ID: 950439556

View in Genome Browser
Species Human (GRCh38)
Location 3:13001292-13001314
Sequence AAGTGCCCACAAGCCAGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 174}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950439556_950439557 -8 Left 950439556 3:13001292-13001314 CCTGTGCTGGCTTGTGGGCACTT 0: 1
1: 0
2: 0
3: 9
4: 174
Right 950439557 3:13001307-13001329 GGGCACTTGATAGATGCATGAGG 0: 1
1: 0
2: 1
3: 6
4: 140
950439556_950439559 18 Left 950439556 3:13001292-13001314 CCTGTGCTGGCTTGTGGGCACTT 0: 1
1: 0
2: 0
3: 9
4: 174
Right 950439559 3:13001333-13001355 GACATTTCATGTTCCCTATCTGG 0: 1
1: 0
2: 0
3: 10
4: 134
950439556_950439558 -4 Left 950439556 3:13001292-13001314 CCTGTGCTGGCTTGTGGGCACTT 0: 1
1: 0
2: 0
3: 9
4: 174
Right 950439558 3:13001311-13001333 ACTTGATAGATGCATGAGGTTGG 0: 1
1: 0
2: 2
3: 19
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950439556 Original CRISPR AAGTGCCCACAAGCCAGCAC AGG (reversed) Intronic
900439119 1:2644566-2644588 AGCTCCCCGCAAGCCAGCACAGG - Intronic
901639471 1:10686107-10686129 AAGGGCCCCCCACCCAGCACGGG + Intronic
902689856 1:18104200-18104222 AAGTGTCCACACACCAACACAGG - Intergenic
902958691 1:19945704-19945726 AAGTTCCCAAAGCCCAGCACAGG - Intergenic
905529651 1:38667493-38667515 GAGTGCCCACAGTCCAGTACTGG - Intergenic
905669138 1:39779530-39779552 AAGTGCACACAATGCAGGACAGG + Intronic
906447315 1:45913619-45913641 AAGAGCCCACGAGGCAGCAGTGG - Intronic
908930881 1:69315125-69315147 GAGTGCCCAGATGCCAGCAGTGG + Intergenic
909746185 1:79100035-79100057 ACATGCCCAAAAGCCAGCCCTGG - Intergenic
917406534 1:174712851-174712873 AAGAGCACACCAGCAAGCACTGG - Intronic
918108806 1:181437762-181437784 GAGGGCCCAGAAGCCAGCCCTGG - Intronic
918418091 1:184333343-184333365 AAGGGGCCACAAGCCAAGACAGG + Intergenic
920532668 1:206715370-206715392 AACTGCCCATGAGCCAGGACAGG - Intronic
922675596 1:227547153-227547175 AAGTCCTCACAGGCCAGCCCTGG - Intergenic
922776321 1:228215749-228215771 AGGTGCCCGCCAGCCTGCACGGG + Exonic
924776033 1:247114862-247114884 AAGTCCCCACAGGCCAGCCCTGG - Intergenic
1063114623 10:3065286-3065308 ACGTGCGCACATGCAAGCACAGG + Intergenic
1063894267 10:10662705-10662727 AAGTGCAAACAAACCAGCAATGG + Intergenic
1064682136 10:17821068-17821090 AAGTGCAGAGAAGCCAGCAGAGG + Intronic
1069592426 10:69650398-69650420 AAGGGGCCGCAAGCTAGCACTGG - Intergenic
1070579822 10:77710914-77710936 AAGTGCCCTTAAACCAGCCCGGG - Intergenic
1071688702 10:87792131-87792153 AAGTTCCCACATGCCAGCCAAGG - Intronic
1072043283 10:91629979-91630001 AAGAGCCCACTAGCCAGCCTCGG + Exonic
1072720383 10:97777276-97777298 AAGTGCTCAGAATTCAGCACAGG - Intergenic
1072989695 10:100180323-100180345 AAGAGTTCACAATCCAGCACAGG + Intronic
1074247986 10:111713904-111713926 GAGCACCCACAGGCCAGCACCGG + Intergenic
