ID: 950433206

View in Genome Browser
Species Human (GRCh38)
Location 3:12963360-12963382
Sequence GAGCAGCTGGGACCCCAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 635
Summary {0: 1, 1: 0, 2: 5, 3: 58, 4: 571}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950433203_950433206 10 Left 950433203 3:12963327-12963349 CCTATGAACAAGGCAAAAAAGAA 0: 1
1: 0
2: 5
3: 61
4: 663
Right 950433206 3:12963360-12963382 GAGCAGCTGGGACCCCAAGAAGG 0: 1
1: 0
2: 5
3: 58
4: 571

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950433206 Original CRISPR GAGCAGCTGGGACCCCAAGA AGG Intronic
900234137 1:1578581-1578603 GAGCTGCAGAGTCCCCAAGAGGG - Intergenic
900390344 1:2431188-2431210 GAGCAGCAGGGGCCCCCAGGGGG - Intronic
901112069 1:6805631-6805653 GAGCAGCTGGGACTTCAGGGGGG + Intronic
901263746 1:7893371-7893393 GAGCAGCCGGGGCTCCAAGCAGG - Intergenic
901309602 1:8258708-8258730 GAGTAGCTGGGACTACAGGAGGG - Intergenic
901439330 1:9268109-9268131 GAGTAGCTGGGACCACAGGAGGG - Exonic
901925067 1:12560974-12560996 GAGCAGCTGGGACTACAGGCAGG + Intergenic
902335542 1:15752258-15752280 GAGCAGCGGGGAGCCACAGAGGG + Intergenic
902548505 1:17205484-17205506 CAGGAGCTGGGGCCCCAAGGAGG - Intronic
902612585 1:17605861-17605883 GAGCAGCTGCGACCTTCAGAAGG - Intronic
902906040 1:19558022-19558044 TAGTAGCTGGGACCACAAGCAGG + Intergenic
902989031 1:20173186-20173208 GAGTAGCTGGGACCACAGGCTGG - Intronic
903016356 1:20364685-20364707 GAGCAGCAGGGAACCCTAGATGG + Intergenic
903119184 1:21203460-21203482 GAGCAGCTAGGACCACAGGTAGG - Intergenic
903134105 1:21297964-21297986 GAGTAGCTGGGACCACAGGTGGG + Intronic
903320447 1:22539942-22539964 GTGCAGCTGGGACCACAGGTGGG + Intergenic
903472931 1:23599939-23599961 GAGTAGCTGGGACCACAGGCAGG - Intronic
903549524 1:24148240-24148262 GAGAAACTGAGACCTCAAGAGGG - Intergenic
903704230 1:25273261-25273283 AAGAAGCTGGGACCACAGGAGGG + Intronic
903723009 1:25420052-25420074 AAGAAGCTGGGACCACAGGAGGG - Intronic
903843692 1:26263548-26263570 GAGTAGCTGGGACTACAGGAGGG - Intronic
903968298 1:27103030-27103052 GAGCAGCTGGGAGCCTGAGGAGG - Intronic
904181034 1:28666908-28666930 GAGTAGCTGGGACCACAAGCAGG - Intergenic
904214392 1:28907738-28907760 GAGTAGCTGGGACCACAGGCAGG + Intronic
904236539 1:29121003-29121025 GAGCTGCTGGGGCCCCAAGGAGG + Exonic
904518260 1:31074076-31074098 GAGCAGCTGGGACTACAGGCAGG + Intergenic
905041013 1:34958493-34958515 GAGCAGCTGGGACTACAGGCAGG + Intergenic
905279675 1:36841161-36841183 GGACAGCTGGGAGCCCAAGCAGG - Intronic
905891010 1:41518401-41518423 GAGGAGCTGGAAGCCGAAGAAGG - Exonic
906194281 1:43920323-43920345 GAGTGGCAGGGACCCCAAGTAGG - Intronic
906341214 1:44982726-44982748 GAGCAGCTGGGACTACAGGTGGG + Intronic
906961634 1:50422695-50422717 GGTCCCCTGGGACCCCAAGACGG - Intronic
907182544 1:52583505-52583527 GAGAAGCTGGGACCACAGGCGGG + Intergenic
907854429 1:58287892-58287914 GAGCAGCTGGGACTACAGGTGGG - Intronic
909033586 1:70570563-70570585 GAGCAGCTGGGACTACCAAAAGG + Intergenic
909194582 1:72601509-72601531 GAGTAGCTGGGACCACATGCCGG + Intergenic
909198955 1:72664258-72664280 GAACAGCTGGGACCACAGGCAGG + Intergenic
909283654 1:73788682-73788704 GAACATCTGGGACCCCAGGAGGG - Intergenic
909630435 1:77764736-77764758 GAGTAGCTGGGACTACAAGCAGG + Intergenic
911053503 1:93692174-93692196 GAGCAGCTGGCACAGCAAGCTGG + Intronic
911420122 1:97630444-97630466 AAGGAGCAGGCACCCCAAGAGGG - Intronic
912897010 1:113602796-113602818 GAGCAGCTGGGACCACAGGTGGG - Intronic
913521171 1:119647397-119647419 CAGCAGCTCGCAGCCCAAGAGGG - Intronic
914714992 1:150247153-150247175 GAGTAGCTGGGACCACAGGTGGG - Intergenic
914806429 1:150995390-150995412 GACCAGCTGGGCCTCCAAGTAGG + Exonic
914817313 1:151072427-151072449 GAGTAGCTGGGACCACCAGTGGG - Intronic
914826054 1:151138577-151138599 GAGTTGGGGGGACCCCAAGATGG - Intronic
915220324 1:154369410-154369432 GAGTAACTGGGACCACAAGCAGG - Intergenic
915433643 1:155886679-155886701 GAGTAGCTGGGACTACAGGAGGG + Intergenic
915469588 1:156117654-156117676 GAGTAGCTGGGACCACAGGCAGG + Intronic
915477481 1:156161389-156161411 GAGCAGCTGGGCCTTCAGGAAGG - Exonic
915619188 1:157069292-157069314 GAGTAGCTGGGACTACAGGAGGG + Intergenic
917305915 1:173624363-173624385 GAGTAGCTGGGACCACAGGCAGG - Intronic
917543192 1:175935473-175935495 AAGTAGCTGGGACCACAGGAAGG + Intergenic
917791342 1:178501116-178501138 GAGAATCTGGGACCCCCACATGG + Intergenic
918292817 1:183125434-183125456 GAGCAGCTGTAACCCCGTGACGG + Exonic
918477562 1:184941520-184941542 GAGCAGCTGGGACTACAAGCAGG - Intronic
918488524 1:185054823-185054845 GAGTAGCTGGGACCACAGGCGGG + Intronic
919521010 1:198586761-198586783 GAGTAGCTAGGACCACAGGAGGG - Intergenic
919552592 1:199010346-199010368 GAGTAGCTGGGACTACAGGAGGG - Intergenic
919660478 1:200239837-200239859 GCGCAGCTGGGACTTCCAGAGGG - Intergenic
919728165 1:200897043-200897065 GGCCAGCTGGGACCCCAACCAGG + Intronic
919973218 1:202594103-202594125 GACCAGCTGGGACCTGAGGAAGG + Exonic
919977665 1:202623337-202623359 GAGCAGCTGGGGGCCCCAGCAGG - Intronic
920068958 1:203288966-203288988 GAGTAGCTGGGACCACAGGCAGG - Intergenic
920104834 1:203544976-203544998 GAGTAGCTGGAACCACAGGATGG + Intergenic
920347909 1:205318458-205318480 GAGTAGCTGAGGCCCGAAGAGGG - Intronic
920757540 1:208748603-208748625 GAGGAGTAGGGACACCAAGATGG - Intergenic
922225962 1:223646107-223646129 GAACAGCTGAGACAACAAGAGGG + Intronic
922801788 1:228367869-228367891 GAGCACCTGGGATCCCATCAAGG - Exonic
922831405 1:228556355-228556377 GAGTAGCTGGGACCCCAAGTAGG - Intergenic
922930192 1:229382775-229382797 GAGTAGCTGGGACCACAGGCAGG + Intergenic
923042788 1:230331754-230331776 GAGTAGCTGGGACTCCAGGTGGG + Intronic
