic
1077883980 11:6372261-6372283 CATGTGCAAGGTGCTGTGGTGGG - Intergenic
1084505593 11:69564920-69564942 CATGTACAAGATCACATGGTGGG + Intergenic
1088031284 11:105253929-105253951 CAGGTACAAGATGTCATGCAGGG - Intergenic
1088692881 11:112342834-112342856 CAGGCACAAGATGCCATGCCTGG + Intergenic
1088741799 11:112773621-112773643 CAGGTTCAAGAGACAGTGGTGGG + Intergenic
1099812338 12:87599671-87599693 CAGGAACAAGCTGCAGTGATAGG + Intergenic
1100633799 12:96414853-96414875 CAGGAACAAGATGCGGTAGGTGG + Intergenic
1103739722 12:123083104-123083126 CAGCTACAGGAGGCTGTGGTGGG + Intronic
1106010789 13:25820116-25820138 CAGGTACAACCCGCCGAGGTTGG + Intronic
1107006602 13:35619505-35619527 CAGATACAGGATGTTGTGGTTGG - Intronic
1110449211 13:75622290-75622312 CTGGTAGAATATGCCTTGGTAGG + Intronic
1111000001 13:82165836-82165858 CAGCTGCAAGATGCCCTGGGAGG + Intergenic
1119227943 14:72958412-72958434 CAATGACAAGATGCCCTGGTTGG - Intronic
1122073239 14:99218971-99218993 CAGGTCCAAGATGGAGGGGTCGG - Intronic
1122496177 14:102157148-102157170 CAGCTACAAGAGGCTGAGGTGGG + Intronic
1130032355 15:80327578-80327600 TAGGAACAAGATCCAGTGGTTGG - Intergenic
1134042604 16:11080010-11080032 TAGGAACAAGATGCCATGATAGG - Intronic
1137709264 16:50555173-50555195 CAGGCTCAAGCTGCCCTGGTAGG + Intronic
1141568618 16:84920639-84920661 CAGGGACCAGATGACATGGTCGG - Intronic
1141704517 16:85657373-85657395 CAGAGAGAAGATGCCATGGTTGG - Exonic
1142623382 17:1178839-1178861 CAGGAGCAAGGTGCGGTGGTGGG + Intronic
1144779446 17:17800501-17800523 CAGGGACAGGATGGGGTGGTCGG - Intronic
1151595265 17:75074509-75074531 CAGGGACAGGATGCCTAGGTGGG + Intergenic
1155498417 18:26464655-26464677 TAGGTGCCAGATGCCGTGGAAGG + Intronic
1159040193 18:63318021-63318043 CAGGTCCGAGATGCGGGGGTTGG - Intronic
1161217075 19:3099890-3099912 CAGTTACAAGAGGCAGAGGTAGG - Intronic
1161431626 19:4235813-4235835 CAGTTACAAGAGGCTGAGGTGGG + Intronic
1162179853 19:8860980-8861002 CAGGTACAAGGTGGGGTGGCTGG - Exonic
926367565 2:12146923-12146945 CAAGTTCAAGAGGCCATGGTGGG - Intergenic
928649139 2:33386545-33386567 CAGGTGCGAGCTGCCGTGCTTGG - Intronic
937957350 2:127428786-127428808 CAGGAACCAGGTGCCGTGGAAGG - Exonic
941144764 2:161831033-161831055 CAGCTACAAGATTCTGAGGTAGG + Intronic
945568870 2:211439043-211439065 CATGTAGGAGATGCTGTGGTGGG + Intronic
947562213 2:231165760-231165782 AAGGTACAAGAGGTAGTGGTCGG - Intronic
948060347 2:235038876-235038898 CAGGTACATGATGTAGTGGTTGG + Intronic
1172681218 20:36716822-36716844 CAGGTACAAGAGGCAGTAGATGG + Intronic
1173182910 20:40818093-40818115 CAGGCACAAGATCCCATGCTAGG + Intergenic
1175695409 20:61099530-61099552 CAGGTATAAGAGCCCTTGGTGGG + Intergenic
1176037960 20:63049509-63049531 CAGGTACAAGAGGCCGAGTGCGG + Intergenic
1178094089 21:29195572-29195594 CAGGTGCCAGACGCCGTGCTAGG + Intronic
1178942891 21:36922468-36922490 CAGGTACAGCATGCCGAGTTTGG - Intronic
1182851615 22:33479301-33479323 CAGGTGCCAGATGCTGTGCTAGG - Intronic
1185377780 22:50489991-50490013 CAGGCACAAGTTGCCGTGAGGGG - Exonic