1075585779 10:123657023-123657045 TTGTGCCCTCAAGCCAGGACTGG - Intergenic
1075585876 10:123657774-123657796 CAGTGCCCAGAGGCCAGCTCTGG + Intergenic
1076023038 10:127089756-127089778 CGGTGTCCACACGCCAGCACTGG - Intronic
1077022813 11:426754-426776 CAGTGCCCCCAAGCCACCAGGGG - Intronic
1077675517 11:4190738-4190760 GGGTTCCCACAAGCCACCACGGG - Intergenic
1079097683 11:17521377-17521399 AATTGCCCAGAAGGCAGCAGAGG - Exonic
1079715207 11:23734938-23734960 AAATGCCCACAAGCGAGAGCAGG + Intergenic
1080075309 11:28140835-28140857 AAGTGCCCACACGCCCACAGGGG - Intronic
1083618692 11:64038504-64038526 TAGAGCCCAGAGGCCAGCACGGG + Intronic
1085884706 11:80508130-80508152 AAGTGCCCACAAGACAAAGCAGG + Intergenic
1099035792 12:77585752-77585774 AACAGGCCACAAGCCAGTACTGG + Intergenic
1101898776 12:108775649-108775671 AACTGCCCTGAAGCCAGCCCTGG + Intergenic
1105070959 12:133234357-133234379 GAGTGGCCACGACCCAGCACAGG - Exonic
1107944970 13:45410081-45410103 ATGTGTCCCCAACCCAGCACAGG + Intronic
1109754114 13:66736412-66736434 AGGTGCCCACAGGCCAGCCAAGG + Intronic
1112650770 13:101394864-101394886 CTGAGCCCACAACCCAGCACAGG - Intronic
1116015237 14:39398603-39398625 AAGTGCCCACATGCTGGCAGGGG - Exonic
1118719411 14:68583694-68583716 CAGTGCCCTCAAGCCACCCCTGG + Intronic
1120504228 14:85334753-85334775 AATTCCCTTCAAGCCAGCACTGG + Intergenic
1120994397 14:90405685-90405707 AAATGCCCACAGCCCAGCATTGG + Exonic
1128380016 15:67105630-67105652 AAGTGCCAAAAATGCAGCACAGG - Intronic
1129767948 15:78182172-78182194 CAGTGTCCACAAGCCAGCCCTGG + Intronic
1133260023 16:4543053-4543075 AAGCGCACACAGTCCAGCACGGG + Intergenic
1135041595 16:19121689-19121711 AAGGAACTACAAGCCAGCACAGG - Intronic
1135814009 16:25615543-25615565 AAGTGCACAAAGGCCAACACAGG + Intergenic
1136517791 16:30778292-30778314 AGCTTCCCACAAGCCAGCAATGG + Intergenic
1138652191 16:58466922-58466944 AGGTGCCAACCAGCCAGGACAGG - Intronic
1145761372 17:27426949-27426971 ACGTGCCCACAGGCCAGACCTGG - Intergenic
1145798158 17:27667754-27667776 AGGTGCCCACAGGCCAGACCTGG + Intergenic
1145924779 17:28638335-28638357 CACTGCCCACACGCCAGCAGAGG + Exonic
1146161423 17:30561105-30561127 ACGTGCCCACAGGCCAGACCTGG - Intronic
1147565812 17:41535959-41535981 AAGGGCCCAGCAGCCAGGACAGG + Intergenic
1148823974 17:50378566-50378588 AAGTACCCAGAACACAGCACAGG - Intronic
1149225246 17:54463008-54463030 AAATGCCCACAAGAGAACACAGG - Intergenic
1150478581 17:65492186-65492208 AGGTGCCCACAGGACAGCAAGGG + Intergenic
1151312278 17:73300525-73300547 AAGTGCTCAGAAGCCAGAAGTGG - Intronic
1151355391 17:73555128-73555150 AAGTGCCCATAGCCCAGCTCGGG - Intronic
1152888480 17:82866519-82866541 AGGGCCCCACACGCCAGCACAGG - Intronic
1155496628 18:26449110-26449132 AAGTGAACAGAAACCAGCACAGG - Intergenic