923344459 1:233037456-233037478 GAGTAGCTGGGACCTCAGGCAGG + Intronic
923606935 1:235452675-235452697 GAGTAGCTGGGACCACAGGCAGG + Intronic
924210793 1:241765057-241765079 GAGTAGCTGGGACCACAGGTGGG - Intronic
924664500 1:246057033-246057055 GAGTAGCTGGGACCACAGGCAGG - Intronic
924719390 1:246607951-246607973 GAGCAGCTGGGACTACAGGCGGG - Intronic
1062920426 10:1274948-1274970 AGGCGGCTGGCACCCCAAGAAGG + Intronic
1063104232 10:2978943-2978965 GAGCAGCTGGGACCACAGGTGGG - Intergenic
1063168243 10:3483242-3483264 GAGTAGCTGGGACCACAGGCAGG - Intergenic
1063300108 10:4843529-4843551 GGGCAGCTCAGACACCAAGAGGG - Intronic
1063632290 10:7745619-7745641 GAGTAGCTGGGACTCCAGGCAGG - Intronic
1064200923 10:13284193-13284215 GAGTAGCTGGGACCACAGGCTGG - Intronic
1064729484 10:18315564-18315586 GAGCAACTGGGACCACAGGCAGG - Intronic
1065210463 10:23397620-23397642 GAGGAGCTGGGACCACAGGCAGG - Intergenic
1065625353 10:27624224-27624246 GAGCAGATGGTAACCCAGGAAGG + Intergenic
1065780101 10:29159432-29159454 GAGTAGCTGGGACTACAAGCAGG + Intergenic
1066086492 10:31976849-31976871 GAGTAGCTGGGACTACAGGAGGG - Intergenic
1067448363 10:46366818-46366840 CAGCAGCTGGAAGGCCAAGAGGG + Intergenic
1067589014 10:47493948-47493970 CAGCAGCTGGAAGGCCAAGAGGG - Intergenic
1067636139 10:48002039-48002061 CAGCAGCTGGAAGGCCAAGAGGG - Intergenic
1067702378 10:48583214-48583236 AGGCAGCTGGGACACCAGGATGG - Intronic
1068989429 10:63135057-63135079 GAGTAGCTGGGACCACAGGCGGG - Intronic
1070119844 10:73565386-73565408 GAGTAGCTGGGACCACAGGCAGG - Intronic
1070132700 10:73666044-73666066 CAGCAGCTGGAAGGCCAAGAGGG - Intergenic
1070828468 10:79404625-79404647 GAGCAAACGGGACCCAAAGAGGG - Intronic
1071207601 10:83299717-83299739 GAGTAGCTGGGACTACAGGAGGG + Intergenic
1071505424 10:86228843-86228865 AAAGAGCTGGGACCCCAGGAGGG + Intronic
1071510470 10:86259072-86259094 GAGCAGCTGTGGCCTCAAAAAGG + Intronic
1071524878 10:86352811-86352833 GTATAGCTGAGACCCCAAGAGGG + Intronic
1072697911 10:97617730-97617752 GAGTAGCTGGGACCACAGGCAGG - Intronic
1073085275 10:100884170-100884192 GAGTACCTGGGCCTCCAAGATGG + Intergenic
1073265230 10:102224000-102224022 GAGTAGCTGGGACCACAGGTGGG + Intergenic
1073462380 10:103673433-103673455 GAGTAGCTGGGACCACAGGTAGG - Intronic
1073883906 10:108015703-108015725 TAGCTGCTGGGAGCCCAAGTGGG + Intergenic
1075709778 10:124524702-124524724 GAGTAGCTGGGACCACAGGTGGG - Intronic
1076055983 10:127373222-127373244 GACCAGCAGGCACCTCAAGAAGG - Intronic
1076479421 10:130775143-130775165 GAGCAGGTGGCACCCCTGGAAGG - Intergenic
1076566421 10:131402758-131402780 GAGCAGCTGTTACCCCAGGTCGG + Intergenic
1076644774 10:131945585-131945607 GAGTAGCTGGGACCACAGGCAGG + Intronic
1076677723 10:132156125-132156147 GGGCAGCTGGGAGTCCCAGAAGG - Intronic
1077090455 11:776108-776130 GAGTAGCTGGGACTACAGGAGGG + Intronic
1077121818 11:912383-912405 GAGCAGATGGGGCCCGCAGATGG + Intronic
1077319998 11:1936835-1936857 GGGCTGCTGGGCCCCCATGAGGG - Intronic
1077473690 11:2776591-2776613 GAGCAGCTGTGCCTCCGAGATGG + Intronic
1077644384 11:3910464-3910486 GAGTAGCTGGGACTGCAAGCAGG - Intronic
1077652858 11:3989566-3989588 GAGCTGCTGAGATCCCCAGAAGG + Intronic
1078320526 11:10330673-10330695 AAGTAGCTGGGACTCCAAGTGGG + Intronic
1078326144 11:10382748-10382770 GAGGAGCTGAGACCCAGAGAGGG - Intronic
1079061486 11:17252545-17252567 GAGTAGCTGGGACTCCAGGTGGG - Intronic
1079594493 11:22225331-22225353 GAGTAGCTGGGACTACAAGAAGG - Intronic
1080499977 11:32861429-32861451 GAGTAGCTGGGACCACAGGCAGG - Intergenic
1081919318 11:46758013-46758035 GAGCAGCTGGGACTCCAGGCAGG + Intronic
1082020472 11:47528760-47528782 GAGTAGCTGGGACCACAGGCAGG - Intronic
1082278175 11:50243985-50244007 GAGTAGCTGGGACCAGAGGAAGG + Intergenic
1082838690 11:57670341-57670363 GAGCAGCTGGGATTACAGGAGGG - Intronic
1082933631 11:58634295-58634317 GAGCAGCTGGGACTACAGGCGGG - Intergenic
1084137528 11:67197299-67197321 GAGTAGCTGGGACCACAGGTGGG + Intronic
1084360113 11:68663824-68663846 GAGCAGCTGGGACCCTGGGCCGG + Intergenic
1084643702 11:70441875-70441897 GAGTAGCTGGGACTTCAAGCGGG - Intergenic
1084709815 11:70836911-70836933 AAGGAGGTGGGACCCCATGATGG + Intronic
1084853207 11:71960830-71960852 GAGCAGCTGGGCCACCACCAAGG - Exonic
1084866389 11:72061616-72061638 GAGTAGCTGGGACCACAGGCAGG + Intronic
1085314136 11:75533546-75533568 GAGCAGCTGGGACTACAGGCAGG - Intergenic
1085579547 11:77638365-77638387 GATCAGCTGGCACCACCAGATGG + Intergenic
1086761761 11:90639872-90639894 GAGCAACTGGGAACACTAGAGGG + Intergenic
1087838631 11:102899588-102899610 GAGTAGCTGGGACCACAGGTGGG + Intergenic
1088984420 11:114892951-114892973 GAGAAGCTGAGACCCAGAGAAGG + Intergenic
1089182411 11:116592184-116592206 TAGCAGCTGGAAGCACAAGAAGG + Intergenic
1089561553 11:119345810-119345832 AGGCAGCTGGGACCCCTAAAGGG - Exonic
1090293751 11:125568980-125569002 GAGTAGCTGGGACCACAGGCAGG + Intergenic
1090752438 11:129759347-129759369 GAGTAGCTGGGACCATAAGCAGG - Intergenic
1090752842 11:129762625-129762647 AAGTAGCTGGGACCACAGGAAGG - Intergenic
1091410149 12:233790-233812 TGGCAGCTGTGAACCCAAGAAGG + Intronic
1091613047 12:2027897-2027919 GAGCAGCTTGTCTCCCAAGAGGG + Intronic
1092275420 12:7057267-7057289 GAGTAGCTGGGACCACAGGATGG + Intronic
1092360536 12:7832601-7832623 GAGTAGCTGGGACTCCAGGCAGG + Intronic
1092476269 12:8821510-8821532 GAGTAGCTGGGACCACAGGTAGG - Intergenic
1092477227 12:8829525-8829547 GAGTAGCTGGGACCACAGGCAGG - Intronic
1094399291 12:30044382-30044404 GAGCAGCTGGAAACCACAGAAGG + Intergenic
1094701501 12:32874866-32874888 GAGTAGCTGGGACCACAGGTGGG + Intronic
1095398641 12:41789886-41789908 GAGCAGGTGGGACTCCCACAGGG + Intergenic
