ID: 950434162

View in Genome Browser
Species Human (GRCh38)
Location 3:12968386-12968408
Sequence AGCTTGTCATAGGTGCTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 98}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950434162_950434164 23 Left 950434162 3:12968386-12968408 CCTTCAAGCACCTATGACAAGCT 0: 1
1: 0
2: 1
3: 6
4: 98
Right 950434164 3:12968432-12968454 TAGAGTTCTTTAGTGATAGTTGG 0: 1
1: 0
2: 0
3: 7
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950434162 Original CRISPR AGCTTGTCATAGGTGCTTGA AGG (reversed) Intronic
900586293 1:3433795-3433817 AGCCCGTCAGAGGTGGTTGATGG - Exonic
901186697 1:7378167-7378189 AGCTTTACATAAGTGCTGGAGGG + Intronic
901945878 1:12703154-12703176 AGCTTTCCATAGGGGCTGGATGG + Intergenic
903762221 1:25706747-25706769 AGCCTGTCTTAAGTGCTTGCAGG - Intronic
905093896 1:35452318-35452340 AGGGTGTCCTAGGTGCTTGATGG - Intronic
910786692 1:91006661-91006683 AGCTTGGGATAGGAGGTTGAAGG - Intronic
913281365 1:117188119-117188141 AGCTTGTAATGTGTTCTTGATGG + Intronic
917699627 1:177567199-177567221 AACATGTTAGAGGTGCTTGAGGG - Intergenic
918068099 1:181115216-181115238 AGCTTGCAACAGGTGCTAGAGGG + Intergenic
918480122 1:184969525-184969547 AGCTGGTCAGTGATGCTTGAGGG - Intronic
924591083 1:245405169-245405191 AGCTTGTCACAGTTGCTTCCCGG - Intronic
1063421620 10:5916779-5916801 ACCTGGTCATAGGAGGTTGAAGG + Intronic
1063477297 10:6340504-6340526 AGCTCATCATGGGTGCTTTATGG + Intergenic
1065226454 10:23548550-23548572 GGCTTCTCATCAGTGCTTGAGGG + Intergenic
1068387222 10:56346969-56346991 ACCTTCTCATAGGTTCTTCAAGG + Intergenic
1069694245 10:70375182-70375204 AGATTGTCATTGGTGTTGGAGGG - Intronic
1072397510 10:95060179-95060201 AGAAAGTCATTGGTGCTTGATGG + Intronic
1073495461 10:103886958-103886980 AGCCTGTCTTAGGTCCCTGAAGG - Intronic
1074110980 10:110422760-110422782 AGCTGGGCATTGGAGCTTGAGGG + Intergenic
1074736306 10:116437629-116437651 AGCTTTTCAGAGATGCTTTAGGG + Intronic
1074737151 10:116447227-116447249 AGCTTATTCTAGATGCTTGAGGG + Intronic
1077404439 11:2376949-2376971 AGATTGTCCAAGGTGCTTGAGGG + Intronic
1079601872 11:22319098-22319120 ACCCTGTTATAGGTGGTTGATGG - Intergenic
1081216621 11:40407045-40407067 AGGTTTTCATAGAAGCTTGAAGG + Intronic
1082705962 11:56495819-56495841 TGCTGGTCAGAGGTGCTTTAAGG + Intergenic
1089481457 11:118808583-118808605 AGGATGTCAAAGGGGCTTGAAGG + Intergenic
1093068012 12:14679050-14679072 AGCTTATCAGAGGTGGTTGAAGG + Intronic
1093190519 12:16069416-16069438 AGCCTGCCATAGATGCTTGAAGG + Intergenic
1093747581 12:22760812-22760834 AGCTTGTCATAGGTGCTTTTGGG - Intergenic
1094207855 12:27859644-27859666 AGAGAGTCACAGGTGCTTGAAGG - Intergenic