1157510159 18:48265565-48265587 CTCTGCCCACAGGCCAGCACTGG - Intronic
1158011801 18:52737271-52737293 AAGACCCCACAAGACACCACTGG + Intronic
1159105979 18:64002607-64002629 CAGTGCGCTCAAGCCAGCCCTGG + Intronic
1160767617 19:815399-815421 CAGTGCCCACAGGCTGGCACAGG + Intronic
1163524329 19:17811452-17811474 AAGTGTCCACAATCCAGCCTGGG - Intronic
1164554871 19:29243662-29243684 AAGATCCCAGAAGCCAGCTCTGG - Intergenic
1164829918 19:31312470-31312492 AAGTCCCCTCCAGCCAGCAATGG - Intronic
1166136475 19:40780205-40780227 AAGGACCAAAAAGCCAGCACTGG - Intronic
1166228057 19:41409432-41409454 AGGTCCCCAGAACCCAGCACAGG + Intronic
1166491868 19:43267321-43267343 AAGAAGCCACAACCCAGCACTGG + Intronic
1167496776 19:49824081-49824103 AAGTGCCTGGCAGCCAGCACAGG + Intronic
1168094349 19:54106056-54106078 AACTGCCCTTACGCCAGCACAGG - Intronic
1168394456 19:56036553-56036575 TGGTGCTCACAGGCCAGCACAGG + Intronic
926508864 2:13748176-13748198 AAGTGCCAACAAGACAAAACAGG + Intergenic
927090929 2:19711957-19711979 AAGAGGCCACCAGCCAGCCCAGG - Intergenic
928330698 2:30355913-30355935 AATTGTCCACCAGCCAGAACAGG + Intergenic
929943553 2:46353204-46353226 AAGTCACCACCTGCCAGCACAGG + Intronic
931933102 2:67163311-67163333 ATGTGTCCAGAAGCCAGCAATGG - Intergenic
933712862 2:85340362-85340384 AACTGCCAACACGCCAGCCCCGG + Intergenic
935132965 2:100275050-100275072 AAGTGCAAACATGCCAGCAGCGG - Exonic
935692461 2:105744320-105744342 AAATGCCCACAAGCAATTACAGG + Intergenic
936093966 2:109517739-109517761 AAGTGCCCACCGTGCAGCACAGG + Intergenic
939996949 2:148928645-148928667 TAGTGCTAACAAGCCAGCCCAGG - Intronic
940903494 2:159147623-159147645 CAGTGGCCCCAAGCCAACACAGG - Intronic
943789065 2:191911395-191911417 TAGTTCTCACAACCCAGCACAGG - Intergenic
945940717 2:215946745-215946767 TAGTGCCCACATGACTGCACTGG + Intronic
946328112 2:218995212-218995234 AAGTGCTCACAGGCCAGCTGCGG + Intergenic
947474089 2:230427066-230427088 AAGTGACCAAAAGACAGCAGAGG - Intronic
948640405 2:239372249-239372271 AAAGGCCCTCAAGCCGGCACTGG + Intronic
948809302 2:240466698-240466720 CAGAGCCCACCAGCCAGCCCTGG + Exonic
948845589 2:240681439-240681461 CACTGCCCACGACCCAGCACTGG - Intronic
948848266 2:240693291-240693313 CACTGCCCACGACCCAGCACTGG + Intronic
948901278 2:240957976-240957998 AAGGCTCCAGAAGCCAGCACTGG - Intronic
1168837298 20:885718-885740 AGATGCCCAAAAGCCAGGACTGG + Intronic
1173406088 20:42766487-42766509 AATTCCACAAAAGCCAGCACCGG + Intronic
1173784337 20:45781854-45781876 AAGTTCCCAGAAGCCAGCCAAGG + Intronic
1176452267 21:6874164-6874186 TATTCCCTACAAGCCAGCACAGG + Intergenic
1176830439 21:13739213-13739235 TATTCCCTACAAGCCAGCACAGG + Intergenic
1179510539 21:41870356-41870378 AAGTGCTCAGAAGCCAGCCCTGG + Intronic
1180865575 22:19117239-19117261 AAGTGCCCACAAGCTAGCTTGGG + Intronic