1095466646 12:42494677-42494699 GAGTAGCTGGGACTACAAGTGGG - Intronic
1095885892 12:47188060-47188082 GAACAGAAGGGACTCCAAGAAGG - Intronic
1096124919 12:49112155-49112177 GAGCAGCTGGGATCACAGGCAGG + Intergenic
1096174608 12:49504888-49504910 GAGTAGCTGGGACTACAAGGCGG + Intronic
1096297241 12:50394044-50394066 GAGTAGCTGGGACTCCAGGCAGG + Intronic
1096365788 12:51027210-51027232 GAGTAGCTGGGACCACAGGCGGG - Intronic
1096442456 12:51655507-51655529 CAGCAGCTGGGACCACCAGGGGG + Intronic
1096581123 12:52585993-52586015 GAGCAGCTGTGCCACCAAAAAGG - Exonic
1096647391 12:53046355-53046377 GAGTAGCTGGGACTACAAGATGG - Intergenic
1096743956 12:53713534-53713556 GAGTAGCTGGGACCACAGGCAGG - Intronic
1096865720 12:54561516-54561538 GAGCCCCAGGGCCCCCAAGAGGG - Intronic
1098072070 12:66686672-66686694 TAGCAGCTGGAACAGCAAGAAGG - Intronic
1098266216 12:68723240-68723262 GAGGAGCTGGGACTACAAGTGGG - Intronic
1099335879 12:81356533-81356555 AAGTAGCTGGGACCACAAGCGGG - Intronic
1099688421 12:85919778-85919800 GAGCAGCTGGGACTGCAGGCAGG + Intergenic
1099834907 12:87896811-87896833 GAGCTGCTGGGACCCCACAGAGG + Intergenic
1099858574 12:88202127-88202149 GAGCAGCTGGGACTACAGGCAGG - Intergenic
1100391717 12:94149997-94150019 GGTCAGCTGGGACTTCAAGACGG + Exonic
1100392549 12:94156603-94156625 GAGTAGCTGGGACCACAGGCGGG + Intronic
1100434801 12:94561645-94561667 GAGTAGCTGGGACCACAGGCAGG - Intergenic
1100911629 12:99370449-99370471 AAGCAGCTAGAAACCCAAGAAGG + Intronic
1100997382 12:100316965-100316987 GAGTAGCTGGGACCACAGGCAGG - Intronic
1101808581 12:108087963-108087985 AAGGAGCTGGGATCCCAGGAGGG + Intergenic
1101912846 12:108873500-108873522 AAGCAGCTGGGACTACAGGATGG - Intronic
1102285521 12:111653063-111653085 TAGTAGCTGGGACCACAGGAGGG - Intronic
1102508511 12:113398883-113398905 GAGCATCTGGGAGCCCAGGCAGG + Intronic
1103088576 12:118081111-118081133 GAGTAGCTGGGACCACAGGCAGG - Intronic
1103701744 12:122851717-122851739 GAGGTGCAGGGACCCCAGGAGGG - Intronic
1103772079 12:123335189-123335211 CAGCAGCTGGGAGGCCAAGGTGG + Intronic
1104020943 12:124991976-124991998 GAGTAGCTGGGATCACAAGCAGG + Intergenic
1104673631 12:130697692-130697714 GAGTAGCTGGGACCACAGGTGGG - Intronic
1105448392 13:20476605-20476627 GAGCAGCAGGGAGCCCAAGCCGG + Intronic
1105783962 13:23729246-23729268 GAGCAGCCAGCACCCCAAGTAGG - Intergenic
1106253885 13:28004431-28004453 GAGTAGCTGGGACCACAAGCAGG + Intronic
1106557123 13:30819186-30819208 GGGCAGCTGTGACCAAAAGAGGG - Intergenic
1107247509 13:38314424-38314446 GAGTAGCTGGGACCACAGGTGGG + Intergenic
1107738117 13:43419416-43419438 GAGCAGCTGGGACGACAGGAGGG - Intronic
1108034993 13:46281468-46281490 GAGTAGCTGGGACCACAGGCAGG + Intergenic
1108329567 13:49371722-49371744 GAGTAGCTGGGACCACAGGCAGG + Intronic
1108757006 13:53515143-53515165 GAGTAGCTGGGACCACAGGCAGG + Intergenic
1109180136 13:59203641-59203663 GCCCAGCTGGGACTCTAAGAGGG - Intergenic
1110235050 13:73208487-73208509 GAGCAGCTGGGACTACAGGCAGG - Intergenic
1111658006 13:91175874-91175896 GAGCGGCTGGGTCCCGCAGAGGG - Intergenic
1112950429 13:104988866-104988888 GAGCAGATGGGACTTCAGGATGG + Intergenic
1113802386 13:113093331-113093353 CTCCAGCTGTGACCCCAAGAAGG + Intronic
1113837807 13:113340349-113340371 GAGTAGCTGGGACCACAGGTGGG - Intronic
1114842471 14:26281528-26281550 TGGCAGCTGGGTCCCAAAGAGGG + Intergenic
1114858383 14:26482825-26482847 AAGCAGCTGGGACTACAGGAAGG + Intronic
1115562845 14:34598754-34598776 AAGTAGCTGGGACTCCAAGCAGG - Intronic
1115678084 14:35703348-35703370 GAGTAGCTGGGACCACAGGGAGG - Intronic
1117619886 14:57575087-57575109 GAGCAGGTGGCACCACTAGATGG - Intronic
1118230719 14:63946298-63946320 GAGAAGCTGGGACCACAGGCAGG - Intronic
1118232582 14:63966991-63967013 GAGTAGCTGGGACCACAGGCAGG + Intronic
1118800006 14:69181049-69181071 GAGTAGCTGGGACCACAGGCAGG + Intergenic
1119186537 14:72646787-72646809 GAGCAGCCGGGTCGCCAAAATGG - Intronic
1119346255 14:73927211-73927233 GAGTAGCTGGGACCACAGGCAGG + Intronic
1120283785 14:82471748-82471770 GACCAGCTAGAACCCTAAGAGGG + Intergenic
1120829849 14:88988079-88988101 GAGTAGCTGGGACCACAGGCGGG - Intergenic
1120910377 14:89661216-89661238 GAGCAGCTGAGACCACAGGCCGG + Intergenic
1120962054 14:90134088-90134110 GAGTAACTGGGACCACAAGCAGG - Intronic
1121125435 14:91403800-91403822 GAGTAGCTGGGACCACCAGTGGG - Intronic
1121586328 14:95065452-95065474 GAGCCGCAGGGAGCCCAGGAAGG - Intergenic
1122015636 14:98793378-98793400 GAGCAGGTGGGAATTCAAGATGG + Intergenic
1122042682 14:99000135-99000157 GAGAAGCGGGGGCCCCCAGATGG - Intergenic
1122739427 14:103862992-103863014 GAGTAGCTGGGACCACAGGCAGG - Intergenic
1122755402 14:103974766-103974788 GAGTAGCTGGGACTACAAGAGGG + Intronic
1122819227 14:104332915-104332937 GAGCTTCTGGGACCCCAGGGAGG - Intergenic
1122931702 14:104936087-104936109 GAGCAGCAGGGGCCCCCACAGGG - Exonic
1124250330 15:28102725-28102747 GAGAAGCTGGGACCACAGGTGGG + Intergenic
1124493315 15:30171701-30171723 GAGCAGCTGGGGGCCCCAGCAGG - Intergenic
1124750219 15:32366624-32366646 GAGCAGCTGGGGGCCCCAGCAGG + Intergenic
1124900946 15:33821751-33821773 GAGTAGCTGGGAACGCAACATGG + Intronic
1125518584 15:40336239-40336261 CAGCAGCTGGGGACCCAGGATGG - Intronic
1125626882 15:41116140-41116162 CGGCTCCTGGGACCCCAAGATGG + Exonic
1125648875 15:41296964-41296986 AAGTAGCTGGGACCACAAGAGGG + Intergenic
1125954926 15:43783887-43783909 GAGTAGCTGGGACTACAAGCGGG + Intronic
1128090657 15:64916711-64916733 GAGCAGCTGGGCTCCAGAGAGGG + Intronic
1128223738 15:65987095-65987117 GTGCCCCTGGGTCCCCAAGAGGG + Intronic
1128472710 15:67968424-67968446 GAACAGCTCAGCCCCCAAGAGGG + Intergenic
