ID: 950432746

View in Genome Browser
Species Human (GRCh38)
Location 3:12960383-12960405
Sequence GCCATCCACGGTGGCTGTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 68}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950432741_950432746 11 Left 950432741 3:12960349-12960371 CCTTCCACTCTGCTGATGGTAGT 0: 1
1: 0
2: 0
3: 19
4: 167
Right 950432746 3:12960383-12960405 GCCATCCACGGTGGCTGTACAGG 0: 1
1: 0
2: 0
3: 6
4: 68
950432739_950432746 22 Left 950432739 3:12960338-12960360 CCAAGGATTCTCCTTCCACTCTG 0: 1
1: 0
2: 0
3: 24
4: 274
Right 950432746 3:12960383-12960405 GCCATCCACGGTGGCTGTACAGG 0: 1
1: 0
2: 0
3: 6
4: 68
950432742_950432746 7 Left 950432742 3:12960353-12960375 CCACTCTGCTGATGGTAGTGCAC 0: 1
1: 0
2: 0
3: 8
4: 87
Right 950432746 3:12960383-12960405 GCCATCCACGGTGGCTGTACAGG 0: 1
1: 0
2: 0
3: 6
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950432746 Original CRISPR GCCATCCACGGTGGCTGTAC AGG Intronic