ID: 950433875

View in Genome Browser
Species Human (GRCh38)
Location 3:12967352-12967374
Sequence CGCGGGGCGAGCGGCCTTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 101}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950433875_950433886 17 Left 950433875 3:12967352-12967374 CCGGGAAGGCCGCTCGCCCCGCG 0: 1
1: 0
2: 1
3: 12
4: 101
Right 950433886 3:12967392-12967414 GTCAAGCTCTAGCTCCAGAAGGG 0: 1
1: 0
2: 0
3: 14
4: 157
950433875_950433888 23 Left 950433875 3:12967352-12967374 CCGGGAAGGCCGCTCGCCCCGCG 0: 1
1: 0
2: 1
3: 12
4: 101
Right 950433888 3:12967398-12967420 CTCTAGCTCCAGAAGGGACTGGG 0: 1
1: 1
2: 0
3: 22
4: 151
950433875_950433885 16 Left 950433875 3:12967352-12967374 CCGGGAAGGCCGCTCGCCCCGCG 0: 1
1: 0
2: 1
3: 12
4: 101
Right 950433885 3:12967391-12967413 TGTCAAGCTCTAGCTCCAGAAGG 0: 1
1: 0
2: 1
3: 6
4: 122
950433875_950433887 22 Left 950433875 3:12967352-12967374 CCGGGAAGGCCGCTCGCCCCGCG 0: 1
1: 0
2: 1
3: 12
4: 101
Right 950433887 3:12967397-12967419 GCTCTAGCTCCAGAAGGGACTGG 0: 1
1: 0
2: 0
3: 14
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950433875 Original CRISPR CGCGGGGCGAGCGGCCTTCC CGG (reversed) Intronic
902929650 1:19721910-19721932 TGAGGGGCCAGCGGCCTCCCTGG + Intronic
903214993 1:21838953-21838975 CGCGTGGGCAGCAGCCTTCCTGG - Exonic
903337610 1:22635446-22635468 GGTGGGGCGGGGGGCCTTCCCGG + Intergenic
903855683 1:26336571-26336593 CGCGGGGGGCGGGGCCTCCCCGG - Intronic
905388999 1:37624324-37624346 TGCAGGGCAAGCGGCCTTGCAGG + Intronic
905548667 1:38818836-38818858 CGCGGGGAGGCCTGCCTTCCTGG - Intergenic
910647018 1:89524985-89525007 CGCGGGGAGCGCGGGCGTCCGGG + Exonic
914376377 1:147077271-147077293 CCCGGTGCGCGCGCCCTTCCCGG - Intergenic
914753225 1:150549547-150549569 CGCGGGGCGGGCGGTCTAACGGG - Intronic
915511209 1:156388047-156388069 CGCGGGGCCAGCGGCGTTGAGGG + Intergenic
916694660 1:167222060-167222082 CACGGGGCGGGTGGCCCTCCGGG + Intronic
923519407 1:234724443-234724465 CGCGGGGCTGGCGGCCGTCCAGG - Intergenic
1064208921 10:13347635-13347657 CGCGGCGGGAGCGGCCGGCCTGG - Intronic
1068955638 10:62817202-62817224 CGCGGAGCGGGCGCCCTTCCCGG + Intronic
1077048476 11:556205-556227 CGCGGGGCCAGCAGCGTGCCCGG + Exonic
1078378996 11:10822816-10822838 CCCTGGGCGAGCTGCCCTCCAGG - Intronic
1078774447 11:14381433-14381455 GGCGGGGCGGGCGGGCTGCCAGG - Intergenic
1083303696 11:61752379-61752401 TGAGGGGCGCGGGGCCTTCCCGG - Intergenic
1083303715 11:61752430-61752452 TGCGGGGCGCGGGGCCGTCCCGG - Intergenic
1083579102 11:63813569-63813591 CGCGGGGCGGGCGGCGGGCCCGG + Exonic
1083886499 11:65575961-65575983 GGCGGGGCGACCCGGCTTCCGGG - Intergenic
1089585319 11:119506861-119506883 CCCTGGGCGAGCTGCCCTCCAGG + Intergenic
1092861666 12:12724545-12724567 AGCGGGGCGAGAGGCCTCTCAGG + Intergenic
1095878206 12:47104894-47104916 CCCGGGGCGAGCCGGCTTCCTGG - Intronic
1096345519 12:50842889-50842911 CGCGGGGCGCACGGCCTGGCGGG - Intergenic
1096786146 12:54018292-54018314 TGCGTGGCGAGCGGGCATCCCGG - Intronic
1101253889 12:102958778-102958800 CGCGGTGAGCGCCGCCTTCCAGG + Exonic