1183284927 22:36955969-36955991 AAGTTCCAACAAGCCAGAATAGG + Intergenic
1184551194 22:45205043-45205065 ACCTGCCCACAAGCAAACACTGG + Intronic
1184848299 22:47102436-47102458 CAGTGGCCACAGGCCAGCCCTGG - Intronic
1184916102 22:47570037-47570059 AAGTGCCCAGGCACCAGCACGGG - Intergenic
950439556 3:13001292-13001314 AAGTGCCCACAAGCCAGCACAGG - Intronic
952886632 3:38016445-38016467 CAGTGTCCACAAGCCAGGCCTGG + Intronic
953128176 3:40111646-40111668 CAGAGCCCACAAGCCAGGCCTGG - Intronic
953819105 3:46188942-46188964 CAGTGTGCACAAGCCACCACAGG - Intronic
954642840 3:52112122-52112144 AAGGGCCCACGGGGCAGCACTGG + Intronic
957221570 3:77389401-77389423 AAGTAGCCACAAGCCCGCATGGG - Intronic
958951768 3:100424710-100424732 AAGTTCCCAGAAGCCAGCTAAGG + Intronic
959945972 3:112125652-112125674 AAAGGCTCACAAGCTAGCACAGG + Intronic
962350132 3:134650580-134650602 AAGCACCCACAGGCCTGCACAGG + Intronic
962678640 3:137775911-137775933 AAGTGCCATCAGGCCAGCCCTGG + Intergenic
965654766 3:170972557-170972579 AAGTGCCCACAAGAGAGAGCAGG - Intergenic
966932067 3:184681947-184681969 ATCTGCCCACAACCCAGCCCAGG - Intronic
968441122 4:625082-625104 AAATGCCCAGAGGCCAGCAAGGG - Intergenic
970222992 4:13829597-13829619 AAGAGCACACATGCCAGCTCAGG - Intergenic
970483220 4:16498706-16498728 AAGCAGCCACAAGCCAGCCCAGG - Intergenic
970644537 4:18105453-18105475 AAGTGTTCACAAGCAATCACGGG - Intergenic
970705403 4:18795550-18795572 AAGAGCACACATGCCAGCTCTGG + Intergenic
973554191 4:52065816-52065838 AAATGGCCACAAGTCTGCACAGG + Intronic
973709610 4:53615345-53615367 CAGTGCCCCAAAGCCAGCCCAGG - Intronic
976779035 4:88738263-88738285 AAGAGCCTAAAAGCCAGCAGAGG + Intronic
982208945 4:153019608-153019630 AGGTGTCGACAAACCAGCACGGG + Intergenic
983323420 4:166224705-166224727 AAGAGCCCACAAGGCAGGACAGG - Intergenic
985763621 5:1764924-1764946 CTGTGCCAACCAGCCAGCACAGG - Intergenic
986560494 5:9056068-9056090 AAATGCGCACAAGGCAGCTCAGG + Intronic
986591220 5:9372951-9372973 AGTGGCCCACAAGACAGCACGGG + Intronic
992306124 5:75440417-75440439 ATTTGCCCACAAACCACCACGGG + Intronic
993372699 5:87112140-87112162 AATTGCCCACAAATCAGGACAGG + Intergenic
995015208 5:107302110-107302132 AAGTCCCCCCACGCCAGCATGGG + Intergenic
995469040 5:112480740-112480762 GAGTGTCCAAAAACCAGCACAGG - Intergenic
997410329 5:133686035-133686057 AGGCGCCCACAGGACAGCACAGG + Intergenic
998391306 5:141788682-141788704 AGGTGCCCACCAGCCACCATCGG + Intergenic
1001724677 5:173887232-173887254 AAGAGCCCACGGTCCAGCACAGG + Intergenic
1002245760 5:177883491-177883513 GAGAGCCCACAAGCCAGCGGAGG - Intergenic
1006086674 6:31600608-31600630 AAAAGTCCACAATCCAGCACAGG + Intergenic
1006899083 6:37488596-37488618 AAGTGCCCAGAAGCCTGGAATGG + Intronic
1008221719 6:48862535-48862557 AGGTACCCACAAGCCATCTCAGG - Intergenic