1095334387 12:41008709-41008731 AGCATGTCATAGATGGTTCATGG - Intronic
1099822603 12:87732163-87732185 TGCTTGGCATAGCTGCTTAATGG - Intergenic
1104111996 12:125712844-125712866 AGCTTGCCAGAGCTGCTTGAAGG + Intergenic
1106604633 13:31216507-31216529 TGCATGTCATAGGGGTTTGATGG + Intronic
1112118112 13:96379548-96379570 ATCTTGTCATAGCAGCTGGAAGG + Intronic
1119890159 14:78176606-78176628 ATCTTGTCATTTGTACTTGAGGG - Intergenic
1123718520 15:23045641-23045663 AGCTGGCCAGAGGTGCTAGAGGG + Intergenic
1125119088 15:36131773-36131795 AGCTTGTGTTAGGTGATTGAGGG - Intergenic
1126643160 15:50848838-50848860 AGCTTGAAATAGGTTATTGAGGG - Intergenic
1127244907 15:57162115-57162137 ATTTTTTCATAGGTGCTTCAAGG + Intronic
1127457178 15:59165687-59165709 AGCTTTTCATAAGTGCTTTTTGG - Intronic
1130832586 15:87616632-87616654 ACCTTGTTACAGGTACTTGATGG - Intergenic
1131662024 15:94527687-94527709 ACATTATCATAGGTGCTTGTTGG + Intergenic
1153251395 18:3125878-3125900 TGCTTGTTATAGTCGCTTGATGG - Intronic
1153383651 18:4467862-4467884 AGATTATACTAGGTGCTTGAAGG + Intergenic
1153951945 18:10064957-10064979 AGATGGACATAGGTGCTGGATGG + Intergenic
1155820929 18:30375321-30375343 AGCTTGTCATATTTTCCTGATGG + Intergenic
1159701212 18:71630528-71630550 TGTTTGTCATCAGTGCTTGATGG - Intergenic
1160061162 18:75530311-75530333 AGCTTGTGAAAGGAGCTGGATGG + Intergenic
1166418340 19:42612598-42612620 ATCTTGTCATATGCCCTTGAGGG + Intronic
1166428387 19:42700221-42700243 ATCTTGTGATATGTCCTTGAGGG + Intronic
1167225751 19:48238563-48238585 AGCATGTCAGAGGAGCTCGATGG + Intronic
927284305 2:21340510-21340532 AGAAAGTCATTGGTGCTTGATGG - Intergenic
932050820 2:68396027-68396049 AGCTTGTTATATCTGCTTGGGGG - Exonic
932903643 2:75726831-75726853 AGTTTGTCTTAGATGATTGACGG - Intergenic
936263748 2:110983618-110983640 AACTTGTGATAGGTGATTGTGGG - Intronic
937437371 2:121891646-121891668 TGCTAGTCACAGGTGATTGATGG - Intergenic
939989899 2:148867643-148867665 AGTCTGTCAGTGGTGCTTGAAGG - Intergenic
944534487 2:200695822-200695844 TGCTTTTCATAGGTTCCTGAGGG - Intergenic
948555712 2:238809494-238809516 AGTTTGTGATAGGGGCTAGAAGG - Intergenic
1171193071 20:23174541-23174563 AGCATGTCATAGGTGGTTTGTGG - Intergenic
1172895906 20:38299931-38299953 AGCTTGTGGTAGATGCTGGAGGG - Intronic
1175630829 20:60535081-60535103 AGCTTGTTAAAGGTGATGGAGGG + Intergenic
1182836646 22:33347534-33347556 AGCTTGTCATTTTTTCTTGAAGG + Intronic
949393620 3:3590889-3590911 AGCTTGTCAAAGTCCCTTGATGG - Intergenic
950434162 3:12968386-12968408 AGCTTGTCATAGGTGCTTGAAGG - Intronic
950956284 3:17056870-17056892 AGCTTGAACTAGGGGCTTGAGGG + Intronic
954130688 3:48559231-48559253 AGCTGGACATAGGGCCTTGAAGG - Intronic