1104980481 12:132571181-132571203 CACGTGGCGAGCGGCCACCCCGG + Intronic
1111237714 13:85431033-85431055 TGTGGGGAGAGGGGCCTTCCTGG - Intergenic
1119236830 14:73026850-73026872 CGCGGGGCGAGTGATCGTCCTGG - Intronic
1119841944 14:77800042-77800064 CGAGGCGCGCGCGGCCTGCCGGG - Intergenic
1131272435 15:90955339-90955361 CGCTGGGCGGGAGGCCTTTCCGG + Intronic
1132536477 16:483886-483908 CGGGGGACGGGCGGGCTTCCAGG - Intronic
1132884931 16:2178447-2178469 CGCGGCGCGAGCGGCCGGGCAGG - Exonic
1132991823 16:2799315-2799337 AGCTGGGCGAGCTGACTTCCAGG + Intergenic
1137300360 16:47143409-47143431 CGCGGGGCGCGAGCCCTGCCCGG - Intronic
1137476104 16:48811189-48811211 CGCGGGGACGGCGGCCTTCGCGG + Intergenic
1139633726 16:68245601-68245623 CGCGGGCGGGGCTGCCTTCCCGG + Intronic
1140221635 16:73048178-73048200 GGCGGGGCGGGGGGCCTTCGGGG + Exonic
1142403622 16:89873911-89873933 GGCGGGGCGAGCGTCCAGCCGGG + Intronic
1143223705 17:5282543-5282565 CGCGGCGGGCGCGGCCTGCCCGG + Intronic
1145970171 17:28951501-28951523 CGCGCGGCGAGCGCCGATCCCGG - Exonic
1147662123 17:42122393-42122415 CCAGGGGAGGGCGGCCTTCCTGG - Exonic
1148440473 17:47709228-47709250 CGCGGGCTGAGGGGCCTGCCAGG - Exonic
1148603045 17:48908558-48908580 CCCGGGGCGAGCAGCGTTGCTGG + Exonic
1151591484 17:75047355-75047377 CGCGGGGCGTGGGGCCAGCCGGG - Exonic
1152001060 17:77645614-77645636 CGCGGGGCGAGAGCCCTTCCGGG + Intergenic
1152349790 17:79778166-79778188 GGCGGGGCGCGCGGCGGTCCGGG + Exonic
1152742037 17:82022666-82022688 CGCGGGGCGCGCGGCCCGGCCGG + Intronic
1152900401 17:82937790-82937812 GGCAGGGCGAGCGGCCCTGCAGG + Intronic
1154210751 18:12377031-12377053 CGCGGGGCCAGCAGCCGCCCCGG + Exonic
1156099735 18:33578723-33578745 CGCGGGGCGAGCGGCGGGGCCGG - Intronic
1160714981 19:572483-572505 GGCGGGGCGACCGGCGTCCCCGG + Intronic
1161283345 19:3457093-3457115 GGCGGGGCGTGGGGCCTCCCAGG + Intronic
1161401325 19:4067207-4067229 CGCGGGGGGAGCGGGCCCCCCGG + Intergenic
1162733822 19:12734686-12734708 CGGGGCCGGAGCGGCCTTCCCGG - Exonic
1163018708 19:14471733-14471755 CGCGGAGCAGGCAGCCTTCCTGG + Exonic
1163551150 19:17967100-17967122 CGGGGGGCGAGCGCCCGCCCGGG - Intronic
1167292308 19:48630944-48630966 ATCGGTGCGGGCGGCCTTCCTGG - Exonic
1167445834 19:49537084-49537106 CTCGGGACGAGCGGCGTTTCCGG + Exonic
928158126 2:28894942-28894964 CGCGGGGCGGGCGCCTTCCCGGG + Intronic
932771663 2:74503783-74503805 AGCGGGGGGAGAGGCATTCCAGG + Intergenic
935137614 2:100321679-100321701 CGCGGGGCGCGCGGGGCTCCGGG + Exonic
935357629 2:102218757-102218779 CAAGGGGCAAGTGGCCTTCCAGG - Intronic
936531131 2:113277802-113277824 CGCGCGGCGCCCGGCCTGCCCGG + Intronic
938668674 2:133566057-133566079 CTAGGGGCGGGGGGCCTTCCTGG - Intronic
945080762 2:206085237-206085259 GGCGGGGCGGGCGGCCTGGCGGG - Intronic
946622166 2:221572470-221572492 CACGGGGCGCGCGGTCTCCCGGG + Intronic
948875596 2:240825713-240825735 CCCGGGGCGACCAGCATTCCTGG - Intergenic
1171217502 20:23362626-23362648 CACGGGGCCAGAGCCCTTCCAGG - Intronic
1172978982 20:38926920-38926942 CGAGAGGTGAGCGGCCCTCCAGG + Exonic