1128500693 15:68225608-68225630 GAGTAGCTGGGACCACAGAAAGG + Intronic
1129171669 15:73811805-73811827 AAGCAGGGGAGACCCCAAGAGGG + Intergenic
1129844420 15:78761693-78761715 GAGCAGCTGGGGCTGCAGGAAGG + Intronic
1130057736 15:80542967-80542989 GAGTAGCTGGGACCACAGGCAGG - Intronic
1130059062 15:80556583-80556605 GATGACCTGGGAGCCCAAGAGGG + Intronic
1130417990 15:83712450-83712472 TAGCAGTAGGGACTCCAAGAAGG - Intronic
1131007006 15:88986597-88986619 GAGTAGCTGGGACTACAGGAGGG - Intergenic
1131105738 15:89733010-89733032 GAAGAGCAGCGACCCCAAGAGGG - Exonic
1131214873 15:90529059-90529081 GACCAGCTGGGACCACAGGCGGG - Intergenic
1131303169 15:91217804-91217826 GAGGAGCTGAGAACCCCAGAAGG + Intronic
1131809566 15:96158663-96158685 GAGTAGCTGGGACTGCAGGAAGG - Intergenic
1132231898 15:100190592-100190614 CAGCAGGAGGAACCCCAAGAGGG + Intronic
1132470303 16:98808-98830 GAGTAGCTGGGACCCCAGGTGGG - Intronic
1133189362 16:4122109-4122131 GAGCAGCTGGGACCACAGGCAGG + Intergenic
1133360140 16:5167796-5167818 GAGTAGCTGGGACCTCAGGCAGG - Intergenic
1133389117 16:5394990-5395012 GAGCAACTGGGAGCCAATGAAGG - Intergenic
1133577756 16:7110230-7110252 GAGAAGCTGGGACTACACGAGGG - Intronic
1133726004 16:8538175-8538197 GAGTAGCTGGGACTACAAGCAGG - Intergenic
1134018693 16:10906996-10907018 GAGGAGCTGGAAGCGCAAGATGG + Exonic
1134021607 16:10924898-10924920 GAGCAGTGGGTACCCCAAAATGG - Exonic
1134275944 16:12776252-12776274 TAGAAGCTGGAACCCCTAGAAGG + Intronic
1135170459 16:20179054-20179076 GAGGGGCTGAGACCCCAGGAAGG - Intergenic
1135535212 16:23288679-23288701 GAGTAGCTGGGACCACAGGTGGG - Intronic
1135762402 16:25147815-25147837 GAGTAGCTGAGACCCCAGGAAGG + Intronic
1136283171 16:29226101-29226123 ATGAAGCTGGGACCCCATGATGG + Intergenic
1136372256 16:29843770-29843792 GAGTAGCTGGGACTACAAGCTGG - Intronic
1137718521 16:50613418-50613440 AGGCAGCAGGGACCCCCAGATGG + Intronic
1137924769 16:52530125-52530147 GGGCAGCAGGGACTTCAAGAAGG + Intronic
1138483346 16:57318638-57318660 GAGCAGCTGGGTCACAAAGATGG - Intergenic
1139276392 16:65731658-65731680 AAGGGGCTGGGAGCCCAAGATGG + Intergenic
1139417134 16:66821995-66822017 GAGTAGCTGGGACCACAAGCAGG + Intronic
1139646254 16:68333118-68333140 GAGTAGCTGGGACCACAGGCAGG + Intronic
1139683343 16:68582327-68582349 GAGCAGCTGGGACTGCAGGGAGG - Intergenic
1139738778 16:69016785-69016807 GAGTAGCTGGGACCACAGGCAGG + Intronic
1139841629 16:69886205-69886227 GAGTAGCTGGGACCACAGGTGGG + Intronic
1140031256 16:71341039-71341061 GAGTAGCTGGGACCACAGGCAGG - Intergenic
1140785585 16:78338302-78338324 CAGCAGCTGGGAATCCATGAGGG - Intronic
1140826631 16:78713142-78713164 AAGCAGCTGGGACCACAGGTAGG - Intronic
1141020030 16:80486528-80486550 GAGTAGCTGGGACCACAGGCAGG - Intergenic
1141470165 16:84232769-84232791 GAGCAGCTGGGACCACAGGCAGG - Intronic
1142256330 16:89015475-89015497 AAGCAGCTGGGAGCCCAGGGAGG - Intergenic
1142307995 16:89296114-89296136 GAGTAGCTGGGACCACAGGTGGG + Intronic
1142385199 16:89759631-89759653 GAGTAGCTGGGACCACAGGTGGG - Intronic
1142485765 17:246923-246945 GAGCAGCGGGGACCTCCAGCAGG - Intronic
1142809138 17:2387123-2387145 GGGCAGCTGGGAGCCCAGGTGGG + Exonic
1143145560 17:4772840-4772862 GAGCAGCTGGAACCACAGGTGGG + Intronic
1143432195 17:6895373-6895395 GAGAAACTGGTACCCAAAGAAGG - Intronic
1143496917 17:7317719-7317741 GAGAAACGGGGATCCCAAGAGGG - Intronic
1143600450 17:7942137-7942159 GAGTAGCTGGGACTACAAGCTGG - Intronic
1143636850 17:8169755-8169777 GAGTAGCTGGGACCACAGGCGGG - Intergenic
1143661310 17:8326308-8326330 GAGTAGCTGGGACCACAGGCAGG + Intergenic
1143693402 17:8590438-8590460 GAGTAGCTGGGACCACAGGCAGG + Intronic
1143791432 17:9299109-9299131 AAGCAGATGTGAACCCAAGATGG - Intronic
1144455247 17:15413139-15413161 GAGCAGATGTGTCCCCATGAGGG - Intergenic
1145073865 17:19835275-19835297 GAGTAGCTGGGACTACAGGATGG + Intronic
1145099685 17:20064222-20064244 GAGCAGCTGGGGGCCAGAGAAGG + Intronic
1145246074 17:21270467-21270489 GAACAGCTGGGACCACATGTTGG + Intergenic
1145362476 17:22223538-22223560 GAGTAGCTGGGACCACAGGCAGG + Intergenic
1145751694 17:27359774-27359796 GAGTAGCTGGGACCACAGGCAGG + Intergenic
1145763883 17:27444698-27444720 GAGTAGCTGGGACCACAGGCGGG + Intergenic
1145832604 17:27928999-27929021 GAGTAGCTGGGACTACAAGCAGG + Intergenic
1147331836 17:39703928-39703950 GAGCAGCTGGGGCTGCAAGCTGG + Intronic
1147598222 17:41730367-41730389 GAGTAGCTGGGACCACAGGTGGG + Intronic
1148449842 17:47769826-47769848 GAGCTGCTGAGACTCCAATAAGG - Intergenic
1148548394 17:48534000-48534022 GAGCAGCTGGGACTTCAGGGAGG - Intergenic
1148791202 17:50173997-50174019 GAGGAGCTGGGGCCCCAGGCAGG - Intronic
1149481171 17:57004260-57004282 GAGCAGCTGAGACCACAGGCAGG - Intronic
1149538546 17:57451461-57451483 GGACAGCTGGGAGCCCACGATGG - Intronic
1149953692 17:61021181-61021203 GAGTAGCTGGGACTACAAGTGGG + Intronic
1150502247 17:65662094-65662116 GAGTAGCTGGGACCACAGGTGGG + Intronic
1151000269 17:70368180-70368202 GAGCAGCTGGGAACACTTGATGG + Intergenic
1151476962 17:74349581-74349603 GAGTAGGTGGGATCCCACGAGGG + Intronic
1151487182 17:74408278-74408300 GAGTAGCTGGGACCACAAATCGG - Intergenic
1151948079 17:77330224-77330246 GAGCAGCAGGTGCTCCAAGAGGG - Intronic
1151993613 17:77594626-77594648 GCACAGCATGGACCCCAAGAGGG - Intergenic
1152191551 17:78891328-78891350 GTGGCGCTGGGACCCCAAGAGGG - Exonic
1152523481 17:80873958-80873980 GAGCAGCGGGTACCCCAGAAGGG + Intronic
1152653478 17:81508108-81508130 GAGTAGCTGGGACCACAGGCAGG + Intergenic
1153238159 18:3008312-3008334 GAGTAGCTGGGACCACAGGGAGG - Intronic
1153524515 18:5981685-5981707 GAGTAGCTGGGACTACAAGCAGG - Intronic
1153854709 18:9135262-9135284 GAGCAGCTGGGAGCACAGGCAGG + Intergenic