1009394204 6:63178410-63178432 AAGTGCCCAGATGCCAGCCAAGG + Intergenic
1009496886 6:64360366-64360388 AAGTGAACACAGGCCATCACTGG + Intronic
1019702046 7:2478752-2478774 AAGGGCCCAGAAGTCAGAACTGG + Intergenic
1021625580 7:22589936-22589958 TACTGACCACAAGCCAGCACTGG + Intronic
1021890537 7:25181803-25181825 AATTGTCCTAAAGCCAGCACAGG + Intergenic
1022886646 7:34653548-34653570 CAATGCCCACAAGGCAGCATTGG + Intergenic
1023205125 7:37740797-37740819 CAGCGTCCACATGCCAGCACTGG - Exonic
1026468370 7:70673706-70673728 GAGAGCTCACAATCCAGCACTGG - Intronic
1026989069 7:74573007-74573029 AAGTCCCCACCAGCCAGAAAAGG - Intronic
1026999683 7:74643707-74643729 AGGTGCCCACAGGCCACCAAAGG + Intergenic
1029988654 7:104943570-104943592 CGGTTCTCACAAGCCAGCACTGG - Intergenic
1033380984 7:140818593-140818615 ATGAGCCAACACGCCAGCACCGG + Intronic
1034259223 7:149744336-149744358 ACGTGCACACAAGCCAGCCTAGG - Intergenic
1034398654 7:150846932-150846954 AAGTTCCCAGATGCCAGCCCAGG + Intronic
1035573636 8:690331-690353 CTGTGCCCAAAAGCCAGGACAGG - Intronic
1037382370 8:18300111-18300133 CAGTGCCCACAAAACAGCAAAGG + Intergenic
1039855408 8:41407819-41407841 AGGTGCACACAAGCCTGCAGGGG - Intergenic
1040310594 8:46234777-46234799 AGGCGCCCACAAGCGAACACGGG + Intergenic
1040314272 8:46252729-46252751 AAGCCCCCACAAGCCAAAACAGG + Intergenic
1040336358 8:46418083-46418105 AGGTGCCCACAAGCAAAAACTGG + Intergenic
1040953908 8:52961060-52961082 AAGTGCCCACGAGTCAGTCCAGG - Intergenic
1047202684 8:122780453-122780475 AAGAGTCCACAGGCCAGCCCAGG + Intergenic
1049081957 8:140450462-140450484 TAGTGCCCAAAAGCCACAACTGG + Intronic
1049463375 8:142740158-142740180 AGGTGCCCACAAGACCCCACGGG + Intergenic
1049579328 8:143404307-143404329 AGGTGCCCACAACCCAGAGCGGG + Intergenic
1049960571 9:734333-734355 AAGTGGCCCCAAGCCAGCCCAGG - Intronic
1051372158 9:16367825-16367847 CAGGGCCCACAAGCCAACACTGG + Intergenic
1055423008 9:76163308-76163330 AAGTGCCCGTCAGCCAGGACAGG - Intronic
1056591703 9:87970011-87970033 AAGGCCCCACAAGCCAGCCCTGG + Intronic
1057930180 9:99186126-99186148 ATGGGCCCAGGAGCCAGCACAGG - Intergenic
1059791423 9:117645190-117645212 AAGTGGCAACAAGGCACCACAGG - Intergenic
1060407895 9:123381822-123381844 AGGGGCACAGAAGCCAGCACTGG + Exonic
1060612500 9:124980404-124980426 AAGTTCCCAGAAGCCAGCCAGGG - Intronic
1061217760 9:129231603-129231625 CAGTGCCCCCAAGCCAGGGCAGG - Intergenic
1203516914 Un_GL000213v1:10351-10373 TATTCCCTACAAGCCAGCACAGG - Intergenic
1188067479 X:25679789-25679811 GAGTGTCCACAAGCCACAACAGG + Intergenic
1188440271 X:30209269-30209291 AAGTGCTTACAAGACAGGACAGG + Intergenic
1190415709 X:50178524-50178546 CACTGCCCAGAAGCCAGCCCAGG + Intergenic
1199297616 X:146176900-146176922 AGGGGCCCAGAAGTCAGCACTGG + Intergenic