960335051 3:116407251-116407273 TGCTTCACATAGGTGTTTGATGG - Intronic
961133963 3:124493370-124493392 TGCTTATCATAGGTGAATGAAGG - Intronic
962264794 3:133937172-133937194 AGCCTATCCTAGGTGCTGGATGG + Intronic
963286801 3:143441549-143441571 AGGTTGTCCTAAATGCTTGAAGG - Intronic
966415659 3:179687141-179687163 AGCATTTCATAGGTACTTCAAGG + Intronic
968874203 4:3256734-3256756 AGGTTGTGATAAGTGCTGGAAGG + Intronic
971572639 4:28232531-28232553 TGCTTGTCTAAGGTGTTTGATGG - Intergenic
971939222 4:33192345-33192367 TGCTTGTCATAGGTACTCGCAGG - Intergenic
976596592 4:86900829-86900851 AGCTTGTCAGAGGTGGTGCAGGG - Intronic
978312892 4:107405324-107405346 AGCTTATCCTTGCTGCTTGAAGG + Intergenic
981673746 4:147316768-147316790 AGCTTGTCACAGAGGCTTGCAGG + Intergenic
985197193 4:187443944-187443966 AGCTTGTTATAGCTCCTTTAAGG + Intergenic
989713141 5:44425535-44425557 TGCTTGTCACTGGTGCTTAAAGG + Intergenic
997735435 5:136209422-136209444 GGGTTGTCCTAGCTGCTTGACGG + Intergenic
998404151 5:141864157-141864179 AGCTTGTGAGAGGTGTTAGAAGG + Exonic
1000122791 5:158213255-158213277 AGCATCTCATAGGGCCTTGAAGG - Intergenic
1002044599 5:176534863-176534885 GGCTAGTCATGGGTGCTTTATGG - Intronic
1004698385 6:18055602-18055624 AGCTTGTAAGAGGTGGTGGAAGG - Intergenic
1005637673 6:27766995-27767017 AGCCTGTCATAGCTGCTAAATGG - Intergenic
1008110802 6:47492164-47492186 ATTTTGTCATAGCAGCTTGAAGG - Intronic
1010548598 6:77190979-77191001 AGCTTTTCTTATGTGCTTGTTGG + Intergenic
1012041253 6:94206704-94206726 AGCTTGACAGAGATGTTTGAAGG - Intergenic
1015307522 6:131726351-131726373 AGGTTGTTATAGGTGCTACACGG + Intronic
1017604363 6:156117870-156117892 AGCTTGTCTTTGGTGCCTGGTGG - Intergenic
1017651614 6:156588586-156588608 AGCTTGTCATTGGTGCCTTTTGG - Intergenic
1019787324 7:2985403-2985425 AGCTCGGCATAGGAGCTTAAGGG + Intronic
1030218966 7:107077581-107077603 TCCATGCCATAGGTGCTTGATGG - Intronic
1033966633 7:146983117-146983139 AGGTTGGCATAGATGGTTGAAGG - Intronic
1041789832 8:61682438-61682460 AACTTATCAGAGGTGCTTCAAGG - Intronic
1041953830 8:63535436-63535458 AGCTTTTCATAGCTTCTTCATGG + Intergenic
1052040545 9:23733886-23733908 AGCTAGTCATGATTGCTTGAGGG - Intronic
1055551304 9:77434430-77434452 ATCTTGCCAGAGCTGCTTGATGG + Exonic
1060439965 9:123629075-123629097 AGATTGTCCAAGGAGCTTGAAGG - Intronic
1186763917 X:12751107-12751129 AGCTGGCCATAGCTGCATGATGG + Intergenic
1189543724 X:42020141-42020163 TGCTTATCATAGGTCCTGGATGG + Intergenic
1195990056 X:110673279-110673301 AGCTAGTATTGGGTGCTTGAGGG + Intergenic
1196465658 X:115969216-115969238 AGCCAGTCGTAGGTGCTTAAAGG + Intergenic
1201338344 Y:12904403-12904425 AGCTTGTCAAAGGTAGGTGACGG + Exonic