1154173768 18:12068403-12068425 GAGCAGCACGTACGCCAAGAGGG - Intergenic
1155251813 18:23959901-23959923 GAGCAGCTGGGACTACAGGTGGG - Intergenic
1155745216 18:29348035-29348057 GAGTAGCTGGGACCAAAAGTGGG + Intergenic
1158450570 18:57560521-57560543 GAGTAGCTGGGACCACAGGCAGG - Intronic
1158956528 18:62545414-62545436 GAGGAGCTGGAACTCAAAGAAGG - Intronic
1159743681 18:72205931-72205953 ACCCAGCTGGGACCCTAAGAGGG - Intergenic
1160929768 19:1564916-1564938 GAGAAGCTGGGAGCCACAGATGG + Intronic
1160980331 19:1813682-1813704 GAGTAGCTGGGACCACAAGCAGG + Intergenic
1160982059 19:1820869-1820891 GAGTAGCTGGGACCACAAGCCGG - Intronic
1161443886 19:4307180-4307202 AAGTAGCTGGGACCACAGGAAGG + Intronic
1161681708 19:5682992-5683014 GAGCAGCTAGGACTACAAGTGGG - Intronic
1161681827 19:5683764-5683786 GAGCAGCTGGGACTACAGGTGGG - Intronic
1161926545 19:7304822-7304844 GAGTAGCTGGGACCACAGGCAGG - Intergenic
1163065100 19:14786599-14786621 CAGGAGGTGGGACCCCAAGCAGG - Intergenic
1163396183 19:17063232-17063254 GAGTAGCTGGGACCACAGGCGGG - Intronic
1163524886 19:17814791-17814813 GAGTAGCTGGGACCATAAGTGGG - Intergenic
1163589151 19:18181379-18181401 GAGTAGCTGGGACTACAAGCGGG + Intergenic
1163798942 19:19353564-19353586 GAGCACTTGGGAAGCCAAGATGG - Intronic
1163814277 19:19454469-19454491 GAGTAGCTGGGACCACAGGTGGG - Intronic
1163838172 19:19588998-19589020 GAGTAGCTGGGACTACAAGTGGG - Intronic
1164870382 19:31638622-31638644 GTGCTGGTGGGTCCCCAAGAAGG + Intergenic
1165334075 19:35156870-35156892 CAGGAGCAGGGAGCCCAAGAAGG + Intronic
1165791039 19:38492696-38492718 GAGCCTCTGGGTCCCAAAGAGGG + Intronic
1166077296 19:40421138-40421160 GAGGCTCTGGGACCCCACGATGG + Intergenic
1166274186 19:41740360-41740382 GGGGAGCAGGGACCTCAAGAGGG + Intronic
1166504715 19:43363970-43363992 GAGTAGCTGGGACCAGTAGAGGG - Intergenic
1166666023 19:44680945-44680967 GGGCGGGTGGGAGCCCAAGACGG - Intronic
1167069705 19:47213767-47213789 GAGTAGCTGGGACCACAGGCAGG + Intergenic
1167110806 19:47459942-47459964 CAGCAGCTGGGACCACAGGGTGG - Intronic
1167115761 19:47488243-47488265 GAGCAGATGGGACAGGAAGACGG + Exonic
1167154784 19:47731435-47731457 GAGTAGCTGGGACTCCAGGCAGG + Intronic
1167329141 19:48843606-48843628 AAGCAGCTGGGACCACAGGTGGG + Intronic
1167435698 19:49477314-49477336 GAGTAGCTGGGACCACAGGTGGG - Intronic
1167769730 19:51507613-51507635 GAGCTCCAGGGACCCCAAGTTGG - Intergenic
1168121436 19:54254391-54254413 GAGAGGCTGGGATCCCCAGAGGG + Exonic
1168177040 19:54633640-54633662 GGGGAGCTGGGGCCCCCAGACGG - Exonic
1168238806 19:55079130-55079152 AAGCAGCTAGGCCCCCAAGCAGG + Intronic
1168411687 19:56144179-56144201 GAGCAGCTGGGACCACAGGCAGG - Intronic
925366235 2:3313979-3314001 GAGCCGCTGGGACCCGGGGAGGG + Intronic
925725201 2:6865358-6865380 GAGCAGCTGGCACCGCTGGAAGG + Exonic
925772238 2:7294005-7294027 GAGAAGCTGGGAGCCAGAGAGGG + Intergenic
925929107 2:8693518-8693540 GGGCTGCTGGGACCCCCAGGTGG - Intergenic
926071356 2:9895371-9895393 GAGTAGCTGGGACCACAGGCAGG - Intronic
927514189 2:23662534-23662556 GAGGGGCTGGAACCCCAGGAGGG - Intronic
928373966 2:30760208-30760230 GAGTAGCTGGGACCACAGGCAGG + Intronic
928543879 2:32310744-32310766 GAGTAGCTGGGACCACAGGCAGG - Exonic
929492551 2:42408891-42408913 GAACAGCAGGGCCCCAAAGAGGG - Intronic
929792129 2:45031132-45031154 GAGCAGCTGGGGCACCAAGAAGG - Intergenic
930129784 2:47837856-47837878 GAGTAGCTGGGACCACAGGCAGG + Intronic
930213070 2:48663306-48663328 GAGAAGCTGGAACTACAAGAGGG - Intronic
930700059 2:54450690-54450712 GAGCAGCTGGGATTACACGAGGG + Intergenic
930808139 2:55512529-55512551 GAGTAGCTGGGACTACAAGCAGG + Intergenic
932959442 2:76395793-76395815 GAGCAGCTGTGGTCCTAAGAAGG + Intergenic
933666128 2:84966642-84966664 GAGTAGCTGGGACTACAGGAGGG - Intergenic
934663874 2:96157166-96157188 GAGCTGCAGGGCACCCAAGAGGG - Intergenic
935064024 2:99632607-99632629 TAGGAGCTGGGCCCCTAAGAAGG - Intronic
935597183 2:104888381-104888403 GGGCAGCTGGGACCTCAGGCTGG + Intergenic
936079711 2:109423878-109423900 GCACAGCTGGGACCCCAAGCAGG + Intronic
936512856 2:113162379-113162401 CAGTAGCTGGGACCACAAGCAGG + Intronic
937945692 2:127333969-127333991 GAGTAGCTGGGACCACAGGCAGG - Intronic
937975003 2:127577107-127577129 GTGCAGCTGGGAGCACAGGAAGG - Intronic
938566787 2:132525850-132525872 GAGCTGCTGGGGCCCAAAAAAGG + Intronic
944271398 2:197787368-197787390 GAGTAGCTGGGACCACAGGCAGG + Intergenic
944539453 2:200742150-200742172 CACCACCTGGGACCCCATGATGG + Intergenic
944647203 2:201791897-201791919 GAGTAGCTGGGACCACAGGCAGG + Intronic
945145582 2:206734707-206734729 GAGTAGCTGGGACCACAGGCAGG + Intergenic
945774288 2:214085242-214085264 GAGCAGCTGGGACTACAGGAAGG - Intronic
945952209 2:216050092-216050114 GAGTAGCTGGGACCACAGGCAGG - Intronic
946020761 2:216638375-216638397 GAGCAGCTGGGACTACAGGCAGG - Intronic
946266001 2:218541992-218542014 GAGCAACTGGTAACCAAAGATGG + Intronic
946766998 2:223050178-223050200 GGGCAGCAGGGACTCCAAGCAGG + Intergenic
947755597 2:232562085-232562107 GAGTAGCTGGGACCACAAGTGGG - Intronic
947868145 2:233415749-233415771 GAGTAGCTGGGACCACAGGCAGG + Intronic
948444832 2:238024471-238024493 GAGTAGCTGGGACTACAAGCAGG + Intronic
948472246 2:238191080-238191102 GAGCAGCTGGGACTGAAAGCAGG + Intronic
948880978 2:240856970-240856992 CAGCAGCTGGGTCCCAAAAAGGG - Intergenic
1169416648 20:5422949-5422971 GAGTAGCTGGGACCACAGTATGG - Intergenic
1169701420 20:8451473-8451495 GAGTAGCTGGGACCACAGGTGGG + Intronic
1170441397 20:16383117-16383139 GAGCAGCTGGGACCACAGTATGG + Intronic
1170864215 20:20138446-20138468 ACTCAGCTGGCACCCCAAGAGGG - Intronic
1170928865 20:20750364-20750386 GAGCAGCTGGGACTACAGGAGGG - Intergenic