950430639 3:12948994-12949016 CAGGTACAAGATGCCGTGGTGGG + Intronic
959762095 3:109977745-109977767 CAGGTACCAGATATGGTGGTTGG - Intergenic
960079797 3:113529352-113529374 GAGGCACAAGAAGCCTTGGTGGG + Intergenic
961832401 3:129630436-129630458 CAGGTGCAAGCTGCCATGCTTGG + Intergenic
965576963 3:170227309-170227331 CAGGCACATGATGCTGTCGTAGG + Intronic
968141864 3:196264684-196264706 CAGGTATTAGATGCCTGGGTTGG - Intronic
969162989 4:5278109-5278131 CAGGTAGAAGATGACGTGGGAGG + Intronic
972181670 4:36474522-36474544 CATGTACAAGATGCCATACTAGG + Intergenic
974625742 4:64427381-64427403 CAGTTACAGGAGGCCGAGGTGGG - Intergenic
980828932 4:138106330-138106352 CAGTTATAAGATTCCGAGGTTGG + Intergenic
983679752 4:170339754-170339776 GAGGTACAAGCTGGAGTGGTGGG - Intergenic
986909742 5:12540605-12540627 CAGGTACAACATACAGTGTTTGG + Intergenic
987357127 5:17073731-17073753 CAGGCACAAGCTGCCATGCTTGG - Intronic
992902400 5:81310989-81311011 CAGGTGCAAGAAGCAGTGGGTGG + Intronic
998819554 5:146046092-146046114 CATGTACAAAATTACGTGGTGGG + Intronic
999132242 5:149293072-149293094 CAGGGACAAGAGGGCATGGTGGG - Intronic
1001145432 5:169179880-169179902 CATGTGCTAGATGCAGTGGTAGG + Intronic
1001823315 5:174726199-174726221 CAGGTAGGGGATGGCGTGGTGGG - Intronic
1005000593 6:21236586-21236608 CAGGAACAAGATTCCATTGTGGG + Intergenic
1005166607 6:22929348-22929370 CAGGCACAGGATTCCGTGTTGGG - Intergenic
1007041934 6:38730345-38730367 CAGGCACAAGATGCTGAGATAGG - Intronic
1007277057 6:40682209-40682231 CAGGTAGAAGATGCCGTCTGTGG - Intergenic
1009202872 6:60767349-60767371 CAGGTATAATATGCCATGGATGG + Intergenic
1014851831 6:126350002-126350024 CAGGTGCAAGCTGCTGTGTTCGG + Intergenic
1015598161 6:134886278-134886300 CAGGTACAAGATCTAGTGCTAGG - Intergenic
1017750434 6:157486330-157486352 CAGGTAGGAGATGCTGTGCTTGG - Intronic
1018856291 6:167677671-167677693 CAGGTAGAAGAGAACGTGGTAGG - Intergenic
1033731780 7:144187530-144187552 CAGGTACAAGATGTGATGCTTGG - Exonic
1033742629 7:144286113-144286135 CAGGTACAAGATGTGATGCTTGG - Intergenic
1033751274 7:144363501-144363523 CAGGTACAAGATGTGATGCTTGG + Exonic
1038861513 8:31393426-31393448 CAGGTACAAGACCCTGAGGTAGG + Intergenic
1047438357 8:124854661-124854683 CATGTCCAAGATACTGTGGTAGG + Intergenic
1057256317 9:93550574-93550596 CAGGTACATGGTGCAGTGGCCGG + Exonic
1060703189 9:125777496-125777518 CAGGTGCAAGCTGCCGTGCCTGG + Intronic
1062266227 9:135687691-135687713 CTGGGACAAGATGCTGAGGTTGG - Intergenic
1062564557 9:137158456-137158478 CAGGTTCATGATGCTGTAGTTGG - Exonic
1185891753 X:3828266-3828288 CAGGGACAAGGGGCCGGGGTAGG - Intronic
1185896861 X:3866682-3866704 CAGGGACAAGGGGCCGGGGTAGG - Intergenic
1185901979 X:3905108-3905130 CAGGGACAAGGGGCCGGGGTAGG - Intergenic
1186083637 X:5961988-5962010 CAGGTATAAGATGCCATGAAGGG - Intronic
1192551676 X:72059447-72059469 CAGGTAGAAGATGAGGTAGTTGG - Intergenic
1197854498 X:130900771-130900793 CAGGTACAAAATGCTATGGAGGG - Intronic
1199742287 X:150746906-150746928 CAGGTATAAGATGCAGTCATAGG + Intronic
1201988465 Y:19995451-19995473 AAGACACAAGATGCCTTGGTGGG - Intergenic