1175429058 20:58889998-58890020 CGCGGCGCGAGCGGCTCTCTCGG - Intronic
1180080826 21:45486894-45486916 CGTGGGGAGAGCGGCCTGGCAGG + Exonic
1180177628 21:46098197-46098219 CGCGGGCCGAGCGGCTTCCAGGG - Intronic
1182289861 22:29268657-29268679 GGCGGGGCCTGCGGCCTTCGAGG + Intronic
950433875 3:12967352-12967374 CGCGGGGCGAGCGGCCTTCCCGG - Intronic
950452475 3:13073128-13073150 CGCGGGGCGAGTCACATTCCCGG + Intergenic
952416726 3:33096803-33096825 GGCGGGGCGCGCGTCCTTCCAGG - Intronic
954085495 3:48241024-48241046 CGCGCGGCGCGCAGCCTGCCGGG - Intergenic
960057687 3:113286794-113286816 CCCGGGGAGAGCTGCATTCCAGG - Exonic
961827487 3:129606622-129606644 CGCGGCGCGAGGAGCCATCCGGG + Exonic
962770923 3:138609247-138609269 CGCGGGGCGCGGGGCCAGCCCGG + Intronic
966743480 3:183254342-183254364 CGCGGTGGGAGAGGCCTCCCCGG - Intronic
971432602 4:26584128-26584150 CGCGGAGCGAACGGGCTACCGGG - Exonic
981044420 4:140252721-140252743 CGGCGGGCGAGCCCCCTTCCCGG - Intergenic
984667886 4:182448408-182448430 CGCGGGACGCGCTGCCTGCCAGG - Intronic
991198342 5:63961167-63961189 CGGGGTCCGAGCGGTCTTCCGGG + Exonic
998401369 5:141850642-141850664 GGCGGGGCGGGGGCCCTTCCCGG + Intergenic
1002424767 5:179168421-179168443 CAGGGGGCGAGCGGCCTGCCCGG - Intronic
1004193825 6:13487114-13487136 CGCGGGGCTCGCGTCCTTCCCGG + Exonic
1005577055 6:27199771-27199793 AGCGGGGGGAGAGGGCTTCCAGG + Intergenic
1006456242 6:34133542-34133564 CGTGGGGCCAGGGGCCTGCCAGG - Exonic
1007264579 6:40586990-40587012 CGCGGGGCGCCCGGGCTCCCCGG + Exonic
1008378694 6:50819895-50819917 CGCGGGGCGCGCGGCGGGCCAGG + Intronic
1017726550 6:157280348-157280370 TGCGGGGAGAGCGGCCGTCCCGG - Intergenic
1019378831 7:711161-711183 CGCGGGGAGAGAGGCCGACCTGG - Intronic
1019536055 7:1530574-1530596 CGCGGGGCCAGCGGCCCCCCGGG + Intergenic
1022275793 7:28854282-28854304 CGCGGGGCGTGCGGGAGTCCTGG + Intergenic
1027260499 7:76461652-76461674 CCCGGGGCGTGCGGCCTTCTGGG - Intergenic
1027311876 7:76959765-76959787 CCCGGGGCGTGCGGCCTTCTGGG - Intergenic
1029640472 7:101816571-101816593 CGCGGGGCGAGCGGGCGGGCGGG - Intronic
1032074549 7:128830289-128830311 CGCGGGCCGGGCGGCATTCCTGG + Intergenic
1032087495 7:128891575-128891597 CCCAGGGCGTGCTGCCTTCCGGG + Intronic
1033361429 7:140641007-140641029 CGCGCGGCGGGCGTCCTCCCAGG - Intronic
1035476560 7:159148370-159148392 AGCGGGGTGTGGGGCCTTCCAGG - Intergenic
1037845027 8:22275479-22275501 CGTGGGGTGAGCCGCCCTCCCGG + Intronic
1040065545 8:43141128-43141150 CGCGGGGCGAACGCGCGTCCCGG - Intronic
1041910742 8:63086060-63086082 CGCGGGGCGCGCGCTTTTCCCGG - Intergenic
1049264756 8:141661630-141661652 CACGGGCCAAGCTGCCTTCCAGG - Intergenic
1049341400 8:142114488-142114510 GGCGGGGAGCTCGGCCTTCCTGG + Intergenic
1062036609 9:134385347-134385369 CGCGGGGGAAGGGGCCTTCATGG - Intronic
1190319468 X:49171793-49171815 GGCGGGGCGAGGGGGCTTCCGGG + Intergenic
1200163351 X:154020051-154020073 CGAGCGGCGATCGGCCTCCCGGG + Intergenic
1200209904 X:154342525-154342547 AGCGGGGCGGGCGGCCGTCTTGG + Intergenic
1200220948 X:154389567-154389589 AGCGGGGCGGGCGGCCGTCTTGG - Intergenic