1172118452 20:32584605-32584627 CAGCGGCCGGGAACCCAAGATGG - Intronic
1172521652 20:35570757-35570779 GAGTAGCTGGGACAACAAGCAGG + Intergenic
1172694787 20:36815171-36815193 GAGCCCCTGGGAGCCCAAGGGGG + Exonic
1173603416 20:44311818-44311840 GAGTAGCTGGGACCACAGGCGGG + Intergenic
1173789352 20:45817570-45817592 GACCAGCTGGGTCCCCACAAGGG + Intergenic
1174310737 20:49651949-49651971 GAGTAGCTGGGACACCAGGTGGG - Intronic
1174344387 20:49919138-49919160 GAGTAGCTGGGACCACAGGTGGG - Intergenic
1174506382 20:51020306-51020328 GAGCAGTGGGGACCTCAGGACGG + Intronic
1174630703 20:51954500-51954522 CAGCATCTGGGAGGCCAAGATGG - Intergenic
1175098026 20:56557624-56557646 GAGTAGCTGGGACTCCAAGAGGG - Intergenic
1175746775 20:61462602-61462624 GAGCAGCTGGGAGCACAAAGGGG - Intronic
1175849916 20:62084532-62084554 GAGTAGCTGGGACCACAGGCAGG - Intergenic
1176114990 20:63428302-63428324 GGGCAGCTGGGGCCCCCAGGAGG + Intronic
1176160645 20:63646146-63646168 GAGCAGCACAGAGCCCAAGAGGG + Intronic
1176192870 20:63821413-63821435 GAGCAGCTGGGACTACAAGCAGG + Intronic
1176364033 21:6021810-6021832 GAGCAGCAGAGACCCCAGGAAGG - Intergenic
1177324854 21:19572296-19572318 CAGCAGCTGAGAGCACAAGATGG + Intergenic
1178040860 21:28639581-28639603 GAGCAGGTGGGACCTAAATAAGG + Intergenic
1178396834 21:32250376-32250398 GAGCAGCTGGGATCCCAGCAAGG + Intergenic
1178487890 21:33030365-33030387 GAGCAGCTGGGGGCTGAAGACGG + Intergenic
1178901896 21:36605231-36605253 GAGCTGCTGGCACCCCAAGAAGG - Intergenic
1178940383 21:36900541-36900563 GAGCAACAGGGAGCCCCAGAAGG + Intronic
1179759485 21:43516735-43516757 GAGCAGCAGAGACCCCAGGAAGG + Intergenic
1180813793 22:18777225-18777247 GAGCAGCTGGGACCAGAGGCAGG - Intergenic
1180840432 22:18956584-18956606 GAGTATCTGAGACCCCAGGAGGG + Intergenic
1181825249 22:25509746-25509768 AAGCAGCGAGGCCCCCAAGAAGG - Intergenic
1182128107 22:27830912-27830934 GAGTAGCTGGGACCACAGGTGGG + Intergenic
1183160619 22:36110609-36110631 GGGCAGTTTGGACCCAAAGAAGG - Intergenic
1183300624 22:37057339-37057361 GAGCACCAGGCACCCCAGGAGGG - Intronic
949677902 3:6478596-6478618 GAGTAGCTGGGACTACAAGCAGG - Intergenic
950054265 3:10012244-10012266 GAACAGGTGGGACCCCCAGGAGG - Intergenic
950305450 3:11912680-11912702 GAACAGGTGGGACCCCCAGGAGG - Intergenic
950416197 3:12870165-12870187 GAACAGGTGGGACCCCCAGGAGG - Intronic
950433206 3:12963360-12963382 GAGCAGCTGGGACCCCAAGAAGG + Intronic
950579657 3:13853954-13853976 GAGCAGCTGGGACCACTGCAGGG + Intronic
950666349 3:14497605-14497627 GAGCAGCAGGGAGCCCCTGAAGG + Intronic
950720920 3:14881997-14882019 TAGCAGCCAGGACCCCAGGAGGG + Intronic
950731827 3:14966457-14966479 GAGTAGCTGAGACCACAGGAAGG - Intronic
951890264 3:27561796-27561818 GAGTAGCTGGGACTACAAGCGGG + Intergenic
953442692 3:42932397-42932419 GAGGAGCTGTGATCTCAAGAGGG - Intronic
953853691 3:46484923-46484945 GAGCAGCCGGGTCCCAGAGAGGG - Intronic
954453099 3:50582260-50582282 GGGCAGCTGGGGCCACAAGCAGG + Exonic
954867168 3:53739475-53739497 GAGAAGCAGGGACCCCAGAAAGG + Intronic
955029302 3:55201047-55201069 GACAAGCTTGGGCCCCAAGAAGG - Intergenic
956607323 3:71085855-71085877 GAGTAGCTGGGACCACAGGCGGG + Intronic
956750298 3:72339771-72339793 GAGCAGCAGGGACAGGAAGAGGG + Intergenic
956857607 3:73291428-73291450 GGCCAGCTTGGAACCCAAGATGG - Intergenic
960802035 3:121549594-121549616 GAGTAGCTGGGACCACAGGTGGG + Intergenic
961216399 3:125163829-125163851 GAGCAGCTGGGCTCCCAAGCTGG + Intronic
961737289 3:129010302-129010324 GAGCAGCTGAGTCCCCTTGATGG + Intronic
961785694 3:129345259-129345281 GAGCAGGAGGGACACCCAGAAGG - Intergenic
962221794 3:133570694-133570716 GAGTAGCTGGGATCACAAGTAGG - Intergenic
964967447 3:162514374-162514396 GAGTAGCTGGGACTACAAGCGGG + Intergenic
965575686 3:170216122-170216144 GAGTAGCTGGGACCACAGGCAGG + Intergenic
965797924 3:172460517-172460539 GTGCAGCTGGAACACAAAGATGG - Intergenic
966686730 3:182703614-182703636 GAGCTCCTGGGTCCCCAGGAAGG - Intergenic
966939878 3:184739156-184739178 TAGGAGCTGGGACCAGAAGAGGG + Intergenic
967879685 3:194292600-194292622 TAGGTGCTGGGACACCAAGAGGG + Intergenic
968136720 3:196225099-196225121 GAGTAGCTGGGACCACAGGCAGG + Intronic
968256365 3:197277017-197277039 GAGTAGCTGGGACCACAGGAGGG + Intronic
968260714 3:197321690-197321712 GAGTAGCTGGGACTACAGGAAGG - Intergenic
968457644 4:707156-707178 GAAGGGCTGGGACCCCAAGATGG + Intronic
968763679 4:2457078-2457100 GAGTAGCTGGGACCACAGGCAGG + Intronic
968984828 4:3869429-3869451 GAACACCTGGGGCCCCAAGAGGG - Intergenic
969053751 4:4389063-4389085 GAGCAGCTGGGGGCCCAGGCAGG - Intronic
969345000 4:6564575-6564597 AGGCAGCTGGGACCCCAAGAGGG - Intergenic
969556269 4:7912973-7912995 GAGTAGCTGGGACCACAGGCAGG + Intronic
969672718 4:8598558-8598580 GAGCAGCAGGAACCCGGAGAAGG - Intronic
970663248 4:18309382-18309404 GAGATGCTGGGACCCCTACAAGG + Intergenic
971388467 4:26162870-26162892 GAGCGGCAGGGAGACCAAGAAGG + Intergenic
972478051 4:39471459-39471481 GAGCAGCTGGGACTACAGGCGGG + Intronic
972496549 4:39639651-39639673 GAGTAGCTGGGACTACAAGCGGG - Intergenic
973238737 4:47934203-47934225 GAGGAGCTGGGACTCAGAGATGG - Intronic
973997525 4:56474280-56474302 GAGAACCTGGGCCTCCAAGAAGG + Exonic
974569333 4:63624839-63624861 GCTCAGCTGGCACCCAAAGAGGG + Intergenic
978706215 4:111714999-111715021 GAGTAGCTGGGACCCCAGGCAGG - Intergenic
979275078 4:118806445-118806467 GAGTAGCTGGGACCACAGGTGGG + Intronic
980892843 4:138833248-138833270 GAGCTGCTGGGAGCCTATGATGG - Intergenic
980967317 4:139534777-139534799 GAGCAGATGGGACGCAAAGCGGG + Intronic
981697817 4:147576301-147576323 GAGTAGCTGGGACCACAGGAAGG + Intergenic
981998761 4:151002884-151002906 GAGTAGCTGGGACCACAGGCAGG - Intronic
982157947 4:152539911-152539933 GAACTGCAGGGACCCAAAGAGGG + Intergenic
982237256 4:153263199-153263221 AAGTAGCTGGGACCACAAGTGGG - Intronic
983287957 4:165763381-165763403 GAGCAGCTGGGACTACAGGTGGG - Intergenic
983550478 4:169012166-169012188 GAGTAGCTGGGACCACAGGTAGG - Intergenic
983779478 4:171650699-171650721 GAGCAGCTGGGAGCCCAAAGAGG + Intergenic
984169223 4:176341527-176341549 GAGTAGCTGGGAACACAGGAAGG + Intergenic
984782647 4:183539802-183539824 GAGTAGCTGGGACCACAGGCAGG - Intergenic
985015287 4:185627335-185627357 GAGTAGCTGGGACCACAGGTGGG + Intronic
985631938 5:1018356-1018378 GAGCAGGTGGGACCACTAGCAGG + Intronic
988553806 5:32219677-32219699 GAGTAGCTGGGACTGCAGGAAGG + Intergenic
989152592 5:38315099-38315121 TACCAGCTAGGACACCAAGAAGG + Intronic
990649377 5:57880927-57880949 CAGCAGCTGGGAGGCCAAGCTGG - Intergenic
991074979 5:62525509-62525531 GAGTAGCTGGGACTCTAAGCAGG + Intronic
991362631 5:65836709-65836731 GAGCAGCTGGGACTACAGGTGGG + Intronic
991971764 5:72148337-72148359 GACCAGCTGAGACCCACAGAAGG + Intronic
992079340 5:73219326-73219348 GAGTAGCTGGGACTACAGGAAGG + Intergenic
992229056 5:74645327-74645349 GAGTAGCTGGGACTGCAAGCGGG + Intronic
992397706 5:76382725-76382747 GAGTAGCTGGGACTACAGGAGGG - Intergenic
993449968 5:88061401-88061423 GATCAGCTGGGAGCCCCAAAGGG + Intergenic
996695323 5:126388243-126388265 AAGCAGCTGGGACCACAGGCAGG - Intronic
997540028 5:134654029-134654051 GAGTAGCTGGGACCACAGGCTGG - Intronic
998529022 5:142868291-142868313 GAGCAGCTGGAGCCCAGAGAGGG + Intronic
999077024 5:148806077-148806099 GAGGGGCTGGGAGCCCAAGGGGG + Intergenic
999864571 5:155686730-155686752 AAGTAGCTGGGACTACAAGATGG - Intergenic
1000570622 5:162909016-162909038 GAGAGGCTGGGACTGCAAGAGGG + Intergenic
1001735007 5:173990238-173990260 GAGTAGCTGGGACCACAGGTGGG + Intronic
1001814141 5:174653859-174653881 GAGTAGCTGGGACCACAGGTAGG - Intergenic
1002024025 5:176384640-176384662 AAGTAGCTGGGACCACAGGATGG - Intronic
1002068826 5:176666324-176666346 GAGTAGCTGGGACCACAGGCAGG + Intergenic
1002485454 5:179532427-179532449 GAGTAGCTGGGACCACAGGCTGG - Intergenic
1002699542 5:181112941-181112963 AAGTAGCTGGGACCACAAGTGGG - Intergenic
1002973227 6:2046585-2046607 GAGTAGCTGGGACTACAAGCAGG + Intronic
1003090475 6:3098069-3098091 GAGTAGCTGGGACCGAAAGTGGG - Intronic
1003650417 6:7954520-7954542 GAGCAGCTGGGACCACAAATGGG - Intronic
1003712014 6:8602842-8602864 GCTCAGCTGGGTCCCCAAGCAGG - Intergenic
1003897263 6:10619475-10619497 GAGTAGCTGGGACCACAGGTGGG + Intronic
1004491898 6:16125625-16125647 GCGTAGCTGGGACCACAAGCAGG - Intergenic
1004514267 6:16308466-16308488 GAGCAGTTGGGAAACCAAGTGGG + Intronic
1006303981 6:33208196-33208218 GAATATCTGGGACCCCAGGAGGG - Intergenic
1008747377 6:54688924-54688946 AAGCAGATGGAACCCCAACAGGG + Intergenic
1012058821 6:94451608-94451630 GAGCAGCTGGGACTACAGGTGGG + Intergenic
1012429772 6:99152279-99152301 GTGCAGCTGGGACCCAGAAAAGG + Intergenic
1012509206 6:99983086-99983108 GAGTAGCTGGGACTTCAGGAGGG + Intronic
1013372359 6:109482336-109482358 GAGTAGCTGGGACCACAGGCGGG - Intronic
1013648450 6:112169181-112169203 GAGAAGCTGGGACCCTAGGCAGG + Intronic
1013820447 6:114147706-114147728 GAGTAGCTGGGACTACAAGCAGG + Intronic
1015986192 6:138886533-138886555 GAGTAGCTGGGACCACAGGCAGG + Intronic
1016019378 6:139219670-139219692 GAGCAGCTGGGAGGCTGAGACGG + Intergenic
1016608833 6:145964763-145964785 GAGCAGCTGGGACTACAGGCGGG - Intergenic
1017265153 6:152436427-152436449 GAGTAGCTGGGACCACAGGCAGG + Intronic
1017481975 6:154866295-154866317 GAGTAGCTGGGACCACAGAAAGG + Intronic
1017517309 6:155168482-155168504 GAGTAGCTGGGACCACAGGCGGG + Intronic
1018029260 6:159829228-159829250 GAGTAGCTGGGACCACAGGTGGG - Intergenic
1018828810 6:167426130-167426152 GAGCTGCAGGGACCCCACGGAGG + Intergenic
1018908178 6:168087192-168087214 GAGCAGCTGGGACCACAGGCGGG + Intergenic
1019276975 7:180887-180909 GAGTAGCTGGGACCACAGGTGGG + Intergenic
1019345418 7:527338-527360 GAGTAGCTGGGACTACAGGAGGG + Intergenic
1019378582 7:709792-709814 GGGTAGCTGGGACCACAAGCAGG + Intronic
1019422305 7:956567-956589 GAGTAGCTGGGACCACAAATGGG + Intronic
1019423554 7:962877-962899 GAAGAGCTGGGACCCCAGGGAGG + Intronic
1019641862 7:2107570-2107592 GAGCTGCTGGGACGCCAGCAGGG - Intronic
1019666713 7:2255609-2255631 GAGTAGCTGGGACCACAGGCAGG - Intronic
1019701632 7:2477121-2477143 GACCAGCTGGGCCCTCAAGGAGG + Intergenic
1019803163 7:3103471-3103493 GAGTAGCTGGGACCACAGGCAGG + Intergenic
1020340320 7:7103058-7103080 GAGTAGCTGGGACCACAGGCGGG + Intergenic
1022729464 7:33008863-33008885 GAGTAGCTGGGACCACAGGCAGG + Intergenic
1023032142 7:36099086-36099108 GAGAAGCTGTGGTCCCAAGAGGG + Intergenic
1023721702 7:43102022-43102044 GAGTAGCTGGGACCACAGGTGGG + Intergenic
1024259030 7:47560168-47560190 GAGGAGCTGGGGCCTCAGGAAGG + Intronic
1024713750 7:52049214-52049236 GAGTAGCTGGGACCACAGGTGGG - Intergenic
1025086183 7:56025385-56025407 GAGCAGCTGGGACTACAGGCAGG + Intronic
1026420897 7:70235903-70235925 GAGTAGATGGGAGCCCAAGGTGG - Intronic
1026462837 7:70630058-70630080 GAGCAGCTTGGATCGCAAAAGGG + Intronic
1026922247 7:74164542-74164564 GAGTAGCTGGGACCACAGGCAGG - Intergenic
1027601399 7:80245499-80245521 GGGCAGCTGCTACCCCATGAGGG - Intergenic
1029484558 7:100831600-100831622 GAGGAGCTGGGACCCCGCGCGGG + Intronic
1030545248 7:110886118-110886140 GCCCAGCTGGGACCCTAAGAGGG + Intronic
1031604136 7:123748669-123748691 GAGCAACAGGGACCCCACGTTGG + Exonic
1032229599 7:130063145-130063167 GAGTAGCTGGGACCACAAGGGGG + Intergenic
1033058027 7:138078087-138078109 GAGTAGCTGGGACCACAGGCAGG + Intronic
1033145025 7:138863872-138863894 GAGAATCTGGGGCCCCAAGGTGG + Intronic
1034763655 7:153696799-153696821 GAGCAGCTGGGCACCAAAGAAGG + Intergenic
1034859633 7:154584199-154584221 GAGCAGGTGGGACAGCAAGGGGG - Intronic
1034894899 7:154870105-154870127 GAGTAGCTGGGACCACAGGCAGG + Intronic
1034938875 7:155217406-155217428 GAGCAGCTGGGACCATAGGCAGG - Intergenic
1035029945 7:155850276-155850298 GAGCAGCTTGGAGCCGAGGAGGG - Intergenic
1035317520 7:158006092-158006114 GGGCAGCAGGTGCCCCAAGAAGG - Intronic
1035653244 8:1284737-1284759 GAGTAGCTGGGACCACAGGCAGG + Intergenic
1036411266 8:8503834-8503856 GAGCAGATGGGAGCCCAAGGAGG + Intergenic
1036432270 8:8702165-8702187 GAGCGGCCGGGACGCCAGGAGGG + Exonic
1036744774 8:11398924-11398946 GAGTAGCTGGGACTACAGGAGGG + Intronic
1036814632 8:11892325-11892347 AAGTAGCTGGGACCACAGGAGGG + Intergenic
1036944160 8:13079071-13079093 GAGTAGCTGGGACTGCAGGAAGG + Intergenic
1038569060 8:28643891-28643913 GAGTAGCTGGGACCACAGGTGGG + Intronic
1038952160 8:32427381-32427403 GAGCAGCTGTGATCGCAGGAAGG - Intronic
1039418858 8:37419220-37419242 CAGCAGCTGGGCCACCATGAGGG - Intergenic
1040546985 8:48406222-48406244 GAGCAGCTGGGCACCCACAAAGG - Intergenic
1040901288 8:52419582-52419604 GAGCAGCTGAGAGTCCCAGAGGG + Intronic
1042069712 8:64917788-64917810 GAACAGCTGGCATCCCAAAAGGG - Intergenic
1043607804 8:82023953-82023975 GAGTAGCTGGGACTGCAGGAGGG + Intergenic
1043855626 8:85261971-85261993 GAGCAACTGGGACCACAGGTGGG + Intronic
1043951037 8:86309459-86309481 GAGCAGCTGGGACTACAGGCAGG - Intronic
1044706948 8:95018165-95018187 GAGTAGCTGGGACCACAGGTGGG + Intronic
1045355777 8:101387676-101387698 TAGCAGATGGGACCCAAACAGGG + Intergenic
1045469389 8:102497548-102497570 GGGCAGCTGATACACCAAGAGGG + Intergenic
1046003472 8:108449238-108449260 GAGTAGCTGGGACCACAGGCGGG + Intronic
1046010764 8:108543958-108543980 GAGTAGCTGGGACCACAGGCAGG + Intergenic
1046061553 8:109145647-109145669 GAGCAGCTGAGACTACAAGCAGG + Intergenic
1048174045 8:132135446-132135468 GAGCAGCTGGGTTTCCAAGGAGG - Intronic
1048310127 8:133315626-133315648 GAGTAGCTGGGACCACAGGCAGG + Intergenic
1048851965 8:138653982-138654004 GAGCAGCTGGAAACCCCAGAAGG - Intronic
1049138714 8:140931435-140931457 GAGCAGCTGGGACTACAGGCAGG - Intronic
1049436915 8:142590638-142590660 GGGCAGCTGGGGCCCTCAGAGGG + Intergenic
1049439036 8:142600900-142600922 CAGCACCTGAGGCCCCAAGAAGG - Intergenic
1049536946 8:143186794-143186816 GACCAGCTGGGACCCCTGGGTGG - Intergenic
1049807431 8:144547345-144547367 GAGCAGCTGGGACTCCCAGCAGG - Exonic
1050549707 9:6738561-6738583 GAGTAGCTGGGACCACAGGTGGG + Intronic
1050833958 9:10052070-10052092 GAGTAGCTGGGACCACAGGCAGG + Intronic
1051390207 9:16555665-16555687 GAGTAGCTGGGACCACAGGTGGG - Intronic
1051499968 9:17765734-17765756 AAGCAGCTGGGATTACAAGAGGG - Intronic
1051520641 9:17983196-17983218 GAGCAGCTGGGACTACAGGTGGG + Intergenic
1051837585 9:21358617-21358639 GAGTAACTGGGACCACAAGCAGG + Intergenic
1052363807 9:27589311-27589333 GGGCAGCTGGCCACCCAAGATGG + Intergenic
1052496016 9:29225163-29225185 GAGTAGCTGGGACTACAGGAGGG - Intergenic
1052834499 9:33240489-33240511 GAGAAACTGAGGCCCCAAGAGGG - Intronic
1052893993 9:33730609-33730631 GAGTAGCTGGGACCATAAGCAGG - Intergenic
1052894397 9:33733874-33733896 AAGTAGCTGGGACCACAGGAAGG - Intergenic
1056066705 9:82942982-82943004 GAGTAGCTGGGACCACAGGCGGG - Intergenic
1056171929 9:83994644-83994666 AAGTAGCTGGGACCACCAGAAGG + Intronic
1056515154 9:87343116-87343138 CAGCAGCTGAGACTCCGAGAAGG + Intergenic
1056954473 9:91071335-91071357 GAGAGGCAGGGACCCCAACAGGG + Intergenic
1057689298 9:97268980-97269002 CAGTAGCTGGGACCACAAGCGGG + Intergenic
1058530501 9:105901179-105901201 GTGGAGCTGAGACCCCATGAGGG + Intergenic
1058833084 9:108836749-108836771 GAAAAGCTGGGGCCCAAAGAGGG + Intergenic
1058865410 9:109157512-109157534 GAGCAGCTGGGACCACAGGCAGG + Intronic
1059078189 9:111217686-111217708 GAGTAGCTGGGACCACAGGAAGG - Intergenic
1059710715 9:116865341-116865363 GAGTAGCTGGGACCACAGGCAGG - Intronic
1060075117 9:120583807-120583829 GAGTAGCTGGGACCACAAGCAGG + Intergenic
1060530707 9:124345786-124345808 GAGCAGCTGAGACTCCAGGACGG - Intronic
1060891568 9:127192520-127192542 GAGTAGCTGGGATCACAGGAGGG - Intronic
1060941376 9:127544999-127545021 GAGGAGCTGGGACACTAACAGGG - Intronic
1062044003 9:134416874-134416896 GTGCAGCAGGGACCCCAACATGG - Intronic
1062318331 9:135978740-135978762 GAGAAGCTGGGGCCCTAATAGGG - Intergenic
1062445417 9:136591907-136591929 AAGCAGCTGGGACCACAGGCAGG - Intergenic
1203688998 Un_GL000214v1:24550-24572 GAGTAGCTGGGACCACAGGCAGG + Intergenic
1203647277 Un_KI270751v1:79503-79525 GAGTAGCTGGGACCACAGGCAGG - Intergenic
1186148491 X:6649317-6649339 GAGTAGCTGGGACCACAGGTGGG + Intergenic
1186403016 X:9277105-9277127 GAGCAGCTGGGACTCCGGGCTGG + Intergenic
1186554158 X:10539870-10539892 GAGTAGCTGGGACCACAGGTAGG + Intronic
1187798793 X:23035987-23036009 GAGAAGCTGAGATCCCAAGAAGG - Intergenic
1189959755 X:46313023-46313045 GAGTAGCTGGGACTACAAGCAGG + Intergenic
1189995563 X:46633797-46633819 GAGCAGCTGGGACTACAGGCAGG + Intronic
1196268236 X:113678641-113678663 GAGTAGCTGGGACTACAAGGAGG + Intergenic
1196892284 X:120302740-120302762 GAGAAGCTGGGACCTAAAGTGGG - Intronic
1197771146 X:130090243-130090265 GAGTAGCTGGGACTACAGGAGGG - Intronic
1197862459 X:130985039-130985061 CAGCAGCTGGGGCCCCAGGAGGG + Intergenic
1198300743 X:135332117-135332139 GAGCAGCAGGTAGGCCAAGAAGG + Intronic
1198800769 X:140445716-140445738 GAGTAGCTAGGACCACAAGCAGG + Intergenic
1201390979 Y:13497243-13497265 AAGAAGCTGAGACCCCAAAATGG + Intergenic
1202039239 Y:20665324-20665346 GAGTAGCTGGGACCACAGGCAGG - Intergenic